SNP molecular marker for identifying wheat thousand kernel weight and its application

Abstract

The present application relates to the technical field of genetic engineering, and particularly relates to a SNP molecular marker for identifying the thousand-grain weight of wheat and application thereof. The SNP site is located on the 7B chromosome of wheat, and the specific position is the 739932086th base pair, and the polymorphism is T and C. The SNP molecular marker provided by the present application can efficiently identify the thousand-grain weight of wheat, and has important significance for promoting high-yield breeding of plants.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an SNP molecular marker for identifying the thousand-grain weight of wheat and its application. Background Technology

[0002] wheat( Triticum aestivum L. Wheat, due to its wide planting range and abundant yield, is listed as one of the world's key food crops. Thousand-grain weight, as a key factor in measuring wheat yield per unit area, has a crucial impact on yield. KASP technology, or competitive allele-specific PCR, is a molecular marker technology based on SNP sites, renowned for its high stability, accuracy, and cost-effectiveness. In the field of high-throughput SNP genotyping, especially when the sample size is large but the number of SNP sites is limited, the application of KASP technology is particularly prominent. With the rapid growth of the global population, increasing wheat yield is of great significance. Currently, SNP markers related to wheat thousand-grain weight require further development. In view of this, this invention is proposed. Summary of the Invention

[0003] To address the aforementioned technical problems, this invention provides an SNP molecular marker for identifying the thousand-grain weight of wheat and its application.

[0004] Specifically, the technical solution provided by this invention is as follows:

[0005] This invention provides a high-yield SNP molecular marker, wherein the SNP molecular marker contains a nucleotide sequence with a polymorphism of T or C at position 739932086 bp on wheat chromosome 7B.

[0006] Preferably, plants with the polymorphic site genotype CC have a higher thousand-grain weight than plants with the genotype TT.

[0007] Secondly, the present invention provides a KASP primer combination for amplifying the SNP molecular marker, comprising forward primer 1, forward primer 2 and reverse primer; the nucleotide sequence of forward primer 1 comprises the nucleotide fragment shown in SEQ ID NO. 01; the nucleotide sequence of forward primer 2 comprises the nucleotide fragment shown in SEQ ID NO. 02; and the nucleotide sequence of reverse primer comprises the nucleotide fragment shown in SEQ ID NO. 03.

[0008] Thirdly, the present invention provides a detection reagent or kit for detecting high-yield characteristics of plants, the kit comprising the KASP primer combination.

[0009] In a fourth aspect, the present application provides a method for identifying high yield characteristics of a plant, comprising: using the KASP primer combination or the detection reagent or kit to perform PCR amplification with DNA of a plant sample as a template, and determining the thousand kernel weight of the plant sample according to the amplification result.

[0010] Preferably, determining the high yield characteristics of the plant sample according to the amplification result comprises: analyzing the genotype of the polymorphic site located at 739932086 bp of the 7B chromosome of wheat in the amplification product, and the plant with genotype CC has a higher thousand kernel weight than the plant with genotype TT.

[0011] Preferably, the plant is one or more of wheat, rice, barley or corn.

[0012] Preferably, the PCR amplification system comprises: KASP Mix (2X) KASP Mix (2X), 4-6 μL, Primer Mix, 0.12-0.16 μL, DNA 25-35 ng, and the rest is water, with a total system of 10 μL.

[0013] Preferably, the reaction program for PCR amplification is: 95℃ 8-12 min; 95℃ 15-25 s, 61℃ 60 s, 8-12 cycles, with a decrease of 0.5-0.7℃ in annealing temperature for each cycle; 95℃ 15-25 s, 55℃ 35-45 s, 32-36 cycles; 25℃ 10-20 min.

[0014] In a fifth aspect, the present application provides any one of the following applications of the SNP molecular marker, the KASP primer combination, or the detection reagent or kit:

[0015] (1) for identifying the thousand kernel weight of wheat;

[0016] (2) for early prediction of high yield characteristics of wheat;

[0017] (3) for molecular marker assisted breeding of wheat;

[0018] (4) for screening or breeding high yield plants

[0019] Beneficial effects:

[0020] The present application provides a SNP molecular marker for identifying the thousand kernel weight of wheat and its application, wherein the SNP site is located on the 7B chromosome of wheat, and the specific position is 739932086 base pairs, which shows polymorphism of T and C. The SNP molecular marker provided by the present application can efficiently identify the thousand kernel weight of wheat, and has important significance for promoting plant high yield breeding. BRIEF DESCRIPTION OF DRAWINGS

[0021] In order to more clearly illustrate the technical solutions in the present application or the prior art, the accompanying drawings required to be used in the embodiments or prior art description will be described below.

[0022] Figure 1 is the result of exon capture sequencing technology provided by the embodiment 1 of the present application TraesCS7B02G482100 Gene exon SNP site map.

[0023] Figure 2 is the statistical diagram of thousand kernel weight of different genotypes of 739932086 sites on 7B chromosome provided by the embodiment 2 of the present application.

[0024] Figure 3 is the genotyping result of wheat genotype of 739932086 sites on 7B chromosome provided by the embodiment 2 of the present application; wherein, TT represents 739932086-T, CC represents 739932086-C, and CK represents no template control, i.e. using ultrapure water instead of sample DNA.

[0025] Figure 4 is the sequencing peak diagram of different genotypes of 739932086 sites on 7B chromosome provided by the embodiment 2 of the present application. DETAILED DESCRIPTION

[0026] The present application provides a SNP site and its application in identifying plant thousand kernel weight, the SNP site is located on the 7B chromosome of wheat, and the specific position is the 739932086th base pair, which shows the polymorphism of T and C. By analyzing the phenotype difference of thousand kernel weight and exon capture analysis, the present application identifies a SNP site closely related to plant thousand kernel weight, and accordingly designs a set of KASP primer pairs. These primer pairs can efficiently identify the thousand kernel weight of wheat, which has important significance for promoting plant high-yield breeding.

[0027] The SNP site provided by the present application is located at 739932086bp of 7B chromosome, and the polymorphism is T / C.

[0028] The application provides a KASP primer combination for detecting the SNP site polymorphism, which comprises 739932086-F1 and 739932086-F2, and further comprises 739932086-R. The 739932086-F1 comprises the following nucleotide sequence AAGCCGACGATCATATTCGGT (SEQ ID NO. 01); the 739932086-F2 comprises the following nucleotide sequence AAGCCGACGATCATATTCGGC (SEQ ID NO. 02); and the 739932086-R comprises the following nucleotide sequence GCCGATCGATCGATGTAGATAG (SEQ ID NO. 03).

[0029] Further, the 739932086-F1 and 739932086-F2 in the KASP primer combination can be further connected with a fluorescent label sequence, for example, FAM (GCCTTTGACCCCGTTCATGCT) or HEX (GCCTTTCTTAGTCCCCTTATT).

[0030] In a specific embodiment provided by the application, the KASP primer combination is as follows:

[0031] 739932086-F1 (SEQ ID NO. 04):

[0032] 5'-GCCTTTGACCCCGTTCATGCTAAGCCGACGATCATATTCGGT-3'.

[0033] 739932086-F2 (SEQ ID NO. 05):

[0034] 5'-GCCTTTCTTAGTCCCCTTATTAAGCCGACGATCATATTCGGC-3'.

[0035] 739932086-R (SEQ ID NO. 03):

[0036] 5'-GCCGATCGATCGATGTAGATAG-3'.

[0037] The application further provides application of the SNP site, the KASP primer combination or the kit in identifying the thousand-grain weight of a plant.

[0038] The application further provides application of the SNP site, the KASP primer combination or the kit in screening or cultivating a high-yield plant.

[0039] Further, the plant is one or more of wheat, rice or corn.

[0040] The application further provides a method for identifying the thousand kernel weight of a plant, comprising: using the DNA of a plant sample to be tested as a template, and using the KASP primer combination or the kit to perform PCR amplification; and determining the thousand kernel weight of the plant sample to be tested according to the amplification result.

[0041] Further, the PCR amplification system comprises, in total 10 μL:

[0042] KASP Mix (2X), 4~6 μL, Primer Mix, 0.12~0.16 μL, DNA 25~35 ng, and the rest is water.

[0043] The reaction procedure of the PCR amplification comprises:

[0044] 95℃ 8~12 min; 95℃ 15~25 s, 61℃ 60 s, 8~12 cycles, and the annealing temperature decreases by 0.5~0.7℃ in each cycle; 95℃ 15~25 s, 55℃ 35~45 s, 32~36 cycles; and 25℃ 10~20 min.

[0045] Further, the Primer Mix comprises, in total 100 μL:

[0046] 739932086-F1, 100 μM, 10~14 μL, 739932086-F2, 100 μM, 10~14 μL, and 739932086-R, 100 μM, 10~14 μL, and the rest is water.

[0047] Further, the plant is one or more of wheat, rice or corn.

[0048] Further, the determination of the thousand kernel weight of the plant sample to be tested according to the amplification result comprises:

[0049] In the amplification result, the SNP site identifies a genotype of CC plant, and the plant with the genotype of CC has a higher thousand kernel weight than a plant with a genotype of TT.

[0050] The present application successfully identifies a SNP site closely related to the phenotype of thousand kernel weight of plants by analyzing the phenotype difference of thousand kernel weight and exon capture sequencing technology. The polymorphism of the SNP site can realize the accurate and rapid identification of the characteristics of the thousand kernel weight of plants. The marker of the site shows strong genetic stability, high resolution, and is suitable for high-throughput detection. The SNP site and the corresponding KASP primer pair provided by the present application can not only be used to identify the high and low of the thousand kernel weight of plants, but also can improve the efficiency of plant variety selection and shorten the breeding period, and has great application value for accelerating the development of high-yield plant breeding field.

[0051] In order to make the objects, technical solutions and advantages of the present application clearer, the technical solutions in the present application will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0052] The endpoints of the ranges and any values disclosed in this specification are not limited to the precise values stated. The ranges or values should be construed to be approximations that can vary depending on the intended application. For numerical ranges, the endpoints are included in the ranges, and the endpoints and individual points within the ranges are combinable to create new ranges that are not expressly disclosed.

[0053] In the description of the present application, the description of the terms "one embodiment", "some embodiments", "specific embodiments", or "some specific embodiments" means that the specific features, structures, materials or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of the present application. In the present application, the illustrative description of the above terms is not necessarily directed to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any appropriate manner in any one or more embodiments or examples. In addition, the skilled in the art can combine and combine the different embodiments or examples described in the present application and the features of the different embodiments or examples without contradiction.

[0054] In the embodiments provided in the present application, the specific technology or condition is not specified, which is carried out according to the technology or condition described in the literature in the art or according to the product instruction. The reagent or instrument used is not specified by the manufacturer, which is a conventional product that can be purchased through a regular channel.

[0055] The relevant wheat varieties (lines) involved in the following examples are provided by Professor Zhang Xueyong of the Institute of Crop Science, Chinese Academy of Agricultural Sciences, and the relevant wheat is sown in Xinxiang, Henan, and harvested after physiological maturity, naturally dried and used for subsequent analysis. It should be noted that, as a professional agricultural research institution, the applicant has long-term preservation of relevant germplasm materials, and the relevant wheat varieties are publicly available in the market or existing germplasm banks.

[0056] Example 1

[0057] This example explains the process of obtaining plant thousand kernel weight SNP markers and KASP primer design.

[0058] 1. Exon capture sequencing of 148 samples

[0059] In order to obtain wheat high thousand kernel weight regulatory genes, exon capture technology was first used to determine the genotypes of 148 wheat samples in order to preliminarily determine the development of wheat SNP molecular markers. The specific determination results are shown in Table 1 below.

[0060] 2. Obtain the thousand kernel weight of different wheat and develop SNP molecular markers.

[0061] In order to obtain wheat high thousand kernel weight regulatory genes, on the basis of exon sequencing, the thousand kernel weight phenotype of the above-mentioned 148 wheat varieties planted was determined in order to preliminarily determine the difference of wheat thousand kernel weight phenotype. The specific determination results are shown in Table 1 below.

[0062] Based on the 148 thousand kernel weight phenotype data determined in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to thousand kernel weight was mined, and a SNP site was screened on chromosome 7B of the wheat genome TraesCS7B02G482100 The SNP site exists in the exon of the gene, and the thousand kernel weight of the SNP variation is significantly increased, and a significant site affecting the thousand kernel weight of wheat (7B: 739932086 bp) is identified (part of the results are shown in Table 1 below) Figure 1 ), and the site is named: 739932086.

[0063] Based on the above sequence difference, and based on the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed, and the specific design is as follows:

[0064] 739932086-F1:

[0065] 5'-GCCTTTGACCCCGTTCATGCTAAGCCGACGATCATATTCGGT-3', (the "GCCTTTGACCCCGTTCATGCT" part of the 5' end sequence is the FAM marker sequence, SEQ ID NO. 06).

[0066] 739932086-F2:

[0067] 5'-GCCTTTCTTAGTCCCCTTATTAAGCCGACGATCATATTCGGC-3' (5' end "GCCTTTCTTAGTCCCCTTATT" part sequence is a HEX labeled sequence, SEQ ID NO. 07).

[0068] 739932086-R:

[0069] 5'-GCCGATCGATCGATGTAGATAG-3'.

[0070] When the primer pair combination of 739932086-F1 and 739932086-R is used, it is used to amplify the sequence of base T at the 739932086 locus on chromosome 7B in the wheat molecular marker.

[0071] When the primer pair combination of 739932086-F2 and 739932086-R is used, it is used to amplify the sequence of base C at the 739932086 locus on chromosome 7B in the wheat molecular marker.

[0072] Example 2

[0073] The application of the SNP molecular marker in identifying the thousand-grain weight of wheat is provided.

[0074] 1. Based on the primer pair design in Example 1, the genotypes (TT 50 / CC 40) of 90 wheat materials were detected, and the correlation between the genotypes and the thousand-grain weight phenotype was identified, and the specific process is as follows.

[0075] First, the genomic DNA of each wheat variety was extracted.

[0076] Then, according to the primer designed in Example 1, the DNA extracted above was used as a template to perform PCR (Quant Studio 1 fluorescent quantitative PCR instrument) detection analysis on different wheat samples.

[0077] The 10 μL amplification system was designed as follows during specific PCR amplification:

[0078] KASP Mix (2X), 5 μL; Primer Mix, 0.14 μL; DNA, 30 ng; ddH2O, supplemented to 10 μL; the Primer Mix, per 100 μL: 739932086-F1, 100 μM, 12 μL; 739932086-F2, 100 μM, 12 μL; 739932086-R, 100 μM, 30 μL; ddH2O, 46 μL.

[0079] The PCR reaction program is as follows (may be adjusted according to the amplification results):

[0080] 95℃ 10min; 95℃ 20 s, 61℃ 60 s (10 cycles, each cycle decreases by 0.6℃); 95℃ 20 s, 55℃ 40 s, 34 cycles; 25℃ 15 min.

[0081] 2. The genomic DNA of each wheat variety extracted in step 1 is used for ordinary PCR, and sequencing is performed to verify the accuracy of KASP genotyping.

[0082] First, specific primers are designed for amplification at 739932086 bp of wheat chromosome 7B (the reference sequence is Chinese Spring wheat), and the primer sequences are as follows:

[0083] A7BF: 5'-GCGAGATCGACCTTGGGCTG-3' (SEQ ID NO. 08).

[0084] A7BR: 5'-AAGGGAGATTGGAGAGGGTT-3' (SEQ ID NO. 09).

[0085] Randomly select 8 wheat varieties of TT / CC genotype in KASP genotyping results, and use an ordinary PCR instrument for amplification. After electrophoresis detection, sequencing is performed to verify the reliability of the genotyping results.

[0086] The specific PCR amplification system is designed as follows:

[0087] 2x EasyTaq PCR SuperMix for PAGE (+dye), 10 μL; Primer A7BF / A7BR, 1 μL each; DNA, 60 ng; ddH2O, supplemented to 25 μL.

[0088] The PCR reaction program is as follows (may be adjusted according to the amplification results):

[0089] 94℃ 5min; 94℃ 30s, 58℃ 30s, 72℃ 40s (35 cycles); 72℃ 10min; 16℃ end.

[0090] The specific genotype and the statistical result of the thousand-grain weight of the wheat are shown in Table 1 and Figures 1-4

[0091] Table 1: The corresponding result of different wheat variety genotypes and their thousand-grain weight

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098] Based on the above statistical result, it can be seen that: the average of the thousand-grain weight of the wheat with TT genotype is 35.46g; the average of the thousand-grain weight of the wheat with CC genotype is 38.43g. The thousand-grain weight of the wheat with CC genotype is significantly higher than that of the wheat with TT genotype, and increases by 8.37%, which has significant difference at the level of p<0.01. That is, the thousand-grain weight of the wheat with TT genotype is significantly lower than that of the wheat with CC genotype.

[0099] The present application can accurately evaluate the thousand-grain weight characteristics of the wheat by precisely detecting the specific gene site through the designed primer pair, and provides a solid foundation for the molecular assisted breeding. In addition, the present application can provide technical and theoretical support for developing new wheat varieties with different thousand-grain weight characteristics by using this gene site, which has great technical value for improving the yield of the wheat.

[0100] Finally, it should be noted that: the above examples are only used to illustrate the technical solutions of the present application, but not to limit it; although the present application has been described in detail with reference to the foregoing examples, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing examples, or make equivalent replacement for part of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present application.​

Claims

1. A method for identifying high yield characteristics in wheat, characterized in that, The application relates to a KASP primer combination or a detection reagent or kit comprising the KASP primer combination for identifying the thousand-grain weight of wheat. The KASP primer combination comprises a forward primer 1, a forward primer 2 and a reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 01; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 02; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

03. The high-yield characteristics of the wheat sample to be detected are determined according to the amplification result, which comprises the following steps: analyzing the genotype of the polymorphic site located at 739932086 bp of the wheat 7B chromosome in the amplification product, and the wheat with the genotype CC has a higher thousand-grain weight than the wheat with the genotype TT.

2. The method for identifying high yield characteristics in wheat according to claim 1, wherein, The PCR amplification system comprises the following components: KASP Mix (2X), 4-6 muL, Primer Mix, 0.12-0.16 muL, DNA 25-35 ng, and the rest is water.

3. The method for identifying high yield characteristics in wheat according to any one of claims 1-2, wherein, The reaction program for the PCR amplification is as follows: 95 DEG C for 8-12 min; 95 DEG C for 15-25 s, 61 DEG C for 60 s, 8-12 cycles, and the annealing temperature is reduced by 0.5-0.7 DEG C in each cycle; 95 DEG C for 15-25 s, 55 DEG C for 35-45 s, 32-36 cycles; and 25 DEG C for 10-20 min.

4. The method for identifying high yield characteristics in wheat according to claim 3, wherein, 5. The KASP primer combination or the detection reagent or kit comprising the KASP primer combination is applied to identifying the thousand-grain weight of wheat. The KASP primer combination comprises a forward primer 1, a forward primer 2 and a reverse primer; The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO. 01; The nucleotide sequence of the forward primer 2 is shown in SEQ ID NO. 02; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.

03. ​

Images