RNA (Ribonucleic Acid) molecular marker related to tomato yield and application thereof

Abstract

The invention discloses a tomato yield related RNA molecular marker and application thereof. The technical problem to be solved is to identify or assist in identifying tomato yield. Specifically, the invention discloses application of a product for detecting insertion deletion or polymorphism in hnRNA, mRNA and / or cDNA in identification or auxiliary identification of the yield of solanum plants and / or preparation of a reagent, a chip or a kit for identification or auxiliary identification of the yield of solanum plants. The insertion deletion refers to whether a sequence 3 exists between the 1020th site and the 1021th site of a sequence 4; the polymorphism comprises at least one of polymorphism 1, polymorphism 2, polymorphism 3 and polymorphism 4; the polymorphism 1 is A or G at the 876th site of the sequence 5; the polymorphism 2 is that the 973rd site of the sequence 5 is A or T; the polymorphism 3 is that the third site of the sequence 6 is A or G; and the polymorphism 4 is A or T at the 70th site of the sequence 6. The marker can be used for identifying the yield of solanum plants, and can be used for agricultural production.

Description

Technical Field

[0001] The present invention particularly relates to RNA molecular markers related to tomato yield and applications thereof. Background Art

[0002] Tomato (Solanum lycopersicum L.), a vegetable crop in the Solanaceae family, is considered a staple vegetable. Yield is a key agronomic trait of tomatoes, determined by both fruit weight and the number of fruits per plant. Modern cultivated tomatoes originated from the South American genus Solanum, which had a high number of fruits per panicle but a single fruit weight of only 2.04±0.85 g. Modern cultivated tomato varieties, however, have a reduced number of fruits per panicle but a significantly increased fruit weight of 111.33±68.19 g. In recent years, to further improve the performance of current cultivated tomato varieties, wild tomato genomes have been intentionally selected and introgressed into superior cultivars. To cultivate high-yield, high-quality tomato varieties, scientists have utilized genetics, molecular biology, and other methods to identify multiple major QTL loci associated with fruit weight. However, fruit weight, a key quantitative trait, remains largely unresolved, influencing the final fruit weight phenotype. Furthermore, current research has been limited to solely increasing fruit weight to improve yield, while overlooking the crucial role of fruit number per plant in yield. Currently, there are no molecular markers applicable to production for increasing the number of flowers and fruits per plant. The relationship between fruit weight and fruit number has also remained largely unexplored and unresearched. Therefore, identifying molecular markers associated with tomato fruit weight and fruit number remains a technical challenge for researchers in this field. Summary of the Invention

[0003] The technical problem solved by the present invention is to provide a molecular marker for identifying the yield, fruit weight, number of flowers and / or number of fruits of Solanum, and to identify the yield, fruit weight, number of flowers and / or number of fruits of Solanum through this molecular marker.

[0004] In order to solve the above technical problems, the present invention provides the use of a product for detecting insertions, deletions or polymorphisms in hnRNA, mRNA and / or cDNA in detecting and identifying or assisting in identifying economic traits or plant morphology of plants;

[0005] The insertion / deletion is any of the following:

[0006] B1) the indel is the presence of sequence 3 between positions 1020 and 1021 of sequence 4;

[0007] B2) an insertion / deletion sequence that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence;

[0008] The polymorphism includes at least one of polymorphism 1, polymorphism 2, polymorphism 3 and polymorphism 4;

[0009] The polymorphism 1 is any of the following:

[0010] C1) the polymorphism 1 is A or G at position 876 of sequence 5;

[0011] C2) a polymorphism that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence;

[0012] The polymorphism 2 is any of the following:

[0013] D1) the polymorphism 2 is A or T at position 973 of sequence 5;

[0014] D2) a polymorphism that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence;

[0015] The polymorphism 3 is any of the following:

[0016] D1) the polymorphism 3 is that the third position of sequence 6 is A or G;

[0017] D2) a polymorphism that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence;

[0018] The polymorphism 4 is any one of the following:

[0019] E1) the polymorphism 4 is A or T at position 70 of sequence 6;

[0020] E2) is a polymorphism of a ribonucleotide sequence that is reverse complementary to the sequence described in B1). Summary of the invention:

[0022] As mentioned above, the product is capable of detecting insertions, deletions or polymorphisms in hnRNA, mRNA and / or cDNA in a biological sample.

[0023] In the above, the biological sample is selected from one or more of roots, stems, leaves, flowers, fruits or seeds.

[0024] In the present application, the reagent is capable of detecting the above-mentioned insertion / deletion or polymorphism in a biological sample.

[0025] In the present application, the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant in which sequence 3 is not present between positions 1020 and 1021 of sequence 4 in the biological sample is higher than the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant in which sequence 3 is present between positions 1020 and 1021 of sequence 4.

[0026] In the present application, the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant whose 876th position in sequence 5 is G in the biological sample is higher than the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant whose 876th position in sequence 5 is A.

[0027] In the present application, the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant whose sequence 5 at position 973 is T in the biological sample is higher than the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant whose sequence 5 at position 973 is A.

[0028] In the present application, the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant whose 3rd position in sequence 6 is A in the biological sample is higher than the yield and / or fruit weight and / or number of flowers and / or number of fruits of the Solanum plant whose 3rd position in sequence 6 is G.

[0029] In the present application, the yield, fruit weight, flower number, and / or fruit number of the Solanaceae plant in the biological sample whose sequence 6 at position 70 is T is higher than the yield, fruit weight, flower number, and / or fruit number of the Solanaceae plant in the biological sample whose sequence 6 at position 70 is A. In the present application, the biological sample is selected from one or more of hnRNA, mRNA, and cDNA.

[0030] In the present application, the Solanum plant may be a tomato.

[0031] In this application, the yield described in 1) is the total weight of fruits per plant.

[0032] In this application, the fruit weight mentioned in 2) is the weight of a single fruit.

[0033] In this application, the number of flowers in the plant described in 3) refers to the number of flowers after all inflorescences in the spike have developed. The number of flowers can also be the average number of flowers. Average number of flowers = total number of flowers on each inflorescence / number of inflorescences surveyed.

[0034] In this application, the number of fruits of a plant described in 4) is the number of fruits after all fruits in the ear have fully developed. The number of fruits can also be the average number of fruits. Average number of fruits = total number of fruits on each inflorescence / number of inflorescences surveyed.

[0035] In the above, the completion of the development of all inflorescences of the ear and the completion of the development of all fruits of the ear means that the development of the inflorescences of the fifth ear is complete. The completion of the development of the inflorescences of the fifth ear means that no new flowers are produced in the fifth ear.

[0036] In order to solve the above technical problems, the present invention also provides a product for identifying or assisting in identifying the economic traits or plant morphology of Solanum plants.

[0037] The products include the above-mentioned products.

[0038] In the above-mentioned uses or the above-mentioned products, the economic traits are yield traits and / or the plant morphology is the morphology of plant reproductive organs.

[0039] In the above-mentioned uses or products, the yield trait is fruit weight and / or the plant reproductive organ morphology is the number of flowers and / or the number of fruits.

[0040] In the above-mentioned use, the insertion / deletion or polymorphism is detected by high-throughput sequencing method, in vitro nucleic acid amplification, and / or molecular labeling method.

[0041] In the above-mentioned use, wherein the amplification primers used in the in vitro nucleic acid amplification include F1 and R1;

[0042] The sequence of F1 is shown in Sequence 12; the sequence of R1 is shown in Sequence 13.

[0043] In the above-mentioned use, wherein the amplification primers for the molecular marker include primer pair 1 and primer pair 2;

[0044] The primer pair 1 consists of L-1 and L-2, and the primer pair 2 consists of R-1 and R-2;

[0045] The sequence of L-1 is shown in SEQ ID NO: 14; the sequence of L-2 is shown in SEQ ID NO: 15;

[0046] The sequence of the R-1 is shown in Sequence 16; the sequence of the R-2 is shown in Sequence 17.

[0047] In order to solve the above technical problems, the present invention also provides a method for identifying the yield of Solanum plants.

[0048] The method comprises detecting the insertion / deletion or polymorphism in the hnRNA, mRNA and / or cDNA of the tested Solanum plant, and identifying or assisting in identifying the yield of the Solanum plant based on the insertion / deletion or polymorphism of the tested Solanum plant, wherein the result is any combination of the following:

[0049] 1) The yield of Solanum plants in which the hnRNA, mRNA and / or cDNA is a deletion type or a deletion type whose sequence is reverse complementary to the sequence thereof and whose sequence is ribonucleotide is higher than the yield of Solanum plants in which the hnRNA, mRNA and / or cDNA is an insertion type or a insertion type whose sequence is reverse complementary to the sequence thereof and whose sequence is ribonucleotide;

[0050] 2) the yield of Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism whose reverse complement is a ribonucleotide sequence is higher than the yield of Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism whose reverse complement is a ribonucleotide sequence is higher;

[0051] 3) the yield of Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism whose reverse complement is a ribonucleotide sequence is higher than the yield of Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism whose reverse complement is a ribonucleotide sequence;

[0052] 4) the yield of Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism whose reverse complement is a ribonucleotide sequence is higher than the yield of Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism whose reverse complement is a ribonucleotide sequence is higher;

[0053] 5) The yield of Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide is higher than the yield of Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide.

[0054] In order to solve the above technical problems, the present invention also provides a breeding method for high-yield Solanum plants.

[0055] The method comprises detecting the insertion / deletion or polymorphism in the hnRNA, mRNA and / or cDNA of the tested Solanum plant, and breeding or assisting in breeding high-yield Solanum plants based on the insertion / deletion or polymorphism of the tested Solanum plant, wherein the result is any combination of the following:

[0056] 1) Among the Solanum plants in which the hnRNA, mRNA and / or cDNA are of insertional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence, and the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence, the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence are selected as high-yield varieties;

[0057] 2) among the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plant in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism is selected as a high-yield variety;

[0058] 3) Among the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a high-yield variety;

[0059] 4) Among the Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a high-yield variety;

[0060] 5) Among the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a high-yield variety;

[0061] In 1)-4), the yield of the high-yield variety is higher than that of other Solanaceae plants.

[0062] In order to solve the above technical problems, the present invention also provides a breeding method for Solanum plants with multiple flower numbers.

[0063] The method comprises detecting the insertion / deletion or polymorphism in the aforementioned hnRNA, mRNA and / or cDNA of the tested Solanum plant, and breeding or assisting in breeding Solanum plants with a large number of flowers based on the insertion / deletion or polymorphism of the tested Solanum plant, wherein the result is any combination of the following:

[0064] 1) Among the Solanaceae plants in which the hnRNA, mRNA and / or cDNA are of insertional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence, and the Solanaceae plants in which the hnRNA, mRNA and / or cDNA are of deletional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence, the Solanaceae plants in which the hnRNA, mRNA and / or cDNA are of deletional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence are selected as varieties with a large number of flowers;

[0065] 2) among the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as species with multiple flower numbers;

[0066] 3) among the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plant in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism is selected as a variety with a large number of flowers;

[0067] 4) among the Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a variety with a large number of flowers;

[0068] 5) Among the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a variety with a large number of flowers;

[0069] In 1)-4), the number of flowers of the variety with multiple flowers is greater than the number of flowers of other Solanum plants.

[0070] In order to solve the above technical problems, the present invention also provides a breeding method for Solanum plants with a large number of fruits.

[0071] The method comprises detecting the insertion / deletion or polymorphism in the hnRNA, mRNA and / or cDNA of the tested Solanum plant, and breeding or assisting in breeding Solanum plants with a high number of fruits based on the insertion / deletion or polymorphism of the tested Solanum plant, wherein the result is any combination of the following:

[0072] 1) Among the Solanaceae plants in which the hnRNA, mRNA and / or cDNA are of insertional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence, and the Solanaceae plants in which the hnRNA, mRNA and / or cDNA are of deletional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence, the Solanaceae plants in which the hnRNA, mRNA and / or cDNA are of deletional type or reverse complementary to the sequences thereof and have a ribonucleotide sequence are selected as varieties with a large number of fruits;

[0073] 2) among the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as species with multiple flower numbers;

[0074] 3) among the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plant in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism is selected as a variety with a large number of fruits;

[0075] 4) among the Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a variety with a large number of fruits;

[0076] 5) Among the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, and the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence, the Solanum plant in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and a ribonucleotide sequence is selected as a variety with a large number of fruits;

[0077] In 1)-4), the number of fruits of the high-fruit variety is greater than the number of fruits of other Solanum plants.

[0078] In the above, the following arbitrary combination refers to a single feature or a combination of multiple features.

[0079] In the above, the insertion type is the presence of sequence 3 between positions 1020 and 1021 of sequence 4, or an insertion type that is reverse complementary to the sequence described above and is a ribonucleotide sequence, specifically a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0080] In the above, the deletion type is the absence of sequence 3 between positions 1020 and 1021 of sequence 4, or a deletion type that is reverse complementary to the sequence described above and is a ribonucleotide sequence, specifically a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0081] In the above, the polymorphism 1 is A, which is an A at position 876 of sequence 5. Or a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0082] In the above, the polymorphism 1 is G, which means that the 876th position of sequence 5 is G. Or it is a polymorphism that is reverse complementary to the sequence described above and the sequence is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0083] In the above, the polymorphism 2 is A, which is an A at position 973 of sequence 5. Or a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0084] In the above, the polymorphism 2 is T, which is a polymorphism in which position 973 of sequence 5 is T. Or a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence, specifically a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0085] In the above, the polymorphism 3 is A, which is a polymorphism in which the third position of sequence 6 is A. Or a polymorphism which is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence which is reverse complementary to the sequence described above.

[0086] In the above, the polymorphism 3 is G, which means that the third position of sequence 6 is G. Or it is a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0087] In the above, the polymorphism 4 is A, which is an A at position 70 of sequence 6. Or a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0088] In the above, the polymorphism 4 is T, which is a polymorphism in which position 70 of sequence 6 is T. Or a polymorphism which is reverse complementary to the sequence described above and is a ribonucleotide sequence, specifically a ribonucleotide sequence which is reverse complementary to the sequence described above.

[0089] In the above, the insertion type is the presence of sequence 3 between positions 1020 and 1021 of sequence 2. Specifically, it can be sequence 1. Or an insertion type that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0090] In the above, the deletion type is the absence of sequence 3 between positions 1020 and 1021 of sequence 2. Specifically, it can be sequence 2. Or a deletion type that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0091] In the above, the polymorphism 1 is A, which is A at position 876 of sequence 18. Specifically, it can be sequence 18. Or a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0092] In the above text, the polymorphism 1 is G, which is G at position 876 of sequence 20. Specifically, it can be sequence 20. Or it can be a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0093] In the above, the polymorphism 2 is A, which is A at position 973 of sequence 18. Specifically, it can be sequence 18. Or a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0094] In the above text, the polymorphism 2 is T, which means that the 973rd position of sequence 20 is T. Specifically, it can be sequence 20. Or it can be a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0095] In the above, the polymorphism 3 is A, which means that the third position of sequence 21 is A. Specifically, it can be sequence 21. Or it can be a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0096] In the above, the polymorphism 3 is G, which means that the third position of sequence 19 is G. Specifically, it can be sequence 19. Or it can be a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0097] In the above, the polymorphism 4 is A, which is A at position 70 of sequence 19. Specifically, it can be sequence 19. Or it can be a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0098] In the above text, the polymorphism 4 is T, which is T at position 70 of sequence 21. Specifically, it can be sequence 21. Or it can be a polymorphism that is reverse complementary to the sequence described above and is a ribonucleotide sequence. Specifically, it can be a ribonucleotide sequence that is reverse complementary to the sequence described above.

[0099] In the above method, the polymorphism or indel is homozygous. The term "polymorphism or indel is homozygous" refers to the situation where no other polymorphisms or indels other than those defined or described are present in the hnRNA, mRNA and / or cDNA.

[0100] In the above, the polymorphisms or insertions and deletions are differences at the hnRNA, mRNA and / or cDNA levels.

[0101] In any of the above uses or methods, the Solanum plant is tomato.

[0102] In any of the above uses or any of the above methods, the Solanum plant is a pure line.

[0103] In the above, the tomatoes are tomato varieties Moneymaker (MM) and / or tomato varieties LA1310 (CC) and / or offspring bred with tomato varieties Moneymaker (MM) and / or tomato varieties LA1310 (CC) as parents.

[0104] Beneficial effects

[0105] This study, for the first time, utilized molecular marker-assisted breeding to develop a linkage marker for tomato fruit weight and fruit number, which was then validated in near-isogenic lines. This molecular marker can be used to rapidly identify high-yielding tomato varieties that exhibit increased fruit weight, flower number, and fruit number, significantly shortening the breeding process and promoting the development of new high-yield tomato varieties.

[0106] This linked marker can simultaneously screen for two key yield-regulating traits, fruit weight and fruit number. Tomato varieties with increased fruit weight and fruit number can be selected during the seedling stage. There is no need to wait until the fruit is ripe to measure the yield. This greatly shortens the identification time and the breeding process, providing important reference value for the cultivation of high-yield tomato varieties.

[0107] The present invention discloses RNA molecular markers related to tomato yield and their applications. The technical problem to be solved is to identify or assist in determining tomato yield. Specifically disclosed are the uses of products for detecting insertions, deletions or polymorphisms in hnRNA, mRNA and / or cDNA in any of the following: 1) identifying or assisting in identifying the yield of Solanaceae plants and / or preparing reagents, chips or kits for identifying or assisting in identifying the yield of Solanaceae plants; 2) identifying or assisting in identifying the weight of Solanaceae plants’ fruits and / or preparing reagents, chips or kits for identifying or assisting in identifying the weight of Solanaceae plants’ fruits; 3) identifying or assisting in identifying the number of Solanaceae plants’ flowers and / or preparing reagents, chips or kits for identifying or assisting in identifying the number of Solanaceae plants’ flowers; 4) identifying or assisting in identifying the number of Solanaceae plants’ flowers. The invention relates to a method for identifying the number of fruits of a plant and / or preparing a reagent, chip or kit for identifying or assisting in identifying the number of fruits of a plant of the genus Solanum; the insertion / deletion is the presence or absence of sequence 3 between positions 1020 and 1021 of sequence 4; the polymorphism includes at least one of polymorphism 1, polymorphism 2, polymorphism 3 and polymorphism 4; the polymorphism 1 is A or G at position 876 of sequence 5; the polymorphism 2 is A or T at position 973 of sequence 5; the polymorphism 3 is A or G at position 3 of sequence 6; the polymorphism 4 is A or T at position 70 of sequence 6, or the reverse complement of the above sequences and the sequence is a ribonucleotide insertion / deletion or polymorphism. The above markers can be used to identify the yield of the plant of the genus Solanum and can be used in agricultural production. BRIEF DESCRIPTION OF THE DRAWINGS

[0108] Figure 1 This is a phenotypic identification diagram of the number of flowers and fruits of the parents ST109 and ST035.

[0109] Figure 2 This is a diagram of the construction and phenotypic identification of near-isogenic lines.

[0110] Figure 3 To identify the single fruit weight of near-isogenic lines.

[0111] Figure 4 It is used to identify the single plant yield of near-isogenic lines.

[0112] Figure 5 This is the identification result of ST035 strain linked marker primer L.

[0113] Figure 6 This is the identification result of ST035 strain linked marker primer R. DETAILED DESCRIPTION

[0114] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0115] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or according to product specifications. Materials and reagents used in the following examples are commercially available unless otherwise noted. Quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0116] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean ± standard deviation and tested using t-test. P < 0.05 (*) indicated a significant difference, and P < 0.01 (**) indicated an extremely significant difference.

[0117] Unless otherwise indicated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, terms and laboratory procedures related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, microbiology, and immunology used herein are those widely used in the respective fields and are standard procedures. To facilitate a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0118] As used herein, the term "product" includes, but is not limited to, a reagent, a chip, or a kit.

[0119] As used herein, the term "economic traits" refers to traits exhibited by crops that are related to production performance and economic benefits, including but not limited to yield traits, quality traits, and maturity traits. Yield refers to fruit weight.

[0120] As used herein, the term "plant morphology" refers to the appearance and structure of various plant organs, i.e., the appearance and structure of the entire plant, the number of organ fruits, the number of tissue fruits, the number of cell fruits, and the appearance and structure of organelles and molecules. This includes, but is not limited to, the morphology of plant reproductive organs and the morphology of plant vegetative organs. Plant morphology and plant reproductive organ morphology include, but are not limited to, flower morphology, fruit morphology, and seed morphology. Flower morphology includes, but is not limited to, the number of flowers. Fruit morphology includes, but is not limited to, the number of fruits.

[0121] As used herein, the term "mRNA" refers to mRNA obtained by transcription of the Solyc12g008900 gene by RNA polymerase.

[0122] As used herein, the term "hnRNA" refers to the various forms from the completion of transcription and splicing of the Solyc12g008900 gene to the acquisition of mature mRNA, and contains the same sequence as the mRNA.

[0123] As used herein, the term "cDNA" refers to a DNA strand that is complementary to mRNA.

[0124] As used herein, the term "kit" refers to any delivery system used to deliver a substance. In assays, such delivery systems include systems for storing, transporting, or delivering reagents (e.g., oligonucleotides, enzymes, etc. in appropriate containers) and / or support materials (e.g., buffers, instructions for performing the assay, etc.) from one location to another. For example, a kit comprises one or more housings (e.g., boxes) containing the relevant reagents and / or support materials.

[0125] As used herein, the term "indel" refers to the difference in RNA between two parents. It specifically refers to indels in hnRNA, mRNA, and / or cDNA. Indels can be directly detected in hnRNA and / or mRNA nucleic acid sequences, or indels can be detected in cDNA nucleic acid sequences. As long as indels can be detected directly or indirectly in RNA, they are included in the term. In a specific embodiment, the indel refers to the presence of sequence 3 between positions 1020 and 1021 of sequence 4, or an indel reversely complementary to the sequence described therein, and having a ribonucleotide sequence. If sequence 3 is present between positions 1020 and 1021 of sequence 4, then the indel is sequence 1, or a sequence reversely complementary to the sequence described therein, and having a ribonucleotide sequence. If sequence 3 is not present between positions 1020 and 1021 of sequence 4, then the indel is sequence 2, or a sequence reversely complementary to the sequence described therein, and having a ribonucleotide sequence.

[0126] As used herein, the term "polymorphism" refers to the difference in RNA between two parents. It specifically refers to single nucleotide polymorphisms in hnRNA, mRNA, and / or cDNA. Polymorphisms in hnRNA and / or mRNA nucleic acid sequences can be directly detected, or polymorphisms in cDNA nucleic acid sequences can be detected. As long as insertions and deletions in RNA can be detected directly or indirectly, they are within the meaning of the term. In a specific embodiment, the single nucleotide polymorphism refers to the polymorphism including at least one of polymorphism 1, polymorphism 2, polymorphism 3, and polymorphism 4. Polymorphism 1 is a polymorphism in which the 876th position of sequence 5 is A or G, or a sequence reversely complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 876th position of sequence 5 is A, then sequence 18 is a sequence reversely complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 876th position of sequence 5 is G, then sequence 20 is a sequence reversely complementary to the sequence described therein, and the sequence is a ribonucleotide. Polymorphism 2 is a polymorphism in which the 973rd position of sequence 5 is A or T, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 973rd position of sequence 5 is A, the sequence is sequence 18, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 973rd position of sequence 5 is T, the sequence is sequence 20, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. Polymorphism 3 is a polymorphism in which the 3rd position of sequence 6 is A or G, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 3rd position of sequence 6 is G, the sequence is sequence 19, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 3rd position of sequence 6 is A, the sequence is sequence 21, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. Polymorphism 4 is a polymorphism in which the 70th position of sequence 6 is A or T, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 70th position of sequence 6 is A, the sequence is sequence 19, or is reverse complementary to the sequence described therein, and the sequence is a ribonucleotide. If the 70th position of sequence 6 is T, it is sequence 21 or a sequence that is reverse complementary to the sequence described therein and the sequence is ribonucleotides.

[0127] As used herein, the term "RNA molecular marker" refers to a heritable and detectable RNA sequence. The RNA molecular marker includes, but is not limited to, hnRNA and / or mRNA. In specific embodiments, it also includes cDNA obtained by reverse transcription of hnRNA and / or mRNA. In specific embodiments, the transcribed sample may be a transcript (mRNA). In this application, the description of "RNA" in the context of RNA molecular markers includes, but is not limited to, hnRNA and / or mRNA and / or cDNA.

[0128] As used herein, the term "ribonucleotide" refers to an important component of RNA, wherein the five-carbon sugar in the ribonucleotide is ribose, including adenine ribonucleotide, guanine ribonucleotide, cytosine ribonucleotide and uracil ribonucleotide.

[0129] As used herein, the term "deoxyribonucleotide" refers to an important component of DNA, wherein the pentose sugar in the ribonucleotide is 2-deoxyribose, including adenine deoxyribonucleotide, guanine deoxyribonucleotide, cytosine deoxyribonucleotide and thymine deoxyribonucleotide.

[0130] As used herein, the term "reverse complement" refers to the operation of performing a reverse operation on a DNA sequence (i.e., reversing the sequence order) and then performing complementary pairing (A paired with T, C paired with G) on the bases therein. Wherein, A is an adenine deoxyribonucleotide, T is a thymine deoxyribonucleotide, C is a cytosine deoxyribonucleotide, and G is a guanine deoxyribonucleotide. Including but not limited to the following examples: the reverse complement of the ATCGATCG sequence is the CGATCGA sequence; the reverse complement of the ATCGrATCG (wherein r is A or G) sequence is the CGATYCGAT (wherein y is T or C) sequence, where A is an adenine deoxyribonucleotide, T is a thymine deoxyribonucleotide, C is a cytosine deoxyribonucleotide, and G is a guanine deoxyribonucleotide.

[0131] As used herein, the term "sequence is ribonucleotide" means that the sequence shown is replaced with a ribonucleotide sequence. In this application, it specifically refers to replacing deoxyribonucleotides with ribonucleotides. The specific replacement rule is to replace adenine deoxyribonucleotides with adenine ribonucleotides, replace guanine deoxyribonucleotides with guanine ribonucleotides, replace cytosine deoxyribonucleotides with cytosine ribonucleotides, and replace thymine deoxyribonucleotides with uracil ribonucleotides. And the connection method remains unchanged. Including but not limited to the following examples: the CGATCGAT sequence is the ribonucleotide sequence of CGAUCGAU; the CGATYCGAT (wherein y is T or C) sequence is the ribonucleotide sequence of CGAUYCGAU (wherein y is Y or C), wherein A is an adenine ribonucleotide, U is a uracil ribonucleotide, C is a cytosine ribonucleotide, and G is a guanine ribonucleotide.

[0132] In the above, the deoxyribonucleotide may be a deoxyribonucleotide residue including, but not limited to, an adenine deoxyribonucleotide residue, a guanine deoxyribonucleotide residue, a cytosine deoxyribonucleotide residue, and a thymine deoxyribonucleotide residue.

[0133] In the above, the ribonucleotide may be a ribonucleotide residue including, but not limited to, an adenine ribonucleotide residue, a guanine ribonucleotide residue, a cytosine ribonucleotide residue, and a uracil ribonucleotide residue.

[0134] As used herein, the term "in vitro nucleic acid amplification" refers to a technique for exponentially amplifying DNA or RNA in vitro using specific enzymes and chemical reagents. Such in vitro nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), strand displacement amplification (SDA), ligase chain reaction (LCR), nucleic acid sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent isothermal amplification (HDA), or Qβ replication technology.

[0135] As used herein, the term "molecular marker" refers to a molecular marker that can be linked to a specific trait, and specifically refers to a molecular marker that can be linked to the above-mentioned insertion / deletion and / or polymorphism.

[0136] As used herein, the term "nightshade" refers to plants of the genus Solanaceae, family Solanaceae, kingdom Plantae, phylum Angiosperms, class Magnoliales, order Solanales.

[0137] As used herein, the term "tomato" refers to kingdom Plantae, phylum Angiosperms, class Magnoliales, orders Solanales, family Solanaceae, genus Solanum, lycopersicon.

[0138] As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms, meaning including but not limited to. As used herein, the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of technical features being referred to. Thus, a feature specified as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.

[0139] Moneymaker (MM) S. Lycopersicum cv. Moneymaker (MM): purchased from Tomato genetics resource center.

[0140] LA1310(CC)S.lycopersicum var.cerasiforme LA1310(CC): purchased from Tomatogenetics resource center.

[0141] Moneymaker (MM) and LA1310 (CC) are disclosed in the following documents:

[0142] Literature 1: Wang,

[0143] Document 2: Li, R., Sun, S., Wang, H. et al. FIS1 encodes a GA2-oxidase thatregulates fruit firmness in tomato. Nat Commun 11, 5844 (2020). https: / / doi.org / 10.1038 / s41467-020-19705-w

[0144] The name of LA1310(CC) in Document 1 or Document 2 is Solanum lycopersicum var. cerasiforme LA1310(CC) or LA1310(CC).

[0145] The name of Moneymaker (MM) in Document 1 or Document 2 is S. lycopersicum Moneymaker (MM) or Moneymaker (MM).

[0146] Example 1. Discovery of linked markers

[0147] 1. The tomato cultivar Moneymaker (MM), known for heavy fruit but a small number of fruits, and the tomato cultivar LA1310 (CC), known for light fruit but a large number of fruits, were hybridized to obtain the F1 generation. The F1 generation was self-pollinated to obtain an F2 generation segregating population. After 10 generations of continuous self-pollination, a population of genetically stable recombinant inbred lines (RILs) was obtained. Two strains, ST035 and ST109, were selected from this population of RILs. The inflorescences of these two strains, ST035 and ST109, were primarily single-branched, with significant differences in the number of flowers and fruits per inflorescence.

[0148] In the spring of 2023, the autumn of 2023, the spring of 2024, and the autumn of 2024, the seeds were directly sown in the sowing shed of the Nankou Seedling Base in Beijing, and transplanted into the greenhouse of the Nankou Seedling Base about 30-40 days later. The temperature in the greenhouse averaged 14 hours of light and 10 hours of darkness during the day, with an average daytime temperature of 28 degrees Celsius and a nighttime temperature of about 22 degrees Celsius. After the fifth spike inflorescence was developed, the number of flowers and fruits on each inflorescence of the two materials was investigated. The number of flowers produced on the inflorescence of the first 2-4 spikes (the number of flowers was continuously monitored and totaled when the fifth spike inflorescence was developed) and the number of normally developed fruits were investigated. The average number of flowers and the average number of fruits were calculated, and the phenotypes were recorded. After the investigation, the average number of flowers on each inflorescence of ST035 was 26 and the average number of fruits was 16, while the average number of flowers on each inflorescence of ST109 was 6 and the average number of fruits was 4. The results showed that the number of flowers and fruits of ST035 were significantly higher than those of ST109 (phenotype photos are shown in Figure 1 As shown in a, the average number of flowers is Figure 1 As shown in b, the average number of fruits is Figure 1 (as shown in c).

[0149] Average number of flowers = total number of flowers on each inflorescence / number of inflorescences surveyed.

[0150] Average number of fruits = total number of fruits on each inflorescence / number of inflorescences surveyed.

[0151] The sign that the development of the fifth ear inflorescence is complete is that no new flowers are produced in the fifth ear.

[0152] 2. To identify key regulatory genes for fruit number, ST109 and ST035 were hybridized to generate the F1 generation. ST109 was then used as the recurrent parent (maternal parent) for backcrossing to generate the BC1F1 generation. The BC1F1 generation was then selfed to generate the BC1F2 segregating population. The average number of fruits per inflorescence per plant in the BC1F2 segregating population was determined. Results showed a normal distribution of fruit number (number of flowers produced and number of fruits developed in the first two to four inflorescences after the fifth inflorescence developed), indicating that the trait is a quantitative trait regulated by multiple genes. Within the BC1F2 segregating population, 30 plants each with extreme high and low fruit numbers were selected. DNA was extracted and pooled for sequencing. BSA analysis ultimately identified two major QTLs associated with fruit number. The most dominant QTL, located within the 0.1 M region on chromosome 12, was identified and tentatively designated qFN12.

[0153] To identify the key differential sequences in qFN12 between ST035 and ST109, we conducted multiple generations of fine mapping and ultimately identified the core differentially expressed gene for qFN12 within this region, the Solyc12g008900 (CKX3) gene. Full-length cloning of this gene revealed a -269 bp deletion in the CDS region of the Solyc12g008900 gene in ST035, resulting in a frameshift mutation and premature termination. However, translation of the Solyc12g008900 gene was normal in ST109. Using the Solyc12g008900 gene CDS as a template, the CDS sequences of the gene in ST035 and ST109 obtained using primers F1+R1 are shown below: F1: ATGGCTAAGTTTTTTTTATCCTATGG (SEQ ID NO: 12); R1: CTAATTAAAAATTCTTTGTCCTGGTGATAGAATCATC (SEQ ID NO: 13). The results of amplifying the CDS region of the Solyc12g008900 gene of the ST035 material using the F1 and R1 primer pairs are shown in Sequence 2. The results of amplifying the CDS region of the Solyc12g008900 gene of the ST109 material using the F1 and R1 primer pairs are shown in Sequence 1.

[0154] The differences are as follows:

[0155] The precursor mRNA or mRNA or cDNA encoded by the fn12 gene has the following differences:

[0156] Pre-mRNA or mRNA level:

[0157] The pre-mRNA or mRNA of the ST109 type plant contains an mRNA or mRNA sequence complementary to Sequence 1. Furthermore, the ST109 type plant does not contain a pre-mRNA or mRNA sequence complementary to Sequence 2.

[0158] The pre-mRNA or mRNA of the ST035 type plant contains an RmRNA or mRNA sequence complementary to Sequence 2. Furthermore, the ST035 type plant does not contain a pre-mRNA or mRNA sequence complementary to Sequence 1.

[0159] cDNA level:

[0160] The cDNA of the ST109 type plant contains the cDNA sequence of Sequence 1. Furthermore, the ST109 type plant does not contain the cDNA sequence of Sequence 2.

[0161] The cDNA of the ST053 type plant contains the cDNA sequence of Sequence 2. Furthermore, the ST035 type plant does not contain the cDNA sequence of Sequence 1.

[0162] The difference between sequence 1 and sequence 2 is:

[0163] Compared with sequence 1, sequence 2 has the following four single base mutations, namely single base mutation 1, single base mutation 2, single base mutation 3, single base mutation 4, and one deletion mutation.

[0164] Compared with sequence 1, sequence 2 has a deletion mutation in which there is a 269 bp (sequence 3) deletion mutation between nucleotides 1020 and 2021 of sequence 2.

[0165] Compared with sequence 1, sequence 2 has a single base mutation 1, which is a single base mutation of A>G at position 876 of sequence 2 (equivalent to position 876 of sequence 1).

[0166] Compared with sequence 1, single base mutation 2 of sequence 2 is a single base mutation of A>T at position 973 of sequence 2 (equivalent to position 973 of sequence 1).

[0167] Compared with sequence 1, single base mutation 3 of sequence 2 is a single base mutation of G>A at position 1024 of sequence 2 (equivalent to position 1293 of sequence 1).

[0168] Compared with sequence 1, single base mutation 4 of sequence 2 is a single base mutation with A>T at position 1090 of sequence 2 (equivalent to position 1359 of sequence 1).

[0169] Sequence 1 is as follows:

[0170]

[0171] Sequence 2 is as follows:

[0172] ATGGCTAAGTTTTTTTTATCCTATGGTTATAATATTATTATTTTCTTTATTATTACTCATTTAATGTCCATTTTAGGAAAGTTAAAACCATGGAATCCTTCAATTCCTTATGAAATTCTTTCACTTAATATTTCATCAAAACTTAGTACAAATTCTCATGCTATTAAAGAATCTTCCAAAGATTTTGGAAAAATTATTCAAGAATATTACCAGCTGCTGTTCTTTATCCTTCTTGTGTTAATGACATAATTGACCTCATACAATTTTCTTATGACCTTTCTGTCCCTTTTCATGTAGCAGCCAAAGGTCATGGACAT TCCATTAGGGGACAAGCCATGGCAAAAAATGGGGTAATTGTGGAAATGAGTTCTTTAAATAATAATAATAATGAGAATTGTGGTGTTAGGGTTTCTTGGGATTCGGATTTAGGGTTTTACGCGGATGTTGGAGGTGAACAATTATGGATTGATGTTCTTCATAACACCCTAGAGTATGGCTTAGCACCTGTTTCATGGACAGATTATTTGTACCTTACCGTTGGTGGTACACTCTCTAATGCTGGAATTAGTGGTCAAACTTTTCGATATGGTCCTCAAATAAGTAACGTTCATGAGATGGATGTTATTACAGGTAAAGGGGAATTAATGACTTGCTCCAAAGATATGAATTCAGAATTGTTTTTTGGAGTTTTAGGAGGTTTGGGACAGTTTGGAATAATAACAAGAGCAAGAATTGTCTTGGATAAAGCACCAACAAGAGTGAAATGGGTGAGAATGTTATATGATGATTTCTCAAAATTCACAAAAGATCAAGAACATCTTATTTCAATTCATAATAATGGATTGGATTATGTTGAAGGCTCTCTAATGATGGAGCAAAGCTCTCTAAATAATTGGAGATCTTCATTTTATTCACCTTCCAATCAAACCAAAATTGCTTCATTATTATCCAAAAATAAAATCATGTATTGCTTGGAAATAGTGAAGTACTATGATGACCAAAATGCTAATACTATTGATAAGATGGGATGATAGGATGTCAGCAATAATACCAGAAGAAGAAACATTTTATTGTGTGGGACTTTTACATTCTTCAAGTGGATATAATGAATGCAAAATTTTGGATAATCAAAATGAAGAAATATTAAATTATTGTGATAAAGTTGGCCTCAATATAAAGCAATATCTTCCACATTACAAGACAAAAGAGGATTGGATCAAACATTTTGGTAAAAAATGGAATATTTTTCAACAAAGAAAAGATCTATTTGATCCAAAGATGATTCTATCACCAGGACAAAGAATTTTTAATTAG。

[0173] The specific sequence 3 is as follows:

[0174] AAGGAGTTGAAGAAGTTGGTAAAAGGATTGAAGTATGTAGGTGGATTTATGTTCAAGAAAGATGTGAGTTTTGTGGAATTTTTGAATAGAGTTAGAAGTGGGGAATTAGAGTTACAATCAAAAGGAATGTGGGATGTTCCACATCCATGGCTCAATTTGTTTGTACCAAAGTCTTCTATCATGCATTTTAATGCTGCTGTTTTTGTGGACATAATCCTCAGACAAAACAAGACAAATGGACCCATACTTGTCTACCCAACAAGTAGGAA。

[0175] The specific sequence 4 is as follows:

[0176]

[0177] Sequence 5 is as follows:

[0178]

[0179] Sequence 6 is as follows:

[0180] AAGrTGGGATGATAGGATGTCAGCAATAATCCAGAAGAAGAAACATTTTTATTGTGTGGGACTTTTACAwTCTTCAAGTGGATATAATGAATGCAAAATTTTGGATAATCAAAATGAAGAAATATTAAATTATTGTGATAAAGTTGGCCTCAATA TAAAGCAATATCTTCCACATTACAAGACAAAAGAGGATTGGATCAAACATTTTGGTAAAAAATGGAATATTTTTCCAACAAAGAAAAGATCTATTTGATCCAAAGATGATTCTATCACCAGGACAAAGAATTTTTAATTAG, where r is A or G and W is A or T.

[0181] Furthermore, the above differences were optimized to determine the presence of five polymorphisms in the RNA of the two plants, namely four polymorphic sites (polymorphism 1, polymorphism 2, polymorphism 3 and polymorphism 4) and one insertion and deletion site (indel), and were expressed at the pre-mRNA or mRNA level or cDNA level:

[0182] cDNA level:

[0183] In the cDNA sequence:

[0184] Polymorphism 1 is A or G at position 876 of sequence 5. Polymorphism 1 being A is A at position 876 of sequence 5. Polymorphism 1 being G is G at position 876 of sequence 5.

[0185] Polymorphism 2 is when the 876th position of sequence 5 is A or T. Polymorphism 2 is A when the 876th position of sequence 5 is A. Polymorphism 2 is A when the 876th position of sequence 5 is T.

[0186] Polymorphism 3 is when the 876th position of sequence 6 is G or A. Polymorphism 3 is G when the 876th position of sequence 6 is G. Polymorphism 3 is G when the 876th position of sequence 6 is A.

[0187] Polymorphism 4 is A or T at position 876 of sequence 6. Polymorphism 4 being A is A at position 876 of sequence 6. Polymorphism 4 being T is T at position 876 of sequence 6.

[0188] An indel is the presence of sequence 3 between positions 1020 and 1021 of sequence 4. An insertion (also known as insertion type or insertion sequence type) is the presence of sequence 3 between positions 1020 and 1021 of sequence 4. A deletion (also known as deletion type or deletion sequence type) is the absence of sequence 3 between positions 1020 and 1021 of sequence 4.

[0189] Pre-mRNA or mRNA level:

[0190] Polymorphism 1 is a polymorphism in pre-mRNA or mRNA corresponding to polymorphism 1 at the cDNA level.

[0191] Polymorphism 2 is a polymorphism in pre-mRNA or mRNA corresponding to polymorphism 2 at the cDNA level.

[0192] Polymorphism 3 is a polymorphism in pre-mRNA or mRNA corresponding to polymorphism 3 at the cDNA level.

[0193] Polymorphism 4 is a polymorphism in pre-mRNA or mRNA corresponding to polymorphism 4 at the cDNA level.

[0194] Indels are indels in pre-mRNA or mRNA that correspond to indels at the cDNA level.

[0195] In organisms, the above polymorphisms will produce different sequence types.

[0196] cDNA level:

[0197] There are three types of polymorphism 1 sequence types, namely, polymorphism 1 sequence type A, polymorphism 1 sequence type G, and polymorphism 1 sequence type AG:

[0198] The sequence type of polymorphism 1 is A, which is homozygous for A at position 876 of sequence 5. The sequence type of polymorphism 1 is G, which is homozygous for G at position 876 of sequence 5. The sequence type of polymorphism 1 is AG (or GA), which is heterozygous for A at position 876 of sequence 5 and G at position 876 of sequence 5.

[0199] There are three types of polymorphism 2 sequence types, namely, polymorphism 2 sequence type A, polymorphism 2 sequence type T, and polymorphism 2 sequence type AT:

[0200] The sequence type of polymorphism 2 is A, which is homozygous for A at position 973 of sequence 5. The sequence type of polymorphism 2 is T, which is homozygous for T at position 973 of sequence 5. The sequence type of polymorphism 2 is AT (or TA), which is heterozygous for A at position 973 of sequence 5 and T at position 973 of sequence 5.

[0201] There are three types of polymorphism 3 sequence types, namely, polymorphism 3 sequence type A, polymorphism 3 sequence type G, and polymorphism 3 sequence type AG:

[0202] The sequence type of polymorphism 3 is A, which is homozygous for A at position 3 of sequence 6. The sequence type of polymorphism 3 is G, which is homozygous for G at position 3 of sequence 6. The sequence type of polymorphism 3 is AG, which is heterozygous for A at position 3 of sequence 6 and G at position 3 of sequence 5.

[0203] There are three types of polymorphism 4 sequence types, namely, polymorphism 4 sequence type A, polymorphism 4 sequence type T, and polymorphism 4 sequence type AT:

[0204] The sequence type of polymorphism 4 is A, which is homozygous for A at position 70 of sequence 6. The sequence type of polymorphism 4 is T, which is homozygous for T at position 70 of sequence 6. The sequence type of polymorphism 4 is AT, which is heterozygous for A at position 70 of sequence 6 and T at position 70 of sequence 5.

[0205] There are three types of insertion-deletion sequence types, namely insertion type (also known as insertion sequence type), deletion type (also known as deletion sequence type) and heterozygous type (also known as heterozygous sequence type):

[0206] The insertion type is homozygous with sequence 3 between positions 1020 and 1021 of sequence 4, the deletion type is homozygous with no sequence 3 between positions 1020 and 1021 of sequence 4, and the heterozygous type is heterozygous with sequence 3 between positions 1020 and 1021 of sequence 4 and no sequence 3 between positions 1020 and 1021 of sequence 4.

[0207] Pre-mRNA or mRNA level:

[0208] The polymorphism 1 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the polymorphism 1 sequence type at the cDNA level.

[0209] The polymorphism 2 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the polymorphism 2 sequence type at the cDNA level.

[0210] The polymorphism 3 sequence type is a sequence type of polymorphism in pre-mRNA or mRNA corresponding to the polymorphism 3 sequence type at the cDNA level.

[0211] The polymorphism 4 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the polymorphism 4 sequence type at the cDNA level.

[0212] The sequence type of polymorphism 4 is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the sequence type of polymorphism 4 at the cDNA level.

[0213] The indel sequence pattern is an indel sequence pattern in pre-mRNA or mRNA corresponding to the indel sequence pattern at the cDNA level.

[0214] In response to the above-mentioned sequence differences, the present invention has developed four detection substances, namely, insertion-deletion polymorphism detection substances (which can detect the above-mentioned deletion mutations and / or insertion-deletion and / or insertion-deletion sequence types), polymorphism 1 detection substances (which can detect the above-mentioned single base mutation 1 and / or polymorphism 1 and / or polymorphism 1 sequence types), polymorphism 2 detection substances (which can detect the above-mentioned single base mutation 2 and / or polymorphism 2 and / or polymorphism 2 sequence types), polymorphism 3 detection substances (which can detect the above-mentioned single base mutation 3 and / or polymorphism 3 and / or polymorphism 3 sequence types) and polymorphism 4 detection substances (which can detect the above-mentioned single base mutation 4 and / or polymorphism 4 and / or polymorphism 4 sequence types).

[0215] The single base mutation 1 detection substance is a substance that detects the 876th nucleotide of sequence 5. The nucleotide is G or A.

[0216] The single base mutation 2 detection substance is a substance that detects nucleotide 973 of sequence 5. The nucleotide is T or A.

[0217] The single base mutation 3 detection substance is a substance that detects the 3rd nucleotide of sequence 6. The nucleotide is G or A.

[0218] The single base mutation 4 detection substance is a substance that detects the 70th nucleotide of sequence 6. The nucleotide is T or A.

[0219] To further analyze the regulatory effect of qFN12 on fruit number, we obtained a near-isogenic line (NIL) from a high-generation inbred line:

[0220] From the BC1F2 population described above, obtained through backcrossing and selfing using ST109 as the maternal parent (the F1 generation was obtained by crossing ST035 and ST109, the BC1F1 generation was obtained by backcrossing using ST109 as the maternal parent, and the BC1F1 generation was obtained by selfing the BC1F1 generation), a group of lines were identified that showed a significant correlation between the FN12 genotype and phenotype, as well as significant phenotypic differences. We selfed these lines for three consecutive generations, and in each generation, identified genotypes within the 196 kb region of the FN12 region that remained heterozygous. After three consecutive selfing generations, two plants with different genotypes in this region were segregated, representing near-isogenic lines, and their phenotypes were investigated.

[0221] In this group of near-isogenic lines, the genotypes of other chromosomes remain consistent, and the genotypes differ only in the 196 kb region containing the qFN12 locus, which can be used to analyze the role of qFN12 and is named NIL-fn12. ST035 and NIL-FN12 ST109 .

[0222] Through genome sequencing and transcriptome detection, it was found that NIL-fn12 ST035 and NIL-FN12 ST109 , the Solyc12g008900 gene has no difference, the only difference is NIL-fn12 ST035 There is a -269 bp deletion in the CDS region of the Solyc12g008900 gene (i.e., sequence 2), which leads to a frameshift mutation of the gene in the ST035 material, resulting in premature termination, but NIL-FN12 ST109 The CDS region (i.e., sequence 1) of the Solyc12g008900 gene in NIL-FN12 is normal. ST109 It is ST109 sequence type, NIL-fn12 ST035 It is the ST035 sequence type.

[0223] In the present application, the ST109 sequence type cDNA has at least one of the following characteristics:

[0224] 1) Insertion sequence type;

[0225] 2) The sequence type of polymorphism 1 is A;

[0226] 3) The sequence type of polymorphism 2 is A;

[0227] 4) The sequence type of polymorphism 3 is G;

[0228] 4) The sequence type of polymorphism 4 is A.

[0229] The cDNA of the ST035 sequence type has at least one of the following characteristics:

[0230] 1) Deletion sequence type;

[0231] 2) The sequence type of polymorphism 1 is G;

[0232] 3) The sequence type of polymorphism 2 is T;

[0233] 4) The sequence type of polymorphism 3 is A;

[0234] 4) The sequence type of polymorphism 4 is T.

[0235] In the present application, the ST109 sequence type pre-mRNA or mRNA has at least one of the following characteristics:

[0236] 1) The insertion / deletion sequence pattern is the insertion / deletion sequence pattern in the pre-mRNA or mRNA corresponding to the insertion sequence pattern at the cDNA level;

[0237] 2) The polymorphism 1 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the sequence type A of polymorphism 1 at the cDNA level.

[0238] 3) Polymorphism 2 sequence type is a polymorphic sequence type in the pre-mRNA or mRNA corresponding to the sequence type A of polymorphism 2 at the cDNA level.

[0239] 4) The polymorphism 3 sequence type is a polymorphic sequence type in the pre-mRNA or mRNA corresponding to the polymorphism 3 sequence type G at the cDNA level.

[0240] 4) Polymorphism 4 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the sequence type A of polymorphism 4 at the cDNA level.

[0241] The ST035 sequence type pre-mRNA or mRNA has at least one of the following characteristics:

[0242] 1) The insertion / deletion sequence pattern is the insertion / deletion sequence pattern in the pre-mRNA or mRNA that corresponds to the deletion sequence pattern at the cDNA level;

[0243] 2) Polymorphism 1 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the sequence type of polymorphism 1 at the cDNA level being G;

[0244] 3) Polymorphism 2 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the sequence type of polymorphism 2 at the cDNA level being T;

[0245] 4) Polymorphism 3 sequence type is a polymorphic sequence type in pre-mRNA or mRNA corresponding to the sequence type A of polymorphism 3 at the cDNA level;

[0246] 4) The polymorphism 4 sequence type is a polymorphic sequence type in the pre-mRNA or mRNA corresponding to the sequence type of polymorphism 4 being T at the cDNA level.

[0247] Example 2: Functional verification of linked markers

[0248] NIL-fn12 will be delivered in Spring 2023, Fall 2023, Spring 2024, and Fall 2024, respectively. ST035 Tomato seeds and NIL-FN12 ST109Eight tomato seeds of each series were planted in the sowing shed of the Nankou Seedling Base in Beijing. After about 30-40 days, they were transplanted into the greenhouse of the Nankou Seedling Base. The average temperature in the greenhouse was 14 hours of light and 10 hours of darkness during the day, with an average daytime temperature of 28 degrees Celsius and a nighttime temperature of about 22 degrees Celsius. When the fifth ear inflorescence was completed, the number of flowers produced on the inflorescences of the first 2-4 ears was investigated (the number of flowers was continuously monitored and totaled when the fifth ear inflorescence was completed), and the average number of flowers and the number of normally developed fruits were calculated. The phenotypes were also recorded, and the fruit weight was further investigated. The investigation method was to pick 10 mature fruits from a single plant as a group and weigh them. The weight was divided by 10 to obtain the average single fruit weight of the group. Each plant was weighed at least five times. Finally, the data of the 8 plants were aggregated and the average value was calculated. The fruit weight and yield were calculated. The sequence type of the variety was also detected. The specific method is as follows:

[0249] The sequence type is detected once in the seedling stage before transplanting to screen plants with suitable genotypes, and then the plants are transplanted into the greenhouse and the identification is repeated to ensure accuracy. The identification method is to extract DNA from the young leaves of the plants, and then use molecular markers for screening. DNA extraction can refer to the normal CTAB method for DNA extraction. Molecular marker PCR uses Novizan's 2XTaq Mix, and the program follows the instructions of the Mix, with an annealing temperature of 56°C, an extension time of 10s, and 4% agarose gel separation of bands. The results showed that the sequence type of all plants was consistent with the marker type (NIL-fn12 ST035 The tomato is of ST035 sequence type, NIL-FN12 ST109 The tomato was of ST109 sequence type).

[0250] Average number of flowers = total number of flowers on each inflorescence / number of inflorescences surveyed.

[0251] Average number of fruits = total number of fruits on each inflorescence / number of inflorescences surveyed.

[0252] Fruit weight = single fruit weight.

[0253] Yield = total weight of fruit per plant.

[0254] The sign that the development of the fifth ear inflorescence is complete is that no new flowers are produced in the fifth ear.

[0255] The results of the investigation on the number of flowers and fruits per inflorescence of the NILs showed that NIL-FN12 ST109 The number of flowers and fruits was significantly lower than that of NIL-fn12 ST035The results showed that qFN12 is the main effect site for regulating fruit number, and when qFN12 is ST035 genotype, the fruit number of the plant will increase significantly, but when qFN12 is ST109 genotype, the fruit number of the plant will decrease significantly. Figure 2 Medium ad( Figure 2 NIL-fn12 ST035 and NIL-FN12 ST109 Represents NIL-fn12 ST035 and NIL-FN12 ST109 Tomato, a is a schematic diagram of NIL construction; phenotype photos are shown in Figure 2 As shown in middle b, the upper half of the phenotypic photo is NIL-FN12 ST109 , the lower part is NIL-fn12 ST035 The left part is a picture of the number of flowers in each inflorescence, and the right part is a picture of the number of fruits in each inflorescence after the fifth spike inflorescence has completed its development; the average number of flowers is as follows Figure 2 As shown in c, the average number of fruits is Figure 2 (shown in d).

[0256] The fruit weight results for the spring of 2024 are as follows: Figure 3 ( Figure 3 In the figure, the left side is the phenotype diagram, and the right side is the bar graph of the average fruit weight. ST035 and NIL-FN12 ST109 Represents NIL-fn12 ST035 and NIL-FN12 ST109 As shown in tomato, the study found that qFN12 not only has a significant regulatory effect on fruit number, but also has a significant promoting effect on single fruit weight.

[0257] What will the production results be like in spring 2024? Figure 4 ( Figure 4 NIL-fn12 ST035 and NIL-FN12 ST109 Represents NIL-fn12 ST035 and NIL-FN12 ST109 Tomato, the left side is the phenotype diagram, the right side is the bar graph of the total weight of fruits per plant). The results show that NIL-FN12 ST109 The yield was significantly lower than that of NIL-fn12 ST035, the results show that qFN12 can simultaneously promote the increase in fruit number and single fruit weight. On this basis, the results of the investigation of single plant yield showed that qFN12 for ST035 genotype has a significant yield-increasing effect. The present invention only shows the yield results in the spring of 2024. The results of other planting periods (spring 2023, autumn 2023, and autumn 2024) have the same trend, all with NIL-FN12 ST109 The yield was significantly lower than that of NIL-fn12 ST035 results.

[0258] Example 3: Design and application of genomic linkage markers

[0259] Although we detected a significant deletion in the Solyc12g008900 gene using cDNA from ST035 and ST109, we did not detect a similar deletion in the fourth exon of the Solyc12g008900 gene at the DNA level. However, we found that the mutant and normal genotypes of Solyc12g008900 in ST035 and ST109 were linked to a gene segment within the major qFN12 region. To facilitate direct DNA genotyping of Solyc12g008900, we designed and synthesized a pair of primers for linkage markers within the major qFN12 region linked to the Solyc12g008900 CDS deletion. These primers are designated as linkage marker primer pair L (primers L-1 and L-2) and linkage marker primer pair R (primers R-1 and R-2). Primer information is shown in Table 1. By using these two pairs of linked marker primers, the genotype of the Solyc12g008900 gene in the segment can be determined through the L segment and the R segment.

[0260] Table 1 Primer information

[0261] Primer name Primer sequence (5'-3') L-1 CTTAGCATCTGTTCTTCGTAAGTCT (sequence 14) L-2 ACAACAACATTGCCACGTGTGTAAT (SEQ ID NO: 15) R-1 ATCACAAGCTTATCTTGGAATGTCC (SEQ ID NO: 16) R-2 ATTCCTCTGTTCTTTGAGTTGTGGA (SEQ ID NO: 17)

[0262] The sequence of the Solyc12g008900 gene is shown in SEQ ID NO: 7.

[0263] Sequence 7 is as follows:

[0264]

[0265] 1. In Example 1, the BC1F2 population constructed with ST035 and ST109 as parental materials was used to screen for suitable strains for constructing NIL populations. The basic requirement was that the genotypes at the 0.1M interval site on chromosome 12 were homozygous ST035 and homozygous ST109, respectively, but the genotypes at other sites related to fruit weight and fruit number were required to be homozygous and consistent. The specific method was to screen plants heterozygous for the chromosome 12 site in the BC1F2 population, self-pollinate these plants for three generations, and select plants with a heterozygous genotype at this site in each generation for subsequent operations. Finally, plant DNA was extracted from the BC1F5 generation population for genotyping.

[0266] The genomic DNA of the leaves of the BC1F5 generation population, ST109 and ST035 were extracted to obtain the genomic DNA of the BC1F5 generation population, the genomic DNA of ST109 and the genomic DNA of ST035.

[0267] 2. Using the genomic DNA of the BC1F5 generation population obtained in step 1, and the genomic DNA of ST035 and ST109 as templates, two pairs of primers L-1+L-2 and R-1+R-2 were used for PCR amplification, and the amplified products were separated by bands using 4% agarose gel electrophoresis.

[0268] The ST035 genomic DNA was amplified using primers L-1+L-2. The result is shown in SEQ ID NO:

[0269] CTTAGCATCTGTTCTTCGTAAGTCTCTCTTTGTTTTATTTTCCATATGCCGTCCTAAAAGTATACTTTGAGCAAG TCTTCTCTATTACTGAATACATGGTTCATAGTACTCACTGAGGGTCTATCAAAAACAAGTCAAACAACCTCTCTACCCAC AGTAGGGGAAAGGTTTGCGTACATCTTAACGTCCCCAGTCCTCACTTTTGTGGGATTACACACGTGGCAATGTTGTTGT.

[0270] ST109 genomic DNA was amplified using primers L-1+L-2. The results are shown in Sequence 9:

[0271] CTTAGCATCTGTTCTTCGTAAGTCTCTCTTTGTTTTATTTTCCATATGCCGTCCTAAAAGTATACTTTGAGCAAG TCTTCTCTATTACTGAATACATGGTTCATAGTACTCACcAGGGGAAAGGTTTGCGTACATCTTAACGTCCCCAGTCCTCA CTTTTGTGGGATTACACACGTGGCAATGTTGTTGT.

[0272] The ST035 genomic DNA was amplified using primers R-1+R-2. The result is shown in SEQ ID NO:

[0273] ATCACAAGCTTATCTTGGAATGTCCCACCTAATCCCGCGTACCAAACGGCCCCTTTAGATGGCAAAATAATATCAC CCCGTCACGTTCAGAAGCAAAATTTATGTTTCACTCCACAACTCAAAGAACAGAGGAAT.

[0274] The ST109 genomic DNA was amplified using primers R-1+R-2. The result is shown in Sequence 11:

[0275] ATCACAAGCTTATCTTGGAATGTCCCACCTAATCCCGCGTACCAAATTATGTTTCACTCCACAACTCAAAGAACAGAGGA AT.

[0276] According to the electrophoresis results of step 2, two pairs of primers were selected from the BC1F5 population, and both ST035 and ST109 plants were detected. A pair of near-isogenic lines were constructed for phenotypic identification. Some results are shown in Figure 2. Figure 5 and Figure 6 The CDS of the Solyc12g008900 gene of each strain in the electrophoresis gel was sequenced, and the results showed that the FN12 sequence type was consistent with the genomic linkage marker, which can be used to identify the sequence type of fn12 in the tested plants.

[0277] Sequence 18 is as follows:

[0278] ATGGCTAAGTTTTTTTTATCCTATGGTTATAATATTATTATTTTCTTTATTATTACTCATTTAATGTCCATTTTAGGAAAGTTAAAACCATGGAATCCTTCAATTCCTTATGAAATTCTTTCACTTAATATTTCATCAAAACTTAGTACAAATTCTCATGCTATTAAAGAATCTTCCAAAGATTTTGGAAAAATTATTCAAGAATATTACCAGCTGCTGTTCTTTATCCTTCTTGTGTTAATGACATAATTGACCTCATACAATTTTCTTATGACCTTTCTGTCCCTTTTCATGTAGCAGCCAAAGGTCATGGACATTCCATTAGGGGACAAGCCATGGCAAAAAATGGGGTAATTGTGGAAATGAGTTCTTTAAATAATAATAATAATGAGAATTGTGGTGTTAGGGTTTCTTGGGATTCGGATTTAGGGTTTTACGCGGATGTTGGAGGTGAACAATTATGGATTGATGTTCTTCATAACACCCTAGAGTATGGCTTAGCACCTGTTTCATGGACAGATTATTTGTACCTTACCGTTGGTGGTACACTCTCTAATGCTGGAATTAGTGGTCAAACTTTTCGATATGGTCCTCAAATAAGTAACGTTCATGAGATGGATGTTATTACAGGTAAAGGGGAATTAATGACTTGCTCCAAAGATATGAATTCAGAATTGTTTTTTGGAGTTTTAGGAGGTTTGGGACAGTTTGGAATAATAACAAGAGCAAGAATTGTCTTGGATAAAGCACCAACAAGAGTGAAATGGGTGAGAATGTTATATGATGATTTCTCAAAATTCACAAAAGATCAAGAACATCTTATTTCAATTCATAATAATGGATTGGATTATGTTGAAGGCTCTCTAATGATGGAACAAAGCTCTCTAAATAATTGGAGATCTTCATTTTATTCACCTTCCAATCAAACCAAAATTGCTTCATTATTATCCAAAAATAAAATCATGTATTGCATGGAAATAGTGAAGTACTATGATGACCAAAATGCTAATACTATTGAT。

[0279] The specific sequence 19 is as follows:

[0280] AAGGTGGGATGATAGGATGTCAGCAATAATACCAGAAGAAGAAACATTTTATTGTGTGGGACTTTTACAATCTTCAAGTGGATATAATGAATGCAAAATTTTGGATAATCAAAATGAAGAAATATTAAATTATTGTGATAAAGTTGGCCTCAATATAAAGCAATATCTTCCACATTACAAGACAAAAGAGGATTGGATCAAACATTTTGGTAAAAAATGGAATATTTTTCAACAAAGAAAAGATCTATTTGATCCAAAGATGATTCTATCACCAGGACAAAGAATTTTTAATTAG。

[0281] Sequence 20 is as follows:

[0282]

[0283] Sequence 21 is as follows:

[0284] AAGATGGGATGATAGGATGTCAGCAATAATACCAGAAGAAGAAACATTTTTGTTGGGACTTTTACATTCTTCAAGTGGATATAATGAATGCAAAATTTTGGATAATCAAAATGAAGAAATATTAAATTATTGTGATAAAGTTGGCCTCAATATAAAGCAATATCTTCCACATTACAAGACAAAAGAGGATTGGATCAAACATTTTGGTAAAAAATGGAATATTTTTTCAACAAA.

Claims

1. Use of products for detecting insertions, deletions or polymorphisms in hnRNA, mRNA and / or cDNA in detecting and identifying or assisting in identifying economic traits or plant morphology of plants; The insertion and deletion is any of the following: B1) the insertion or deletion is whether sequence 3 exists between positions 1020 and 1021 of sequence 4; B2) is reverse complementary to the sequence described in B1) and is an insertion or deletion of ribonucleotides; The polymorphism includes at least one of polymorphism 1, polymorphism 2, polymorphism 3 and polymorphism 4; The polymorphism 1 is any of the following: C1) the polymorphism 1 is that the 876th position of sequence 5 is A or G; C2) a polymorphism that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence; The polymorphism 2 is any of the following: D1) the polymorphism 2 is that the 973rd position of sequence 5 is A or T; D2) a polymorphism that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence; The polymorphism 3 is any of the following: D1) the polymorphism 3 is that the third position of sequence 6 is A or G; D2) a polymorphism that is reverse complementary to the sequence described in B1) and is a ribonucleotide sequence; The polymorphism 4 is any of the following: E1) the polymorphism 4 is that the 70th position of sequence 6 is A or T; E2) is reverse complementary to the sequence described in B1) and is a ribonucleotide polymorphism.

2. Products used for identifying or assisting in identifying the economic traits or plant morphology of Solanum, where: The product comprises the product of claim 1.

3. The use according to claim 1 or the product according to claim 2, wherein: The economic trait is a yield trait and / or the plant morphology is a plant reproductive organ morphology.

4. The use or product according to claim 3, wherein: The yield trait is fruit weight and / or the plant reproductive organ morphology is the number of flowers and / or the number of fruits.

5. A method for identifying the yield of Solanum, wherein: The method comprises detecting the insertion, deletion or polymorphism in the hnRNA, mRNA and / or cDNA of claim 1 in the tested Solanum plant, and identifying or assisting in identifying the yield of the Solanum plant according to the insertion, deletion or polymorphism of the tested Solanum plant, and the result is any combination of the following: 1) The yield of Solanum plants in which the hnRNA, mRNA and / or cDNA is a deletion type or a deletion type whose sequence is reverse complementary to the sequence thereof and whose sequence is ribonucleotide is higher than the yield of Solanum plants in which the hnRNA, mRNA and / or cDNA is an insertion type or a insertion type whose sequence is reverse complementary to the sequence thereof and whose sequence is ribonucleotide; 2) the yield of the Solanum plant in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or the polymorphism in which the sequence is reversely complementary to the sequence and the sequence is a ribonucleotide is higher than the yield of the Solanum plant in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or the polymorphism in which the sequence is reversely complementary to the sequence and the sequence is a ribonucleotide; 3) the yield of the Solanum plant in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or the polymorphism is reversely complementary to the sequence and the sequence is a ribonucleotide is higher than the yield of the Solanum plant in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or the polymorphism is reversely complementary to the sequence and the sequence is a ribonucleotide; 4) the yield of the Solanum plant in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or the polymorphism reversely complementary to the sequence and the sequence is a ribonucleotide is higher than the yield of the Solanum plant in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or the polymorphism reversely complementary to the sequence and the sequence is a ribonucleotide; 5) The yield of Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence and the sequence is a ribonucleotide is higher than the yield of Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence and the sequence is a ribonucleotide.

6. A method for breeding high-yield Solanum plants, wherein: The method comprises detecting the insertion / deletion or polymorphism in the hnRNA, mRNA and / or cDNA of claim 1 in the tested Solanum plant, and breeding or assisting breeding of high-yield Solanum plants according to the insertion / deletion or polymorphism of the tested Solanum plant, and the result is any combination of the following: 1) among the Solanum plants in which the hnRNA, mRNA and / or cDNA are of insertion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide and the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide, the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide are selected as high-yield varieties; 2) among the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide and the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide, the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide are selected as high-yield varieties; 3) among the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide and the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide, the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide are selected as high-yield varieties; 4) among the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide and the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide, the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide are selected as high-yield varieties; 5) among the Solanum plants in which the polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as high-yield varieties; In 1)-4), the yield of the high-yield variety is higher than that of other Solanum plants.

7. A method for breeding Solanum plants with a large number of flowers, wherein: The method comprises detecting the insertion / deletion or polymorphism in the hnRNA, mRNA and / or cDNA of claim 1 in the tested Solanum plant, and breeding or assisting in breeding Solanum plants with a large number of flowers according to the insertion / deletion or polymorphism in the tested Solanum plant, and the result is any combination of the following: 1) among the Solanum plants in which the hnRNA, mRNA and / or cDNA are of insertion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide, and the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide, the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide are selected as varieties with a large number of flowers; 2) among the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as species with multiple flower numbers; 3) among the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as varieties with a large number of flowers; 4) among the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as varieties with a large number of flowers; 5) among the Solanum plants in which the polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or is reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or is reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or is reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as varieties with a large number of flowers; In 1)-4), the number of flowers of the variety with multiple flowers is greater than the number of flowers of other Solanum plants.

8. A method for breeding a plant of the genus Solanum with a large number of fruits, wherein: The method comprises detecting the insertion / deletion or polymorphism in the hnRNA, mRNA and / or cDNA of claim 1 in the tested Solanum plant, and breeding or assisting in breeding Solanum plants with a large number of fruits according to the insertion / deletion or polymorphism in the tested Solanum plant, and the result is any combination of the following: 1) among the Solanum plants in which the hnRNA, mRNA and / or cDNA are of insertion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide, and the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide, the Solanum plants in which the hnRNA, mRNA and / or cDNA are of deletion type or reverse complementary to the sequence thereof and the sequence is ribonucleotide are selected as varieties with a large number of fruits; 2) among the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 1 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as species with multiple flower numbers; 3) among the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 2 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as varieties with a large number of fruits; 4) among the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is G or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which the polymorphism 3 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as varieties with a large number of fruits; 5) among the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is A or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism and the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism, the Solanum plants in which polymorphism 4 in the hnRNA, mRNA and / or cDNA is T or a polymorphism reversely complementary to the sequence thereof and the sequence is a ribonucleotide polymorphism are selected as varieties with a large number of fruits; In 1)-4), the number of fruits of the high-fruit variety is greater than the number of fruits of other Solanum plants.

9. The use according to claim 1, the product according to claim 2, the use or product according to claim 3 or 4, or the method according to claims 5 to 8, wherein: The Solanum plant is tomato.

10. The use according to claim 1, the product according to claim 2, the use or product according to claim 3 or 4, or the method according to claims 5 to 8, wherein: The Solanum plant is pure line.

Images