Application of gene cluster in rapid detection of vibrio vulnificus and detection primer probe set thereof

Abstract

The invention belongs to the technical field of marine organisms, and particularly relates to application of a gene cluster in rapid detection of vibrio vulnificus and a detection primer probe set of the gene cluster. The primer is a complete set of primer combination corresponding to three gene loci, and consists of upstream and downstream primers and a probe primer; the upstream primer is as shown in SEQ ID NO. 1; the downstream primer is as shown in SEQ ID NO. 2; and the probe primer is as shown in SEQ ID NO. 3. Aiming at the current vibrio vulnificus, a corresponding RPA amplification detection primer is designed according to three specific gene loci obtained through screening, a test strip RPA detection system and method of the vibrio vulnificus are established, and the technology has an important value for on-site rapid screening and detection of the vibrio vulnificus in aquatic product culture, import and export trade and bathing beach, and has a wide application prospect. The market application prospect is wide.

Description

Technical Field

[0001] The present invention belongs to the field of marine biotechnology, and particularly relates to the application of a gene cluster in the rapid detection of Vibrio vulnificus and its detection primer-probe group. Background Art

[0002] Vibrio vulnificus ( Vibrio vulnificus ) is a Gram-negative halophilic marine vibrio, widely distributed in seawater and seafood, and is listed as one of the three pathogenic vibrios defined by the US Centers for Disease Control and Prevention (CDC) together with Vibrio cholerae and Vibrio parahaemolyticus. Its infection can cause serious complications such as septicemia, necrotizing fasciitis, myositis and gangrene, with a fatality rate as high as 50%. Due to its extremely high pathogenic risk, it is listed as one of the most dangerous pathogenic bacteria in the world. Although the infection probability of healthy people is relatively low, this bacterium can still invade the human body through swallowing seawater or minor wounds. Ingesting a small amount of bacteria usually does not cause symptoms, but if signs such as limb swelling, pain or bruise patches appear after infection, immediate medical attention is required to avoid the deterioration of the condition. In addition, Vibrio vulnificus can also cause "gastrointestinal type" infections, manifested as non-specific symptoms such as nausea, vomiting, diarrhea and abdominal pain, which are easily confused with other digestive tract diseases and delay diagnosis.

[0003] The rapid and accurate detection of Vibrio vulnificus is a technical problem that urgently needs to be broken through in the fields of public health and food safety. The current mainstream detection technologies have the following key defects, which urgently need to be solved through technological innovation: Traditional methods mainly rely on the bacterial culture method, which takes 48-72 hours to complete enrichment, isolation and biochemical identification. This method is not only cumbersome to operate, but also has low sensitivity (the detection limit is about 10³ CFU / mL), and it is difficult to meet the screening requirements for early infections or low-load samples (such as asymptomatic carrier seafood). In addition, the culture method has strict requirements for laboratory conditions and cannot adapt to on-site detection scenarios in aquaculture farms, ports or remote areas. Although PCR and real-time fluorescence quantitative PCR technologies have significantly improved the detection sensitivity (up to 10¹ CFU / mL), they rely on thermal cyclers, fluorescence signal reading devices and professional operators. The cost of single detection is high, and it is difficult to promote in areas with limited resources. Existing molecular detections mostly target single genes (such as VvhA, gyrB or virulence gene RtxA), but these genes are prone to false positives / false negatives due to horizontal transfer or intraspecies variation. Such limitations severely restrict the clinical and regulatory credibility of the detection results. Portable detection solutions of "sample in - result out" are urgently needed in aquaculture, food processing and clinical first aid scenarios. Summary of the Invention

[0004] Aiming at the disadvantages of the existing technology, the present invention provides the application of a gene cluster RsxG-HutX-DsbC in the rapid detection of Vibrio vulnificus.

[0005] The present invention also provides a primer-probe set for detecting Vibrio vulnificus based on the above gene cluster RsxG-HutX-DsbC.

[0006] The technical solution adopted by the present invention to achieve the above object is as follows: The present invention provides an application of a gene cluster RsxG-HutX-DsbC in the rapid detection of Vibrio vulnificus. In the gene cluster, the sequence of RsxG is as shown in SEQ ID NO.1; the sequence of HutX is as shown in SEQ ID NO.2; and the sequence of DsbC is as shown in SEQ ID NO.3.

[0007] Another object of the present invention is to provide a primer-probe set for detecting Vibrio vulnificus based on the gene cluster RsxG-HutX-DsbC. The primer-probe set is specifically as follows: RsxG-F (SEQ ID NO.4): CCACACGTAATGGCCAAGCCACCACCATTGCTATT; RsxG-R (SEQ ID NO.5): biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC; RsxG-Probe (SEQ ID NO.6): FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3; HutX-F (SEQ ID NO.7): ATTTTGGACCAGTGACAACCATCGTACACGCGTTC; HutX-R (SEQ ID NO.8): biotin-TAAATAGATCTTAAAAATGTTCTCACCAGAGGTCG; HutX-Probe (SEQ ID NO.9): FAM-TATTACAACCTAATGGGCAAACAGGGTGAGC / idSp / GCACGGCCATCTCAAG -SpC3; DsbC-F (SEQ ID NO.10): TTCAAAGTTGGACCTGAACATCATGGATATTCAAC; DsbC-R (SEQ ID NO.11): biotin-ATTTTCTTCGCGTTGAGCGGTGCTTGACGTTCAGC; DsbC - Probe (SEQ ID NO.12): FAM - AATTCAAACCAGTGGAGGAGTGTTGTTTGCG / idSp / CTAACGACGGCAGCCA - SpC3; Wherein, biotin represents biotin labeling; FAM represents fluorescein labeling; SpC3 represents Spacer C3 modification; idSp represents a gap.

[0008] The present invention further provides the application of the above primer - probe set in the preparation of a kit for rapid detection of Vibrio vulnificus, including the following steps: (1) Performing a nucleic acid isothermal amplification reaction on the extracted and purified DNA using PRA reagent; (2) Analyzing the RPA amplification product using a colloidal gold lateral - flow immunochromatographic test strip and reading the result of the test strip.

[0009] Preferably, the specific process of the nucleic acid isothermal amplification reaction is as follows: 15 μL of hydrolysis buffer, 1.0 μL of upstream primer 10 μM, 1.0 μL of downstream primer 10 μM, 0.3 μL of probe primer 10 μM, 2 μL of DNA template, 5.5 μL of ddH 2 O and 1.2 μL of magnesium acetate 280 mM, and incubating at a constant temperature of 37 °C for 15 min.

[0010] Preferably, in step (2), the specific process is: adding 5 μL of the RPA amplification product to 95 μL of diluent for dilution, and then dropping the diluted RPA amplification product onto the sample - adding end of the colloidal gold lateral - flow immunochromatographic test strip and reading the result of the test strip.

[0011] Preferably, after reading the result of the test strip, the determination condition is: a sample with positive control lines on all three test strips and also positive detection lines is determined as a positive sample; a sample with positive control lines on all three test strips and negative detection lines is determined as a negative sample.

[0012] The gene clusters provided by the present invention: RsxG, an electron transport complex subunit; HutX, a heme - utilization cytoplasmic carrier protein; DsbC, a bifunctional disulfide isomerase / oxidoreductase.

[0013] The present invention screens a conservative and highly specific multi-gene cluster (RsxG-HutX-DsbC) to avoid the biological errors of single-gene detection and improve the result accuracy; adopts the recombinase polymerase amplification (RPA) technology to complete nucleic acid amplification within 15 minutes under the constant temperature condition of 37-42°C, getting rid of the dependence on precision temperature control equipment; combines with a colloidal gold lateral flow chromatographic test strip (LFD) to directly interpret the result with the naked eye, realizing "zero-equipment" on-site detection. The present invention can not only fill the technical gap of on-site rapid detection, but also has great practical significance for reducing the mortality rate of Vibrio vulnificus infection, ensuring the safety of aquatic product trade and improving the public health emergency response ability.

[0014] The present invention designs a set of primers and probes according to the specific regions of three genes, aiming to achieve the accurate detection of Vibrio vulnificus. At the same time, a test strip is used to indicate the result of isothermal amplification detection, so as to reduce the dependence on instrument equipment to a greater extent and be better applied to on-site rapid detection.

[0015] The sensitivity and specificity of the test strip RPA detection method of the present invention were tested. The results show that the sensitivity of using the test strip of the present invention to detect Vibrio vulnificus by RPA is 3×10 1 CFU / mL, and it has a wide detection range, and samples within at least 10 8 -10 2 can be detected. The specific detection results show that using this method can well distinguish Vibrio vulnificus from other Vibrio types. Therefore, it shows that the test strip RPA detection method of the present invention has good specificity and universality.

[0016] Compared with the prior art, the beneficial technical effects of the present invention are as follows: 1. The designed set of isothermal amplification primers of RPA of the present invention has strong specificity and high sensitivity; 2. The present invention systematically screens three genes with stable and specific expression for Vibrio vulnificus, designs specific primers and probes for the three genes, and interprets the detection results of the three-gene cluster at the same time, greatly improving the detection accuracy; 3. The detection method of the present invention combines the RPA isothermal amplification technology with a colloidal gold immunochromatographic test strip, which can realize the rapid detection of Vibrio vulnificus, and can detect the indicated positive samples (3×10 1 CFU / mL) at the lowest. The specific test results of the detection method of the present invention are good, and the repeatability test has good stability, providing a new on-site detection method with low cost and no special equipment for the effective detection of Vibrio vulnificus; 4. The present invention can be used as a rapid on-site screening detection method for environmental monitoring of seawater bathing beaches or Vibrio vulnificus in aquatic products, and can also be applied to the epidemiological investigation and research of Vibrio vulnificus infection, having important value and market application prospects. Brief Description of the Drawings

[0017] Figure 1 It is the detection result of the RPA sensitivity of the test strip. Among them, A is the detection sensitivity result of gene RsxG, B is the detection sensitivity result of gene HutX, and C is the detection sensitivity result of gene DsbC; Figure 2 It is the detection result of the specificity and universality of the test strip RPA-LFD. Among them, A is the detection result of the specificity and universality of gene RsxG, B is the detection result of the specificity and universality of gene HutX, and C is the detection result of the specificity and universality of gene DsbC. Detailed Embodiments

[0018] The technical solutions of the present invention will be further explained and illustrated through specific embodiments below.

[0019] Example 1: Establishment of a test strip RPA detection method for rapid on-site detection of Vibrio vulnificus 1. Design of RPA upstream and downstream primers and probe primers Download the nucleic acid sequences corresponding to three specific genes (RsxG-HutX-DsbC) of Vibrio vulnificus from GenBank of NCBI, design and manually adjust them, and screen a set of primers and probes in order to be able to detect Vibrio vulnificus with high specificity and high sensitivity. The primer and probe sequences finally optimized and designed in the present invention are shown in Table 1 below.

[0020] Table 1

[0021] 2. Extraction of clinical sample DNA The Vibrio vulnificus strains used in the present invention are collected and preserved by this laboratory. Use the TIANamp Bacterial DNA Kit (DP302, Tiangen) kit to extract and prepare Vibrio vulnificus DNA positive samples, and finally elute them with 50 μL of nuclease-free ultrapure water. Synchronously prepare and extract Photobacterium damselae ( P. damselae ), Vibrio alginolyticus ( V. alginolyticus ), Vibrio campbellii ( V. campbellii ), Vibrio parahaemolyticus ( V. parahaemolyticus ), Vibrio harveyi ( V. harveyi ), Vibrio splendidus ( V. splendidus ), Vibrio kanaloae ( V. kanaloae ), Edwardsiella tarda ( E. tarda ) and other 8 common marine pathogenic bacteria as negative controls. The extracted DNA is stored at -20 °C for subsequent use.

[0022] 3. Optimization of Amplification Conditions for RPA Test of Test Strip Using the extracted and purified total DNA sample of tissue as a template for amplification, the experimental system is as follows: 15 μL of rehydration buffer (TwistDx nfo Kit, Cambridge, United Kingdom), 1.0 μL of upstream primer (10 μM), 1.0 μL of downstream primer (10 μM), 0.3 μL of probe primer (10 μM), 2 μL of DNA template, 5.5 μL of ddH 2 O and 1.2 μL of magnesium acetate (280 mM).

[0023] Among them, the sequences of the pair of primers and one probe are as follows: Upstream primer: 5’- CCACACGTAATGGCCAAGCCACCACCATTGCTATT -3’; Downstream primer: 5’-biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC-3’; Probe primer: 5’-FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3-3’.

[0024] The reaction conditions are 37°C and the reaction time is 15 min. After completion, a lateral flow chromatography test strip (TS101, GenDx) is used to detect the result.

[0025] Add 5 μL of RPA amplification product to 95 μL of diluent (the diluent is 25 mM Tris, 150 mM NaCl and 0.05% Tween-20.) for dilution, and then drop the diluted RPA amplification product onto the sample application end of the colloidal gold lateral flow immunochromatography test strip, and read the result of the test strip.

[0026] The present invention respectively evaluates six sets of primer combinations synthesized by RsxG, HutX and DsbC using this system (as shown in Table 2). Among them, the combination after artificial adjustment (as shown in Table 1) can produce the strongest amplification signal. Therefore, this set of primer combinations is applied to the present invention.

[0027] Table 2

[0028] Determination of the test results of the strip RPA test: Under specific conditions (37 °C, 15 min), if the control lines on all three test strips are positive and the test lines are also positive for a sample, the sample is determined to be a positive sample; if the control lines on all three test strips are positive while the test lines are all negative, the sample is a negative sample.

[0029] 4. Sensitivity detection Using the plate counting method, first perform quantitative analysis on Vibrio vulnificus in the positive sample. The Vibrio vulnificus DNA samples after quantification are respectively diluted by 10-fold gradients (3×10 8 -3×10 1 ) as the sensitivity templates for strip RPA detection. Three groups of gene primers are respectively used for strip RPA amplification detection, and the reaction system and conditions are as described in item 3 above. The results are as Figure 1 shown. It can be seen from the sensitivity detection results that the primer combinations of RsxG, HutX and DsbC can show positive bands for Vibrio vulnificus samples at the order of magnitude of 3×10 1 CFU / mL and above, and the threshold range for the three groups of primers to judge positive samples is defined as 3×10 1 CFU / mL and above.

[0030] 5. Specificity and universality detection Use the nucleic acid of the confirmed positive Vibrio vulnificus sample as the positive sample amplification template, the nucleic acids of the other 8 common Vibrio samples as the negative sample amplification templates, and water as the blank control. Use three groups of gene primer combinations for RPA amplification and combine strip chromatography to judge the results. The reaction system and conditions are as described in item 3 above.

[0031] The results are as Figure 2 shown. The three groups of gene primer combinations can specifically detect positive Vibrio vulnificus samples, and there are no amplification bands at the test line of negative samples.

Claims

1. Application of a gene cluster RsxG-HutX-DsbC in rapid detection of Vibrio vulnificus, characterized in that: In the gene cluster, the sequence of RsxG is shown in SEQ ID NO.1; the sequence of HutX is shown in SEQ ID NO.2; and the sequence of DsbC is shown in SEQ ID NO.

3.

2. A primer probe set for detecting Vibrio vulnificus based on the gene cluster RsxG-HutX-DsbC, characterized in that: The primer probe set is specifically: RsxG-F:CCACACGTAATGGCCAAGCCACCACCATTGCTATT; RsxG-R: biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC; RsxG-Probe: FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3 HutX-F:ATTTTGGACCAGTGACAACCATCGTACACGCGTC; HutX-R: biotin-TAAATAGATCTTAAAAATGTTCTCACCAGAGGTCG; HutX-Probe: FAM-TATTACAACCTAATGGGCAAACAGGGTGAGC / idSp / GCACGGCCATCTCAAG -SpC3 DsbC-F: TTCAAAGTTGGACCTGAACATCATGGATATTCAAC; DsbC-R: biotin-ATTTTCTTCGCGTTGAGCGGTGCTTGACGTTCAGC; DsbC-Probe: FAM-AATTCAAACCAGTGGAGGAGTGTTGTTTGCG / idSp / CTAACGACGGCAGCCA-SpC3; Among them, biotin indicates biotin labeling; FAM indicates fluorescein labeling; SpC3 indicates Spacer C3 modification; idSp indicates vacancy.

3. Use of the primer probe set as claimed in claim 2 in preparing a kit for rapid detection of Vibrio vulnificus, characterized in that: The following steps are involved: (1) Using PRA reagent to perform nucleic acid isothermal amplification reaction on the extracted and purified DNA; (2) Use colloidal gold directional flow immunochromatography test strips to analyze the RPA amplification products and read the test strip results.

4. The use according to claim 3, characterized in that: The specific process of the nucleic acid isothermal amplification reaction is: 15 μL hydrolysis buffer, 1.0 μL upstream primer 10 μM, 1.0 μL downstream primer 10 μM, 0.3 μL probe primer 10 μM, 2 μL DNA template, 5.5 μL ddH2O and 1.2 μL magnesium acetate 280 mM, and incubate the reaction at a constant temperature of 37°C for 15 min.

5. The use according to claim 4, characterized in that: In step (2), the specific process is: add 5 μL of RPA amplification product to 95 μL of diluent for dilution, then drip the diluted RPA amplification product onto the sample loading end of the colloidal gold lateral flow immunochromatography test strip, and read the test strip result.

6. The use according to any one of claims 3 to 5, characterized in that: After reading the test strip results, the judgment conditions are: samples with positive control lines on all three test strips and positive test lines are judged as positive samples; samples with positive control lines on all three test strips and negative test lines are judged as negative samples.

Images