Application of gene cluster in rapid detection of Vibrio vulnificus and its detection primer probe set

Abstract

The present invention belongs to the field of marine biotechnology, and specifically relates to the application of a gene cluster in the rapid detection of Vibrio vulnificus and a primer probe set thereof. The primers are a set of primers corresponding to three gene loci, consisting of upstream and downstream primers and a probe primer; the upstream primer is shown in SEQ ID NO. 1; the downstream primer is shown in SEQ ID NO. 2; and the probe primer is shown in SEQ ID NO. 3. The present invention is aimed at the current detection of Vibrio vulnificus ( V. vulnificus ), corresponding RPA amplification detection primers were designed based on the three specific gene loci obtained through screening, and a strip RPA detection system and method for Vibrio vulnificus was established. This technology is of great value for on-site rapid screening and detection of Vibrio vulnificus in aquaculture, import and export trade, and bathing beaches, and has broad market application prospects.

Description

Technical Field

[0001] The invention belongs to the field of marine biotechnology, and particularly relates to an application of a gene cluster in rapid detection of Vibrio vulnificus and a detection primer probe group thereof. Background Art

[0002] Vibrio vulnificus ( Vibrio vulnificus V. vulnificus is a Gram-negative, halophilic marine vibrio species widely distributed in seawater and seafood. It is listed alongside Vibrio cholerae and Vibrio enteritidis as one of the three most pathogenic Vibrio species defined by the US Centers for Disease Control and Prevention (CDC). Infection with V. vulnificus can cause serious complications such as sepsis, necrotizing fasciitis, myositis, and gangrene, with a mortality rate as high as 50%. Due to its extremely high risk of causing disease, it is classified as one of the most dangerous pathogens in the world. Although the incidence of infection in healthy individuals is low, the bacterium can still enter the human body through swallowing seawater or minor wounds. Ingesting small amounts of the bacteria usually does not cause symptoms, but if signs of infection such as redness, swelling, pain, or bruising of the limbs occur, immediate medical attention is required to prevent worsening of the condition. V. vulnificus can also cause "gastrointestinal" infections, characterized by non-specific symptoms such as nausea, vomiting, diarrhea, and abdominal pain, which can be easily confused with other gastrointestinal diseases and delay diagnosis.

[0003] Rapid and accurate detection of Vibrio vulnificus (V. vulnificus) is a technological challenge urgently needed in the fields of public health and food safety. Current mainstream detection technologies suffer from the following key limitations, which urgently require technological innovation: Traditional methods primarily rely on bacterial culture, requiring 48-72 hours for enrichment, isolation, and biochemical identification. This method is not only cumbersome but also has low sensitivity (limit of detection approximately 10³ CFU / mL), making it difficult to screen for early-stage infections or low-load samples (such as asymptomatic seafood). Furthermore, culture methods require stringent laboratory conditions, making them unsuitable for on-site testing at aquaculture farms, ports, or remote locations. While PCR and quantitative PCR technologies have significantly improved detection sensitivity (reaching 10¹ CFU / mL), they rely on thermal cyclers, fluorescence signal readers, and specialized operators. The high cost of individual tests makes them difficult to scale up in resource-limited settings. Existing molecular tests often target single genes (such as VvhA, gyrB, or the virulence gene RtxA), but these genes are prone to false positives and false negatives due to horizontal transfer or intraspecific variation. These limitations severely hamper the clinical and regulatory credibility of test results. Aquaculture, food processing, and clinical emergency scenarios urgently require portable, “sample-in, result-out” testing solutions. Summary of the Invention

[0004] In view of the shortcomings of the existing technology, the present invention provides an application of a gene cluster RsxG-HutX-DsbC in the rapid detection of Vibrio vulnificus.

[0005] The present invention also provides a primer probe set for detecting Vibrio vulnificus based on the above gene cluster RsxG-HutX-DsbC.

[0006] The technical solutions adopted by the present invention to achieve the above-mentioned purpose are as follows:

[0007] The present invention provides an application of a gene cluster RsxG-HutX-DsbC in the rapid detection of Vibrio vulnificus. In the gene cluster, the sequence of RsxG is shown in SEQ ID NO.1; the sequence of HutX is shown in SEQ ID NO.2; and the sequence of DsbC is shown in SEQ ID NO.3.

[0008] Another object of the present invention is to provide a primer probe set for detecting Vibrio vulnificus based on the gene cluster RsxG-HutX-DsbC, wherein the primer probe set is specifically:

[0009] RsxG-F (SEQ ID NO.4): CCACACGTAATGGCCAAGCCACCACCATTGCTATT;

[0010] RsxG-R (SEQ ID NO.5):

[0011] biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC;

[0012] RsxG-Probe (SEQ ID NO.6):

[0013] FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3;

[0014] HutX-F (SEQ ID NO.7): ATTTTGGACCAGTGACAACCATCGTACACGCGTC;

[0015] HutX-R (SEQ ID NO.8): biotin-TAAATAGATCTTTAAAAATGTTCTCACCAGAGGTCG;

[0016] HutX-Probe (SEQ ID NO.9):

[0017] FAM-TATTACAACCTAATGGGCAAACAGGGTGAGC / idSp / GCACGGCCATCTCAAG-SpC3;

[0018] DsbC-F (SEQ ID NO. 10): TTCAAAGTTGGACCTGAACATCATGGATATTCAAC;

[0019] DsbC-R (SEQ ID NO.11):

[0020] biotin-ATTTTCTTCGCGTTGAGCGGTGCTTGACGTTCAGC;

[0021] DsbC-Probe (SEQ ID NO.12):

[0022] FAM-AATTCAAACCAGTGGAGGAGTGTTGTTTGCG / idSp / CTAACGACGGCAGCCA-SpC3;

[0023] Among them, biotin indicates biotin labeling; FAM indicates fluorescein labeling; SpC3 indicates Spacer C3 modification; idSp indicates vacancy.

[0024] The present invention further provides the use of the above primer probe set in preparing a kit for rapid detection of Vibrio vulnificus, comprising the following steps:

[0025] (1) The extracted and purified DNA was subjected to a nucleic acid isothermal amplification reaction using PRA reagent;

[0026] (2) Use colloidal gold directional flow immunochromatographic test strips to analyze the RPA amplification products and read the test strip results.

[0027] Preferably, the specific process of the nucleic acid isothermal amplification reaction is: 15 μL hydrolysis buffer, 1.0 μL upstream primer 10 μM, 1.0 μL downstream primer 10 μM, 0.3 μL probe primer 10 μM, 2 μL DNA template, 5.5 μL ddH2O and 1.2 μL magnesium acetate 280 mM, and incubate the reaction at 37°C for 15 min.

[0028] Preferably, in step (2), the specific process is: 5 μL of RPA amplification product is added to 95 μL of diluent for dilution, and then the diluted RPA amplification product is added dropwise to the sample addition end of the colloidal gold lateral flow immunochromatography test strip, and the test strip result is read.

[0029] Preferably, after reading the test strip results, the judgment conditions are: a sample whose control lines on the three test strips are all positive and whose detection lines are all positive is judged as a positive sample; a sample whose control lines on the three test strips are positive and whose detection lines are all negative is judged as a negative sample.

[0030] The gene cluster provided by the present invention includes: RsxG, an electron transport complex subunit; HutX, a heme utilization cytoplasmic carrier protein; and DsbC, a bifunctional disulfide bond isomerase / oxidoreductase.

[0031] This method screens for a conserved and highly specific multi-gene cluster (RsxG-HutX-DsbC), avoiding the biological errors of single-gene testing and improving the accuracy of results. It also utilizes recombinase polymerase amplification (RPA) technology to complete nucleic acid amplification within 15 minutes at a constant temperature of 37-42°C, eliminating the need for precision temperature-controlled equipment. Combined with colloidal gold lateral flow chromatography (LFD) strips, results can be directly interpreted visually, achieving "zero-equipment" on-site testing. This method not only fills a technological gap in rapid on-site testing but also has significant practical significance for reducing the mortality rate of Vibrio vulnificus infection, ensuring the safety of aquatic product trade, and enhancing public health emergency response capabilities.

[0032] This study designed a set of primers and probes based on three gene-specific regions, enabling accurate detection of Vibrio vulnificus. Furthermore, a test strip was used to indicate the results of the constant-temperature amplification assay, minimizing the test's dependence on instrumentation and enabling improved application for rapid on-site testing.

[0033] The sensitivity and specificity of the test strip RPA detection method of the present invention were tested. The results showed that the sensitivity of the test strip RPA for detecting Vibrio vulnificus was 3×10 1 CFU / mL, and has a wide detection range, at least 10 8 -10 2 The specificity test results showed that the method can well distinguish Vibrio vulnificus from other Vibrio species, thus demonstrating that the invented test strip RPA detection method has good specificity and versatility.

[0034] Compared with the prior art, the beneficial technical effects of the present invention are:

[0035] 1. The RPA constant temperature amplification primer set designed by the present invention has strong specificity and high sensitivity;

[0036] 2. This invention systematically screened three genes with stable and specific expression for Vibrio vulnificus, designed specific primers and probes for these three genes, and simultaneously interpreted the detection results of the three gene clusters, greatly improving the accuracy of the detection;

[0037] 3. The detection method of the present invention combines RPA constant temperature amplification technology with colloidal gold immunochromatographic test strips to achieve rapid detection of Vibrio vulnificus, with the minimum detection capacity of positive samples (3×10 1CFU / mL). The detection method of the present invention has good specificity test results and good stability in repeatability tests, providing a new on-site detection method for effectively detecting Vibrio vulnificus with low cost and no need for special equipment;

[0038] 4. The present invention can be used as a rapid on-site screening and detection method for monitoring the environment of bathing beaches or for detecting Vibrio vulnificus in aquatic products. It can also be applied to epidemiological investigations and studies of Vibrio vulnificus infections, and has important value and market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 is the RPA sensitivity test result of the test strip, where A is the sensitivity result of gene RsxG detection, B is the sensitivity result of gene HutX detection, and C is the sensitivity result of gene DsbC detection;

[0040] Figure 2 The specificity and universality results of the test strip RPA-LFD are shown, where A is the specificity and universality result of the gene RsxG, B is the specificity and universality result of the gene HutX, and C is the specificity and universality result of the gene DsbC. DETAILED DESCRIPTION

[0041] The technical solution of the present invention is further explained and illustrated by means of specific embodiments below.

[0042] Example 1: Establishment of a rapid on-site detection method for Vibrio vulnificus using a test strip RPA

[0043] 1. Design of RPA upstream and downstream primers and probe primers

[0044] The nucleic acid sequences corresponding to three specific genes of Vibrio vulnificus (RsxG, HutX, and DsbC) were downloaded from NCBI's GenBank. Primers and probes were designed and manually adjusted to screen for highly specific and sensitive detection of Vibrio vulnificus. The final optimized primer and probe sequences are shown in Table 1 below.

[0045] Table 1

[0046]

[0047] 2. DNA extraction from clinical samples

[0048] The Vibrio vulnificus strain used in this invention was collected and preserved in our laboratory. DNA-positive samples of Vibrio vulnificus were extracted and prepared using the TIANamp BacterialDNA Kit (DP302, Tiangen), and finally eluted with 50 μL of nuclease-free ultrapure water. Simultaneously, Photobacterium mermani ( P. damselae)、Vibrio alginolyticus( V. alginolyticus ), Vibrio campbellii ( V. campbellii ), Vibrio parahaemolyticus ( V. parahaemolyticus harveyi ( V. harveyi )、Vibrio splendens( V. splendidus ), Vibrio kanagi ( V. kanaloae ), Edwardsiella tarda ( E. tarda ) and eight other common marine pathogens were used as negative controls. The extracted DNA was stored at -20°C for subsequent use.

[0049] 3. Optimization of test strip RPA test amplification conditions

[0050] The extracted and purified total DNA sample of the tissue was used as a template for amplification. The experimental system was as follows:

[0051] 15 μL rehydration buffer (TwistDx nfo Kit, Cambridge, United Kingdom), 1.0 μL upstream primer (10 μM), 1.0 μL downstream primer (10 μM), 0.3 μL probe primer (10 μM), 2 μL DNA template, 5.5 μL ddH2O and 1.2 μL magnesium acetate (280 mM).

[0052] The sequences of the pair of primers and the probe are as follows:

[0053] Upstream primer:

[0054] 5'- CCACACGTAATGGCCAAGCCACCACCATTGCTATT -3';

[0055] Downstream primer:

[0056] 5'-biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC-3';

[0057] Probe primers:

[0058] 5'-FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3-3'.

[0059] The reaction was performed at 37°C for 15 min, and the results were detected using lateral flow chromatography strips (TS101, GenDx).

[0060] Dilute 5 μL of RPA amplification product with 95 μL of diluent (25 mM Tris, 150 mM NaCl, and 0.05% Tween-20). Then, add the diluted RPA amplification product dropwise to the sample loading end of the colloidal gold lateral flow immunochromatographic test strip and read the test strip results.

[0061] The present invention used this system to evaluate six primer combinations synthesized for RsxG, HutX, and DsbC (as shown in Table 2). One of the combinations, after manual adjustment (as shown in Table 1), produced the strongest amplification signal. Therefore, this primer combination was used in the present invention.

[0062] Table 2

[0063]

[0064] The test results of the RPA test strips are determined as follows: under specific conditions (37°C, 15 minutes), if the control lines on the three test strips are all positive and the test lines are all positive, the sample is determined to be a positive sample; if the control lines on the three test strips are positive and the test lines are all negative, the sample is determined to be a negative sample.

[0065] 4. Sensitivity detection

[0066] The plate counting method was used to quantitatively analyze the Vibrio vulnificus in the positive samples. The quantified Vibrio vulnificus DNA samples were diluted 10 times (3×10 8 -3×10 1 ) as the test strip RPA detection sensitivity template, respectively, using three sets of gene primers to perform test strip RPA amplification detection, the reaction system and conditions are as described in 3 above. The results are as follows Figure 1 As shown in the results of sensitivity test, the combination of RsxG, HutX and DsbC primers is sensitive to 3×10 1 The samples with CFU / mL and above could show positive bands, and the threshold range of the three sets of primers for judging positive samples was limited to 3×10 1 CFU / mL and above.

[0067] 5. Specificity and universality testing

[0068] The nucleic acid from the confirmed positive Vibrio vulnificus sample was used as the template for positive sample amplification, while nucleic acid from the remaining eight common Vibrio strains was used as the template for negative sample amplification. Water served as a blank control. RPA amplification was performed using three sets of primers, and the results were evaluated using test strip chromatography. The reaction system and conditions were as described in Section 3 above.

[0069] The results are as follows Figure 2As shown in the figure, the three sets of gene primer combinations can specifically detect Vibrio vulnificus positive samples, and there is no amplified band at the detection line of negative samples.

Claims

1. A use of a gene cluster RsxG-HutX-DsbC for rapid detection of Vibrio vulnificus for non-diagnostic purposes, characterized in that: In the gene cluster, the sequence of RsxG is shown in SEQ ID NO.1; the sequence of HutX is shown in SEQ ID NO.2; the sequence of DsbC is shown in SEQ ID NO.3; The primer probe set for detecting Vibrio vulnificus based on the gene cluster RsxG-HutX-DsbC is: RsxG-F:CCACACGTAATGGCCAAGCCACCACCATTGCTATT; RsxG-R: biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC; RsxG-Probe: FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3 HutX-F:ATTTTGGACCAGTGACAACCATCGTACACGCGTC; HutX-R: biotin-TAAATAGATCTTAAAAATGTTCTCACCAGAGGTCG; HutX-Probe: FAM-TATTACAACCTAATGGGCAAACAGGGTGAGC / idSp / GCACGGCCATCTCAAG-SpC3 DsbC-F: TTCAAAGTTGGACCTGAACATCATGGATATTCAAC; DsbC-R: biotin-ATTTTCTTCGCGTTGAGCGGTGCTTGACGTTCAGC; DsbC-Probe: FAM-AATTCAAACCAGTGGAGGAGTGTTGTTTGCG / idSp / CTAACGACGGCAGCCA-SpC3; Among them, biotin indicates biotin labeling; FAM indicates fluorescein labeling; SpC3 indicates Spacer C3 modification; idSp indicates vacancy.

2. Use of a primer probe set in preparing a kit for rapid detection of Vibrio vulnificus, characterized in that: The following steps are involved: (1) The extracted and purified DNA was subjected to a nucleic acid isothermal amplification reaction using PRA reagent; (2) Analyze the RPA amplification product using a colloidal gold directional flow immunochromatographic test strip and read the test strip results; The sequences of the primer probe set are: RsxG-F:CCACACGTAATGGCCAAGCCACCACCATTGCTATT; RsxG-R: biotin-AATCTGTCACTCTAAGGTCGATCTTATCGTCTAAC; RsxG-Probe: FAM-ATCATTACGGGTATCGATGCCAGCGGTACCG / idSp / GCTTGGCACGCGCGTA-SpC3 HutX-F:ATTTTGGACCAGTGACAACCATCGTACACGCGTC; HutX-R: biotin-TAAATAGATCTTAAAAATGTTCTCACCAGAGGTCG; HutX-Probe: FAM-TATTACAACCTAATGGGCAAACAGGGTGAGC / idSp / GCACGGCCATCTCAAG-SpC3 DsbC-F: TTCAAAGTTGGACCTGAACATCATGGATATTCAAC; DsbC-R: biotin-ATTTTCTTCGCGTTGAGCGGTGCTTGACGTTCAGC; DsbC-Probe: FAM-AATTCAAACCAGTGGAGGAGTGTTGTTTGCG / idSp / CTAACGACGGCAGCCA-SpC3; Among them, biotin indicates biotin labeling; FAM indicates fluorescein labeling; SpC3 indicates Spacer C3 modification; idSp indicates vacancy.

3. The use according to claim 2, characterized in that The specific process of the nucleic acid isothermal amplification reaction is as follows: 15 μL of hydrolysis buffer, 1.0 μL of upstream primer 10 μM, 1.0 μL of downstream primer 10 μM, 0.3 μL of probe primer 10 μM, 2 μL of DNA template, 5.5 μL of ddH2O and 1.2 μL of magnesium acetate 280 mM, and incubation at 37°C for 15 minutes; The hydrolysis buffer comprises: rehydration buffer, TwistDx nfo Kit.

4. The use according to claim 3, characterized in that In step (2), the specific process is as follows: 5 μL of RPA amplification product is added to 95 μL of diluent for dilution, and then the diluted RPA amplification product is added dropwise to the sample addition end of the colloidal gold lateral flow immunochromatography test strip, and the test strip result is read.

5. The use according to any one of claims 2 to 4, characterized in that: After reading the test strip results, the judgment conditions are: if the control lines on all three test strips are positive and the test lines are all positive, the sample is judged as a positive sample; if the control lines on all three test strips are positive and the test lines are all negative, the sample is judged as a negative sample.

Images