Self-energized detection platform capable of efficiently detecting germs and preparation method and application of self-energized detection platform

Abstract

The invention belongs to the technical field of biosensors, and particularly relates to a self-powered detection platform capable of efficiently detecting germs and a preparation method and application of the self-powered detection platform. The self-powered detection platform is an electrochemical / colorimetric dual-mode detection platform and comprises a biological anode, a biological cathode and electrolyte; the preparation method comprises the following steps: constructing a biological anode of a self-powered detection platform by using Cr-MOF, AuNPs, NF and GOx, and constructing a biological cathode of the self-powered detection platform by using Cr-MOF, AuNPs, NF and a nucleic acid amplification product, wherein the electrolyte comprises glucose, methylene blue and a PBS buffer solution. The self-energized detection platform constructed by the invention has the characteristics of excellent stability, extremely low environmental interference, high reaction activity and economic cost effectiveness, and realizes ultrasensitive quantitative detection of the pathogenic bacteria target DNA of the sugarcane pokkah boeng rot.

Description

Technical Field

[0001] The present invention relates to the technical field of biosensors, and particularly to a self-powered detection platform for efficiently detecting pathogenic bacteria, a preparation method thereof, and an application thereof. Background Art

[0002] As a multi-purpose crop, sugarcane has a wide range of applications globally. However, as a global sugarcane disease, sugarcane top rot disease can cause yellowing of the top leaves of sugarcane, easy breakage of the upper leaves, and even the death of the whole plant in severe cases. Although the symptoms of sugarcane top rot disease are obvious and easy to diagnose after onset, due to its long incubation period, it is difficult to accurately identify in the early stage. Therefore, being able to detect and take measures in a timely manner in the early stage of sugarcane top rot disease is crucial for reducing the economic losses of sugarcane farmers and quickly taking remedial measures.

[0003] Traditional detection methods for sugarcane top rot disease mainly include symptom observation, histological observation, and molecular biology methods, which mainly perform simple observation and judgment on obvious disease symptoms. Molecular biology detection methods, such as PCR amplification method and gene sequencing method, although having high specificity and reliability, involve multiple steps such as DNA extraction and PCR reaction, and have problems such as complex operation and high cost. Therefore, it is particularly urgent to develop a new detection method with high sensitivity, high accuracy, and strong stability. Summary of the Invention

[0004] In view of the above problems, the present invention provides a self-powered detection platform for efficiently detecting pathogenic bacteria, a preparation method thereof, and an application thereof. The self-powered detection platform of the present invention is constructed based on Cr-MOF, NF, nucleic acid amplification, GOx, methylene blue, and AuNPs, and is used for detecting sugarcane top rot disease pathogens. The core design of this platform lies in the preparation of Cr-MOF. By utilizing the oxygen-selective adsorption characteristic of Cr-MOF, a high-performance bioanode is constructed. Cr-MOF not only serves as a carrier for GOx to increase the loading amount of the bioanode catalyst, but also selectively adsorbs oxygen in the electrolyte for the catalytic decomposition of glucose oxidase, thereby improving the catalytic efficiency of the bioanode. In addition, by combining the detection platform with nucleic acid amplification technology, the sensitivity and specificity of the sensor can be significantly improved. The self-powered detection platform constructed by the present invention is characterized by excellent stability, extremely low environmental interference, high reaction activity, and economic cost-effectiveness, and realizes ultrasensitive quantitative detection of the target DNA of sugarcane top rot disease pathogens.

[0005] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0006] A preparation method of a self-powered detection platform for efficient detection of pathogenic bacteria, the preparation method includes constructing a bioanode of the self-powered detection platform using Cr-MOF, AuNPs, NF, and GOx, and constructing a biocathode of the self-powered detection platform using Cr-MOF, AuNPs, NF, and nucleic acid amplification products.

[0007] In the present invention, preferably, the specific preparation steps of the bioanode include:

[0008] (1) Mix 1-3 mg of Cr-MOF with 1-3 mL of AuNPs solution evenly to obtain a mixed solution, drop 30-40 μL of the mixed solution onto NF, and incubate at 35-40 °C for 2-4 hours;

[0009] (2) Drop 30-40 μL of EDC / NHS solution into the product obtained in step (1), and incubate for 30-60 minutes;

[0010] (3) Then add 30-60 μL of 5 mg / mL GOx solution to the product obtained in step (2), and react at 3-6 °C for 10-24 hours to obtain the bioanode.

[0011] In the present invention, preferably, the preparation steps of the Cr-MOF are: Dissolve 1-2 mol of Cr(NO 3 ) 3 ·9H 2 O and 1-2 mol of PTA in a solvent containing 4-5 mL of water and 0.2-3.6 mL of acetic acid, stir for 30-60 minutes, carry out a solvothermal reaction at 220-240 °C for 8-10 hours, wash, and then vacuum dry at 50-60 °C for 6-8 hours to obtain Cr-MOF.

[0012] In the present invention, preferably, the specific preparation steps of the biocathode include:

[0013] (1) Mix 1-3 mg of Cr-MOF with 1-3 mL of AuNPs solution, then drop 30-40 μL of the mixed solution onto NF, and incubate at 35-40 °C for 2-4 hours;

[0014] (2) After incubation, drop 30-40 μL of EDC / NHS solution and continue to incubate for 30-60 minutes, add 30-60 μL of 1 μmol / L SH-CP solution, and react at 4 °C for 10-24 hours;

[0015] (3) After the reaction is completed and washed, 20 - 40 μL of 6-mercapto-1-hexanol is added dropwise onto the NF, and the reaction is carried out at 25 - 30 °C for 30 - 60 minutes. Then, 20 - 40 μL of the nucleic acid amplification product OD is added dropwise, and incubated at 35 - 40 °C for 2 - 4 hours to obtain the biocathode.

[0016] In the present invention, preferably, the preparation steps of the nucleic acid amplification product include: adding 10 - 15 μL of the target solution to 100 μL of the DNA amplifier, then adding 2 - 4 μL of phi29 DNA polymerase and 10 - 20 μL of 10 mmol / L dNTPs, incubating for 2 - 4 hours, and then adding 1 - 2 μL of phi29 DNA polymerase, 10 - 15 μL of 10 mmol / L dNTPs and 1 - 3 μL of Nt.BbvCI respectively, reacting at 35 - 40 °C for 0.5 - 4 hours, and then annealing at 70 - 80 °C for 20 - 40 minutes to obtain the nucleic acid amplification product OD.

[0017] In the present invention, preferably, the preparation steps of the DNA amplifier include: mixing 50 - 70 μL of 1 μmol / L target capture probe CP0 with 50 - 70 μL of 1 μmol / L probe SP-NH 2 mixing, annealing at 95 °C for 5 - 10 minutes, transferring the formed CP-SP double strand to the carboxylated modified Fe₃O₄ magnetic beads, and adding 20 - 40 μL of the EDC / NHS solution, reacting at 35 - 40 °C for 6 - 12 hours to obtain the DNA amplifier.

[0018] The present invention also provides a self-powered detection platform capable of efficiently detecting pathogenic bacteria prepared by the above-mentioned preparation method.

[0019] Preferably, the self-powered detection platform is an electrochemical / colorimetric dual-mode detection platform. The self-powered detection platform includes a bioanode, a biocathode and an electrolyte. The bioanode is composed of Cr-MOF / AuNPs / GOx, the biocathode is composed of Cr-MOF / AuNPs / nucleic acid amplification product, and the electrolyte contains glucose, methylene blue and PBS buffer solution.

[0020] In addition, the present invention also provides an application of the self-powered detection platform in detecting the pathogenic bacteria of sugarcane top rot disease.

[0021] The method of the application includes the following steps:

[0022] (1) When the pathogenic bacteria of sugarcane top rot disease are not introduced, measure the instantaneous current of the detection platform;

[0023] (2) After adding different concentrations of the pathogenic bacteria of sugarcane top rot disease, measure the instantaneous current of the detection platform;

[0024] (3) Under the colorimetric mode, when the sugarcane top rot pathogen is not introduced, place the double-electrode system in the electrolyte and record the RGB Blue value of the electrolyte color; after introducing the sugarcane top rot pathogen, place the double-electrode system in the electrolyte and record the RGB Blue value of the electrolyte color.

[0025] Among them, the electrolyte is a 15 - 20 mL phosphate (0.01 mol / L NaH 2 PO 4 / Na 2 HPO 4 , pH = 7.4) electrolyte containing 5 mmol / L glucose and 500 μmol / L methylene blue.

[0026] By adopting the above technical solutions, the beneficial effects of the present invention are as follows:

[0027] (1) In the detection platform of the present invention, Cr-MOF exhibits the advantages of high electrocatalytic activity and large specific surface area with its three-dimensional pore structure and numerous active sites. As a substrate material, Cr-MOF can bind more amplification products, realizing sensitive detection of the sugarcane top rot pathogen, thus significantly improving the detection sensitivity. At the same time, the metal atom catalytic activity of Cr-MOF and glucose oxidase act synergistically to further enhance the catalytic efficiency of the bioanode to achieve sensor power output. In addition, Cr-MOF has the ability to selectively adsorb oxygen highly, and this characteristic improves the efficiency of the bioanode catalyzing the decomposition of glucose.

[0028] (2) In the detection platform of the present invention, by depositing gold nanoparticles on Cr-MOF and loading them on nickel foam, the loading of the catalyst is optimized. This strategy not only enhances the electron transfer efficiency but also improves the response speed and sensitivity of the sensor to target molecules.

[0029] (3) The present invention constructs a highly specific DNA amplifier. By regulating the SDR nucleic acid amplification technology, a self-powered sensor with high stability and specificity is developed, significantly improving the sensitivity and specificity of the sensor.

[0030] (4) The detection platform of the present invention not only provides an efficient electrocatalytic platform but also can effectively stabilize GOx and protect it from the influence of adverse environmental factors, thus maintaining its biological activity. Description of the Drawings

[0031] Figure 1 is a schematic diagram of the construction of the self-powered detection platform of the present invention for detecting the sugarcane top rot pathogen;

[0032] Figure 2It is the scanning electron microscope (SEM) image of the Cr-MOF nanomaterial in the present invention;

[0033] Figure 3 It is the test current intensity diagram of the self-powered detection platform of the present invention with and without the sugarcane top rot pathogen;

[0034] Figure 4 It is the colorimetric test RGB Blue diagram of the self-powered detection platform of the present invention with and without the sugarcane top rot pathogen;

[0035] Figure 5 It is the current response diagram of the self-powered detection platform of the present invention to different substances. Specific embodiments

[0036] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0037] Example 1

[0038] A preparation method of a self-powered detection platform capable of efficiently detecting pathogens, comprising the following steps:

[0039] 1. Preparation of Cr-MOF

[0040] Dissolve 1 mol of Cr(NO 3 ) 3 ·9H 2 O and 1 mol of PTA (terephthalic acid) in a solvent containing 4.8 mL of water and 0.2 mL of acetic acid, stir for 30 min to obtain a uniformly stirred solution. Transfer the uniformly stirred solution to a high-pressure reaction kettle for solvothermal reaction, the reaction temperature is 220 °C, and the reaction time is 10 h. Subsequently, wash it three times alternately with ethanol and water, and vacuum dry it at 50 °C for 6 h to obtain Cr-MOF.

[0041] 2. Preparation of the DNA amplifier:

[0042] Mix 50 μL of 1 μmol / L target capture probe CP0 with 50 μL of 1 μmol / L probe SP-NH 2 , anneal at 95 °C for 5 minutes to form a CP-SP double strand. Transfer the formed CP-SP double strand to carboxylated modified iron oxide nanoparticles, and add 40 μL of EDC / NHS solution, react at 37 °C for 12 hours to obtain the DNA amplifier.

[0043] 3. Preparation of Nucleic Acid Amplification Product (OD):

[0044] Add 10 μL of the target solution (pathogen) to 100 μL of the DNA amplifier, then add 2 μL of phi29 DNA polymerase and 10 μL of 10 mmol / L dNTPs, incubate at 37 °C for 2 hours, and aspirate the supernatant of the reaction. Add 1 μL of phi29 DNA polymerase, 10 μL of 10 mmol / L dNTPs and 1 μL of Nt.BbvCI to the supernatant, react at 37 °C for 2 hours, and then anneal at 80 °C for 20 minutes to obtain the nucleic acid amplification product OD, as Figure 1 shown.

[0045] 4. Preparation of the Bioanode of the Self-Powered Detection Platform

[0046] Mix 1 mg of Cr-MOF with 1 mL of AuNPs solution, drop 30 μL of the mixed solution onto NF, incubate at 37 °C for 2 hours, then drop 30 μL of EDC / NHS solution and incubate for 30 minutes, add 50 μL of 5 mg / mL GOx solution, and react at 4 °C for 12 hours to obtain the bioanode, as Figure 1 shown.

[0047] 5. Preparation of the Biocathode of the Self-Powered Detection Platform

[0048] Mix 1 mg of Cr-MOF with 1 mL of AuNPs solution, then drop 30 μL of the mixed solution onto NF, incubate at 37 °C for 2 hours, then drop 30 μL of EDC / NHS solution and incubate for 30 minutes, add 50 μL of 1 μmol / L SH-CP solution, react at 4 °C for 12 hours, wash, and then continue to drop 20 μL of 6-mercapto-1-hexanol (MCH) onto the nickel foam NF, react at 25 °C for 30 minutes, and then drop 20 μL of the nucleic acid amplification product OD, incubate at 37 °C for 2 hours to obtain the biocathode, as Figure 1 shown.

[0049] 6. Assembly Process of the Portable Detection Platform

[0050] Clamp the biocathode and bioanode with platinum electrodes respectively, and immerse them in 15 mL of phosphate (0.01 mol / L NaH 2 PO 4 / Na 2 HPO 4 , pH = 7.4) electrolyte containing 5 mmol / L glucose and 500 μmol / L methylene blue to construct the portable detection platform. As Figure 1As shown, the left side corresponds to the oxidation process of glucose, and the right side corresponds to the reduction process of methylene blue, indicating that the detection platform can carry out these two reactions.

[0051] Example 2

[0052] A preparation method of a self-powered detection platform for highly efficient detection of pathogenic bacteria, comprising the following steps:

[0053] 1. Preparation of Cr-MOF

[0054] Dissolve 2 mol of Cr(NO 3 ) 3 ·9H 2 O and 2 mol of PTA (purified terephthalic acid) in a solvent containing 5 mL of water and 2.5 mL of acetic acid, stir for 60 min to obtain a uniformly stirred solution. Transfer the uniformly stirred solution to a high-pressure reaction kettle for solvothermal reaction, the reaction temperature is 220 °C, and the reaction time is 10 h. Subsequently, wash three times alternately with ethanol and water, and vacuum dry at 50 °C for 6 h to obtain Cr-MOF.

[0055] 2. Preparation of DNA amplifier:

[0056] Mix 60 μL of 1 μmol / L target capture probe CP0 with 60 μL of 1 μmol / L probe SP-NH 2 , anneal at 95 °C for 8 minutes to form a CP-SP double strand. Transfer the formed CP-SP double strand to carboxylated modified iron oxide magnetic beads, and add 30 μL of EDC / NHS solution, react at 37 °C for 10 h to obtain the DNA amplifier.

[0057] 3. Preparation of nucleic acid amplification products:

[0058] Add 15 μL of the target (pathogenic bacteria) solution to 100 μL of the DNA amplifier, then add 4 μL of phi29 DNA polymerase and 20 μL of 10 mmol / L dNTPs, incubate at 37 °C for 2 h, and aspirate the supernatant of the reaction. Add 2 μL of phi29 DNA polymerase, 15 μL of 10 mmol / L dNTPs and 2 μL of Nt.BbvCI to the supernatant, react at 37 °C for 2 h, and then anneal at 80 °C for 20 minutes to obtain the nucleic acid amplification product OD, as Figure 1 shown.

[0059] 4. Preparation of the bioanode of the self-powered detection platform

[0060] Mix 2 mg of Cr-MOF with 2 mL of AuNPs solution, drop 40 μL of the mixed solution onto NF, incubate at 37 °C for 2 hours, then add 40 μL of EDC / NHS solution and incubate for 60 minutes. Add 60 μL of 5 mg / mL GOx solution and react at 4 °C for 12 hours to obtain the bioanode, as Figure 1 shown.

[0061] 5. Preparation of the biocathode of the self-powered detection platform

[0062] Mix 2 mg of Cr-MOF with 2 mL of AuNPs solution, then drop 40 μL of the mixed solution onto NF, incubate at 37 °C for 2 hours, then add 40 μL of EDC / NHS solution and incubate for 60 minutes. Add 50 μL of 1 μmol / L SH-CP solution and react at 4 °C for 12 hours. After washing, continue to drop 20 μL of 6-mercapto-1-hexanol (MCH) onto the nickel foam NF, react at 25 °C for 50 minutes, then add 40 μL of the nucleic acid amplification product OD and incubate at 37 °C for 2 hours to obtain the biocathode, as Figure 1 shown.

[0063] The assembly process of the portable detection platform is the same as that in Example 1.

[0064] Example 3

[0065] In this example, except that the preparation of Cr-MOF, the preparation of the bioanode and biocathode of the self-powered detection platform are slightly different from those in Example 1, the others are the same as those in Example 1.

[0066] In this example, the specific preparation process of Cr-MOF is as follows: Dissolve 1.5 mol of Cr(NO 3 ) 3 ·9H 2 O and 1.5 mol of PTA (purified terephthalic acid) in a solvent containing 5 mL of water and 1.5 mL of acetic acid, stir for 60 min to obtain a uniformly stirred solution. Transfer the uniformly stirred solution to a high-pressure reaction kettle for solvothermal reaction, the reaction temperature is 220 °C, and the reaction time is 10 h. Subsequently, wash three times alternately with ethanol and water, and vacuum dry at 50 °C for 6 h to obtain Cr-MOF.

[0067] The specific preparation process of the bioanode of the self-powered detection platform is as follows:

[0068] Mix 3 mg of Cr-MOF with 3 mL of AuNPs solution, drop 40 μL of the mixed solution onto NF, incubate at 37 °C for 2 hours, then add 40 μL of EDC / NHS solution and incubate for 60 minutes. Add 60 μL of 5 mg / mL GOx solution and react at 4 °C for 12 hours to obtain the bioanode, asFigure 1 as shown

[0069] The specific process for preparing the biocathode of the self-powered detection platform is as follows:

[0070] Mix 3 mg of Cr-MOF with 3 mL of AuNPs solution, then drop 40 μL of the mixed solution onto NF, incubate at 37 °C for 2 hours, then drop 40 μL of EDC / NHS solution and incubate for 60 minutes, add 50 μL of 1 μmol / L SH-CP solution, react at 4 °C for 12 hours, after washing, continue to drop 20 μL of 6-mercapto-1-hexanol (MCH) onto the nickel foam NF, react at 25 °C for 50 minutes, then drop 40 μL of the nucleic acid amplification product OD, incubate at 37 °C for 2 hours to obtain the biocathode, as Figure 1 as shown

[0071] The applicant characterized the Cr-MOF nanomaterials used for preparing the above detection platform and tested the obtained detection platform, and the results are as follows:

[0072] I. Scanning electron microscopy (SEM) characterization of Cr-MOF nanomaterials

[0073] As Figure 2 shown, the structure of Cr-MOF is composed of numerous two-dimensional layered structures stacked together, constructing a rich three-dimensional pore network, which provides an effective channel for the transport and adsorption of gas molecules. Through the high-resolution images of scanning electron microscopy (SEM), the ordered arrangement and stacking between the Cr-MOF layered structures can be clearly observed. This structural feature not only enhances the mechanical stability of the material, but also increases the internal surface area, thereby improving the gas molecule adsorption capacity. In addition, the presence of the three-dimensional pore network provides more adsorption sites for gas molecules, which is crucial for improving the selectivity and efficiency of gas adsorption. The unique microstructure of Cr-MOF makes it show great application potential in the fields of gas storage, separation and catalysis. Especially in oxygen adsorption, the three-dimensional pore structure of Cr-MOF can provide more active sites to achieve efficient capture and selective separation of oxygen molecules. Further analysis shows that the pore size and surface chemical properties of Cr-MOF can be optimized by adjusting the synthesis conditions and post-treatment steps to adapt to the specific gas molecule size and chemical characteristics. This tunability enables Cr-MOF to be customized for different gas molecules to achieve more efficient gas adsorption and separation performance.

[0074] II. Bimodal testing of the self-powered detection platform for detecting sugarcane top rot pathogen

[0075] Electrochemical mode test: The instantaneous current of the detection platform was measured without introducing the target of sugarcane top rot pathogen. As Figure 3 shown, when the target was not introduced, the instantaneous current of the detection platform was relatively small. After introducing sugarcane top rot pathogens at different concentrations, the instantaneous current of the platform was measured again, and it was found that it increased significantly, much larger than the current value when the target was not introduced.

[0076] Colorimetric mode test: Without introducing sugarcane top rot pathogen, the two-electrode system was placed in the electrolyte for 20 minutes, and the color change of the electrolyte (represented by the RGB Blue value) was recorded. Subsequently, after introducing sugarcane top rot pathogen, the above steps were repeated and the color change was recorded. As Figure 4 shown, when the target was absent, there were only capture probes on the cathode, and nucleic acid amplification could not be carried out, resulting in less methylene blue adsorbed on the biocathode and low electron conduction, so the amount of methylene blue reduced was small, and the color of the electrolyte was darker, corresponding to a smaller RGB Blue value. As the concentration of the target increased, the amount of methylene blue adsorbed on the biocathode increased, and the amount of methylene blue reduced also increased accordingly, resulting in the gradual lightening of the electrolyte color and the gradual increase of the RGB Blue value. This result indicates that the portable detection platform is feasible and effective in detecting sugarcane top rot pathogen.

[0077] III. Anti-interference test analysis of the portable detection platform for sugarcane top rot pathogen

[0078] To evaluate the anti-interference performance of the portable detection platform for sugarcane top rot pathogen, a series of interference tests were carried out in the present invention. In the test, single-base mismatched gene (SW), double-base mismatched gene (DW), full-base mismatched gene (AW), smut pathogen gene (Beq8) and ascorbic acid (AA) were selected as potential interfering substances to measure their effects on the sensor respectively, and then they were mixed with 10 -12 mol / L of Target (pure sugarcane top rot pathogen) to determine their effects on the detection effect of the sensing platform. All tests were measured by a multimeter for the instantaneous current of the sensing platform.

[0079] As Figure 5 shown, first, the detection concentrations of blank samples (samples without adding the target) and pure Target were used as references, and then the detection signal intensities of three-fold concentrations of SW, DW, AW, Beq8 and AA were compared. The results showed that these mismatched bases did not have the ability to activate the DNA amplifier, so they did not trigger the nucleic acid amplification reaction. Similarly, glucose, a common component in sugarcane, also did not have the ability to open the amplifier and could not initiate nucleic acid amplification, so the instantaneous current measured on the sensing platform was small. And by increasing the concentration, it was shown that under strong interference, the detection platform still had strong anti-interference ability.

[0080] When all interfering substances are mixed with the target (Mix in Figure 5 ), during the interference test, we found that in the presence of interfering substances, the current signal decreased slightly. This may be due to a large amount of interfering matrix being distributed on the electrode, inhibiting the electron transfer ability of the electrode. Nevertheless, this phenomenon indicates that the sensing platform still has good anti-interference ability and can maintain good detection performance in an environment containing a large amount of interfering matrix. This result confirms the reliability and stability of the detection platform in practical applications.

[0081] Among them, the detection platform constructed above supports an electrolyte of 15 mL phosphate (0.01 mol / L NaH 2 PO 4 / Na 2 HPO 4 , pH = 7.4) containing 5 mmol / L glucose and 500 μmol / L methylene blue.

[0082] The oligonucleotide sequence information used in the present invention is as follows:

[0083] Target of the pathogen causing shoot blight: 5’-GTTGTAAACTCGGTAATGATCCCT-3’

[0084] CP0: 5’-TTTCCTCTCTTCTCTTCTCAAACTCAGCTGAGGGATCATTACCGAGTTTGT T-3’

[0085] SP: 5’-AGAAGAGAAGAGAGG-NH 2

[0086] SH-CP: 5’-TCAGCCTCTCTTCTCTTCTCAAACTCATACTCGAAGAGACTG-SH

[0087] The above description is a detailed description of the preferred and feasible embodiments of the present invention, but the embodiments are not intended to limit the scope of the patent application of the present invention. Any equivalent changes or modifications made under the technical spirit disclosed by the present invention shall fall within the scope of the patent covered by the present invention.

Claims

1. A method for preparing a self-powered detection platform capable of efficiently detecting pathogens, characterized in that: The preparation method comprises the steps of constructing a bioanode of a self-powered detection platform using Cr-MOF, AuNPs, NF and GOx, and constructing a biocathode of a self-powered detection platform using Cr-MOF, AuNPs, NF and nucleic acid amplification products.

2. The method for preparing the self-powered detection platform according to claim 1, characterized in that: The specific preparation steps of the bioanode include: (1) Mix 1-3 mg of Cr-MOF and 1-3 mL of AuNPs solution to obtain a mixed solution, drop 30-40 μL of the mixed solution onto the NF, and incubate at 35-40 °C for 2-4 h; (2) Add 30-40 μL of EDC / NHS solution to the product obtained in step (1) and incubate for 30-60 minutes; (3) Add 30-60 μL of 5 mg / mL GOx solution to the product obtained in step (2) and react at 3-6 °C for 10-24 hours to obtain a bioanode.

3. The method for preparing the self-powered detection platform according to claim 1 or 2, characterized in that: The preparation steps of the Cr-MOF are as follows: dissolving 1-2 mol of Cr(NO3)3·9H2O and 1-2 mol of PTA in a solvent containing 4-5 mL of water and 0.2-3.6 mL of acetic acid, stirring for 30-60 minutes, performing a solvothermal reaction at 220-240°C for 8-10 hours, and after washing, vacuum drying at 50-60°C for 6-8 hours to obtain Cr-MOF.

4. The method for preparing the self-powered detection platform according to claim 1, characterized in that: The specific preparation steps of the biocathode include: (1) Mix 1-3 mg of Cr-MOF with 1-3 mL of AuNPs solution, then drop 30-40 μL of the mixture onto the NF and incubate at 35-40 °C for 2-4 h. (2) After the incubation, add 30-40 μL of EDC / NHS solution and continue incubation for 30-60 minutes, add 30-60 μL of 1 μmol / L SH-CP solution, and react at 4 °C for 10-24 hours; (3) After the reaction is completed and washed, add 20-40 μL of 6-mercapto-1-hexanol onto the NF and react at 25-30 °C for 30-60 minutes. Then add 20-40 μL of the nucleic acid amplification product OD and incubate at 35-40 °C for 2-4 hours to obtain the biocathode.

5. The method for preparing the self-powered detection platform according to claim 1 or 4, characterized in that: The preparation steps of the nucleic acid amplification product include: adding 10-15 μL of the target solution to a 100 μL DNA amplifier, then adding 2-4 μL of phi29 DNA polymerase and 10-20 μL of 10 mmol / L dNTPs, incubating at 35-40°C for 2-4 hours, and absorbing the reaction supernatant; adding 1-2 μL of phi29 DNA polymerase, 10-15 μL of 10 mmol / L dNTPs and 1-3 μL of Nt.BbvCI to the supernatant, reacting at 35-40°C for 0.5-4 hours, and then annealing at 70-80°C for 20-40 minutes to obtain the nucleic acid amplification product OD.

6. The method for preparing the self-powered detection platform according to claim 5, characterized in that: The preparation steps of the DNA amplifier include: mixing 50-70 μL of 1 μmol / L target capture probe CP0 and 50-70 μL of 1 μmol / L probe SP-NH2, annealing at 95°C for 5-10 minutes, transferring the formed CP-SP double strand to carboxyl-modified ferrosoferric oxide nanomagnetic beads, adding 20-40 μL of EDC / NHS solution, and reacting at 35-40°C for 6-12 hours to obtain the DNA amplifier.

7. A self-powered detection platform capable of efficiently detecting pathogens, prepared according to the preparation method according to any one of claims 1 to 6.

8. The self-powered detection platform capable of efficiently detecting pathogens according to claim 7, characterized in that: The self-powered detection platform is an electrochemical / colorimetric dual-mode detection platform, including a bioanode, a biocathode and an electrolyte, wherein the bioanode is composed of Cr-MOF / AuNPs / GOx, the biocathode is composed of Cr-MOF / AuNPs / nucleic acid amplification product, and the electrolyte contains glucose, methylene blue and PBS buffer solution.

9. Use of the self-powered detection platform according to claim 7 or 8 in detecting sugarcane tip rot pathogens.

10. Application of the self-powered detection platform according to claim 9 in detecting sugarcane tip rot pathogens, characterized in that: The method of application comprises the following steps: (1) Measure the instantaneous current of the detection platform when no sugarcane shoot rot pathogens are introduced; (2) After adding different concentrations of sugarcane tip rot pathogens, measure the instantaneous current of the detection platform; (3) In the colorimetric mode, when the sugarcane tip rot pathogen is not introduced, the dual-electrode system is placed in the electrolyte and the RGB Blue value of the electrolyte color is recorded; after the sugarcane tip rot pathogen is introduced, the dual-electrode system is placed in the electrolyte and the RGB Blue value of the electrolyte color is recorded; The electrolyte is 15-20 mL of phosphate electrolyte containing 5 mmol / L glucose and 500 μmol / L methylene blue.

Images