Wheat quality gene TaRNP1 and application of molecular marker thereof
By developing KASP molecular markers of the wheat quality-related gene TaRNP1, the problem of lack of wheat quality-related gene markers in the prior art is solved, efficient selection and improvement of wheat quality traits is achieved, and grain weight and yield in wheat breeding are improved.
Patent Information
- Application Number
- CN202510186936.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-02-20
- Publication Date
- 2025-05-30
AI Technical Summary
The prior art lacks molecular marking of the wheat quality-related gene TaRNP1 and its application, which limits the efficient selection and improvement of quality traits during wheat breeding.
Molecular markers of the wheat quality trait-related gene TaRNP1 were developed, and the SNP sites were detected through KASP marking technology. They were divided into two haplotypes TT and GG, which were used to assist in breeding and select excellent genotypes.
Through the application of TaRNP1-KASP molecular marker, it can effectively distinguish the genotypes of different wheat varieties. It was found that the wheat materials with TT genotypes had high starch content, drop value and weakening, providing technical support for improving high-quality wheat breeding.
Smart Images

Figure CN120060532A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of plant bioengineering, and specifically relates to a molecular marker TaRNP1 related to wheat quality and its application. Background Art
[0002] Wheat is one of the most important food crops in the world and an indispensable source of energy and nutrition for humans. With the improvement of living standards, people's demand for healthy diets is increasing, and nutritional quality has become a hot topic in wheat research.
[0003] Compared with traditional breeding methods, marker-assisted selection (MAS) has the characteristics of easy operation, relatively high stability, and high reliability. It can analyze the genetic composition of individuals at the molecular level to select more excellent genotypes, thus accelerating the breeding process of crops. In the process of wheat breeding, the currently mainly applied molecular marker technologies are SSR and SNP molecular markers. Among them, SSR is easy to operate, but has limitations such as low genomic density, low coverage rate, and high cost. Compared with SSR markers, SNPs have more stable heritability, more abundant and widely distributed loci, and are more efficient for quantitative trait mapping. With the completion of whole-genome sequencing, it has promoted the development of molecular functional markers. A large number of molecular markers can be developed to distinguish different genotypes according to the differences in bases of the same gene in different materials. Currently, the main SNP genotyping methods are KASP and CAPS / dCAPS markers.
[0004] KASP markers are applied to the detection of SNP loci in genomic DNA samples. By accurately judging the alleles of SNP polymorphic loci and insertions and deletions (InDels), genotypes can be distinguished in a large number of samples. In recent years, KASP markers have been widely used in wheat breeding and have been effectively applied in practice. For example, Zhang Weijun et al. used KASP markers to genotype 4 grain weight-related genes, TaGASR, TaGW2-6B, TaGS-D1, and TaCWI-4, in 209 wheat germplasms and found that all 4 grain weight genes had two haplotypes. Further association analysis found that the 4 grain weight genes were significantly associated with grain traits, and 14 high thousand-grain weight materials were screened out from 209 materials, among which 9 materials aggregated excellent haplotypes of multiple grain weight-related genes. Therefore, grain weight, as an important index of yield traits, the development of molecular markers related to grain weight has important scientific research value and broad application prospects for improving grain weight and yield in future wheat breeding in China. There is no report on the molecular marker of wheat quality-related gene TaRNP1 and its application in the prior art. Summary of the Invention
[0005] In view of the deficiencies of the prior art, the present invention provides a molecular marker TaRNP1 related to wheat quality traits and its application.
[0006] To achieve the above object, the present invention adopts the following technical solutions:
[0007] 1. Application of the molecular marker TaRNP1 related to wheat quality traits in assistant breeding. The molecular marker includes the TT type shown in SEQ ID No.1 in the sequence listing, with T at the 61st position; the GG type shown in SEQ ID No.2, with G at the 61st position. The following steps are used to achieve assistant breeding with this molecular marker:
[0008] (1) Extract DNA from the offspring of the wheat natural population, amplify using primers, and genotype the products.
[0009] (2) Determine the genotype by detecting the fluorescence signal of the amplification product. If the product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule shown in SEQ ID NO.1, the genotype of the SNP marker of the wheat to be tested is TT; if the product only shows the color of the fluorescent label connected to the 5' end of the DNA molecule shown in SEQ ID NO.2, the genotype of the SNP marker of the wheat to be tested is GG.
[0010] (3) Wheat with the genotype identified as TT is a strain with high starch content, falling number, and softening degree.
[0011] 2. Application of the molecular marker TaRNP1 related to wheat quality traits in assistant breeding. The primer sequences are as follows:
[0012] KASP-TaRNP1-F1: 5'-GAAGGTCGGAGTCAACGGATTAGCTGATAGTAACTCTATGG GCTATCTA-3'; KASP-TaRNP1-R: 5'-GAACTGTCCGGCTATAAGTTTTCTAC-3';
[0013] KASP-TaRNP1-F2: 5'-GAAGGTGACCAAGTTCATGCTCCACTCACTAAGAGGTCAGT GAAATC-3'; KASP-TaRNP1-R: 5'-GAACTGTCCGGCTATAAGTTTTCTAC-3'.
[0014] 3. The molecular marker TaRNP1 related to wheat quality traits. The TaRNP1 molecular marker is an SNP variation site at -1898bp from the start codon in the coding region of the gene TraesCS1A02G150600, and can be divided into two different haplotypes: TT and GG.
[0015] 4. Method for obtaining molecular marker TaRNP1 related to wheat quality traits, comprising the following steps: (1) extracting wheat DNA, (2) detecting SNP sites, (3) data analysis.
[0016] 5. Wheat quality-related gene TaRNP1, which is proven to have the highest expression level at 15 days after anthesis through enrichment analysis and quantitative verification of transcriptome data of grains at 15 days after anthesis from two extreme materials, and there are differences in the expression levels between the two materials.
[0017] Beneficial effects: In this invention, genotyping and phenotype association analysis were carried out on 158 wheat germplasm resource materials from different provinces in China and 2 wheat germplasm resource materials from the United States. The results showed that the TaRNP1-KASP molecular marker can divide different wheat varieties into 2 haplotypes: haplotype TaRNP1-Hap1 and haplotype TaRNP1-Hap2. The genotype of haplotype TaRNP1-Hap1 is TT, and the genotype of haplotype TaRNP1-Hap2 is GG. Combining the phenotype data and conducting association analysis on materials with different genotypes, it was found that the starch content, falling number, and softening degree of wheat materials with the TT genotype were significantly greater than those of wheat materials with the GG genotype. This indicates that the TT genotype is an excellent allelic variation and has a positive effect on wheat starch content, falling number, and softening degree. During the breeding process, the polymerization of favorable mutant alleles is consistent with the result of increased yield in the crop breeding process. Therefore, this invention provides that the TaRNP1-KASP molecular marker can efficiently detect and trace the TaRNP1 gene in wheat varieties / lines, providing technical support for improving high-quality wheat breeding. Description of the Drawings
[0018] Figure 1 Expression level analysis of TaRNP1 at 0, 5, 10, 15, 20, and 25 DAF after anthesis in two extreme materials of the present invention, *P<0.05; **P<0.01; ***P<0.001.
[0019] Figure 2 Transcriptome analysis results of grains at 15 DAF after anthesis from two extreme materials.
[0020] Figure 3 Distribution of SNP sites in the coding region and promoter region of the TaRNP1 gene.
[0021] Figure 4 Genotype identification results of wheat germplasm resources from different wheat-growing regions in China using the TaRNP1 gene KASP marker primer set. Among them, the scattered points in the upper left box represent the HEX-type allele T, and the scattered points in the lower right box represent the FAM-type allele G.
[0022] Figure 5This is the geographical distribution of two TaRNP1 genotypes of wheat germplasm resources in the main wheat-growing regions of China.
[0023] Figure 6 Shows the associations of TaRNP1-Hap1 and TaRNP1-Hap2 with protein content, starch content, ash, falling number, softening degree, and wet gluten in 160 wheat materials under three environmental conditions; E1 - E3 are Tongwei (35°11‘N, 105°19’E, altitude 1750m), Zhuanglang (35°21‘N, 105°58’E, altitude 2110m), and Zhongliang (34°34‘N, 105°53’E, altitude 1550m) in Gansu in 2022. *P < 0.05; **P < 0.01.
[0024] Figure 7 Are the sequences of two TaRNP1 genotypes. Among them, the underlined part is the amplified sequence of the KASP marker primer, and the box is the SNP site at the 61st position starting from the underlined part. Detailed implementation manners
[0025] To make the objectives, technical solutions, and advantages of the invention clearer, the following will detail the specific implementation manners of the present invention with reference to the accompanying drawings. Examples of these preferred implementation manners are illustrated in the accompanying drawings. The implementation manners of the present invention shown in the drawings and described according to the drawings are merely exemplary, and the present invention is not limited to these implementation manners. Here, it should also be noted that to avoid obscuring the technical solutions of the present invention with unnecessary details, only the structures and / or processing steps closely related to the solutions of the present invention are shown in the drawings, while other details of less relevance are omitted.
[0026] Example 1
[0027] This example provides the wheat quality-related gene TaRNP1, specifically as follows:
[0028] 1. qRT-PCR analysis of TaRNP1 gene
[0029] Collect grains of two extreme materials at 0, 5, 10, 15, 20, and 25 days after flowering to obtain samples. Use A plant tissue RNA rapid extraction kit to extract total RNA from the collected samples, and measure the RNA concentration with a ultra-microphotometer. Synthesize the first strand of cDNA using the FastKing gDNA isolation method (Beijing). Use FastReal qPCR PreMix (SYBRGreen) to detect the changes in the relative expression levels of the TaRNP1 gene in different tissues through qRT-PCR analysis. Use wheat TaGADPH as the internal reference gene for wheat tissue development expression analysis (refer to L. Guo et al., 2022).
[0030] Among them, the PCR reaction system was 20 μL, including 10 μL FastReal qPCR PreMix (SYBR Green), 0.6 μL each of forward primer and reverse primer, 2 μL cDNA and 6.8 μL ddH 2 O. The PCR conditions were 95 °C for 2 min; 95 °C for 5 s, 58 °C for 10 s, 72 °C for 15 s (fluorescence collection), 40 cycles.
[0031] The primers used for qRT-PCR are shown in Table 1. The 2 -ΔΔCT method was used to calculate the relative expression level of TaRNP1 gene (refer to Schmittgen & Livak, 2008). All quantifications were performed in 3 biological replicates.
[0032] Table 1 Primer information
[0033]
[0034]
[0035] The expression level of TaRNP1 in grains at 0, 5, 10, 15, 20, and 25 days after flowering was determined by qRT-PCR, and the results are as Figure 1 shown. The qRT-PCR results showed that the expression level of TaRNP1 in grains at different stages after flowering first increased and then decreased, and there were significant differences in two extreme materials at 15 DAF, suggesting its potential role in grain development.
[0036] 2. Transcriptome analysis of two extreme materials
[0037] 2.1 Sampling of transcriptome materials
[0038] For 30 plants of wheat materials with extremely plump grains and defective grains, the dominant grains in the middle part of the ear were sampled at 0, 10, 15, 20, and 25 days after flowering. The 15 plants of grain plump materials and 15 plants of grain defective materials at each stage were mixed evenly, with 3 biological replicates for each sample. And the 30 samples were quickly frozen with liquid nitrogen and stored in a -80 °C refrigerator for total RNA extraction.
[0039] 2.2 RNA-seq sequencing
[0040] Total RNA was extracted using TRIzol reagent according to the instructions. The purity and quantification of RNA were determined using a NanoDrop 2000 spectrophotometer (Thermo Scientific, USA), and the integrity of RNA was evaluated using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). A transcriptome library was constructed using the VAHTS Universal V6 RNA-seq Library Prep kit according to the instructions. The library was sequenced using an Illumina Novaseq 6000 sequencing platform, and 150-bp paired-end reads were generated. The fastp software was used to process the raw reads in fastq format, and clean reads were obtained after removing low-quality reads for subsequent data analysis. The HISAT2 software was used for reference genome alignment, and gene expression levels (FPKM) were calculated. The reads count (counts) of each gene was obtained through HTSeq-count. PCA analysis and plotting of genes (counts) were performed using R (v 3.2.0) to evaluate the biological replicates of samples. Transcriptome sequencing and analysis were carried out by Shanghai OE Biotech Co., Ltd. (Shanghai, China).
[0041] Example 2
[0042] This example provides a molecular marker for the wheat quality-related gene TaRNP1, which is as follows:
[0043] The wheat quality-related gene TaRNP1 encodes an RNA-binding protein, and its N-terminus contains two RRM domains. The RRM domain is involved in the translation of mRNA into protein. According to the re-sequencing data of 677 hexaploid wheat varieties in the Wheat Genome Variation Consortium database (http: / / wheat.cau.edu.cn / WheatUnion / ), multiple SNP variation sites were found in the promoter region, coding region, and intron of the TaRNP1 gene, which can be divided into two different haplotypes ( Figure 3 ).
[0044] The KASP molecular marker for the wheat quality-related gene TaRNP1 in this example is located at -1898 bp from the start codon in the promoter region. The KASP marker primer set includes:
[0045] KASP-TaRNP1-F1: GAAGGTCGGAGTCAACGGATTCCACTCACTAAGAGGTCAGTGA AATA; KASP-TaRNP1-R: GAACTGTCCGGCTATAAGTTTTCTAC;
[0046] KASP-TaRNP1-F2: GAAGGTGACCAAGTTCATGCTCCACTCACTAAGAGGTCAGTG AAATC; KASP-TaRNP1-R: GAACTGTCCGGCTATAAGTTTTCTAC.
[0047] As shown in Sequence Listing SEQ No.1 and SEQ No.2, the TaRNP1 promoter region was used to develop the SNP locus for KASP marker development and the sequence information nearby (±100bp). The sequences amplified by the KASP marker primers are underlined. As shown in Sequence Listing SEQ No.1 and Figure 7 shown is the amplification sequence of the molecular marker TT type, with the 61st being T; as shown in Sequence Listing SEQ No.2 and Figure 7 shown is the amplification sequence of the molecular marker GG type, with the 61st being G.
[0048] Example 3
[0049] This example provides a method for obtaining the molecular marker of wheat quality-related gene TaRNP1, which is as follows:
[0050] 1. Extract wheat DNA
[0051] Use the CTAB method to extract the DNA of wheat seedling leaves at the two-leaf and one-heart stage. Randomly select several DNA working solutions and measure the concentration using NanoDrop2000. A ratio of A260 / A280 around 1.8 indicates that the sample quality is qualified.
[0052] 2. SNP locus detection
[0053] Use a set of PCR reaction systems including two temperature steps: DNA is denatured at a higher temperature and then annealed and extended at a lower same temperature. PCR amplification can be carried out on any suitable PCR gene amplifier. The PCR reaction system is: 2 μL of 2x Taq DNA Polymerase Mix, 1 μL of SNP Primer Mix (4x), and 2 μL of DNA. The PCR amplification system is: (1) 94 °C, 15 min; (2) 94 °C, 20 s; decreasing by 0.6 °C per cycle from 61 to 55 °C; a total of 10 cycles; (3) 94 °C, 20 s; 55 °C, 45 s, 37 cycles. After the PCR amplification cycle ends, use the OMEGA SNP genotyping instrument to read the fluorescence value. In this method, the SNP locus detection uses fluorophores FAM (excitation light 485 nm, emission light 520 nm) and VIC (excitation light 535 nm, emission light 556 nm) to distinguish two isogenic loci. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) is used to correct the signal difference caused by the reaction volume error between wells.
[0054] 3. Data analysis
[0055] Use the genotype reading software Kluster Caller to analyze the data. In this software, the VIC and FAM data are plotted on the x-axis and y-axis respectively. The VIC and FAM values of each reaction well are corrected by the value of the specific well reference dye (ROX), and the data fluorescence values are normalized to obtain the relative fluorescence values corresponding to VIC and FAM of each PCR reaction well. According to the relative fluorescence values, cluster the samples, and further determine the genotype based on the sample clusters and fluorescence types.
[0056] Example 4
[0057] This example provides the application of the molecular marker TaRNP1 related to wheat quality, specifically as follows:
[0058] 1. Use 160 germplasm resource materials from different ecological regions in China in Table 1. The materials were planted at the Tongwei County Experimental Station (E1), Nanhu Experimental Station (E2) in Zhuanglang County, Gansu Province, and Zhongliang Town Experimental Station (E3) in Tianshui City, Gansu Province from 2021 to 2022. The field experiment adopted a randomized block design with 3 replicates. Each material was planted in 3 rows with a row spacing of 20 cm, a row length of 1 m, and 20 seeds were planted in each row.
[0059] 2. After the wheat grains matured, randomly sample 5 plants in each environment for threshing. After the grains were air-dried, use 1 to measure the protein content, starch content, ash, sedimentation coefficient, wet gluten, and softening degree of the wheat grains. The phenotypic value is the average of 3 replicates. The specific data are shown in Table 1.
[0060] 3. Using the TaRNP1 molecular marker provided in Example 2 and the method provided in Example 3, analyze the TaRNP1 genotypes of wheat germplasm resources in different ecological regions. The genotyping results are as Figure 4 shown.
[0061] Figure 5 Show the main wheat planting areas in China (Henan, Shaanxi, Shanxi, Shandong, Hebei, etc.). Materials with the genotype TT occupy the main position. The specific geographical information of wheat germplasm resources is shown in Table 1. The information sources are "The First Variety Approval Variety Information Query" and Zhuang Qiaosheng's "Analysis of Wheat Variety Improvement and Pedigree in China".
[0062] Using the one-way analysis of variance method of Excel (2016) software, analyze whether there are significant differences in protein content, starch content, ash content, sedimentation coefficient, wet gluten, and softening degree of wheat varieties carrying different genotypes. The results are as Figure 6 shown, and the specific data are shown in Table 2.
[0063] Table 1 Geographical distribution of wheat germplasm resources
[0064] Region Quantity of TaRNP1-Hap1 Quantity of TaRNP2-Hap2 Beijing 13 1 Gansu 56 0 Hebei 15 1 Henan 9 1 USA 2 0 Qinghai 0 1 Shandong 5 7 Shanxi 35 0 Shaanxi 10 2 Xinjiang 2 0
[0065] Table 2 Grain quality phenotypic data of two haplotype wheat germplasm resources in different ecological regions
[0066]
[0067]
[0068] The results show that the dominant varieties of TaRNP1-Hap1 are distributed in Gansu (100%), Shanxi (100%), Hebei (94%), and Beijing (93%), which are the main wheat production areas in China.
[0069] The above are only specific implementation manners of the present application. For those of ordinary skill in the art, without departing from the principle of the present application, several improvements and retouches can be made, which should also be regarded as the protection scope of the present application.
Claims
1. Application of TaRNP1 molecular marker for wheat quality trait related gene in assisted breeding, characterized in that The molecular markers include the TT type as shown in the sequence table SEQ ID No. 1, in which the 61st is T; the GG type as shown in SEQ ID No. 2, in which the 61st is G; the molecular markers are used to implement assisted breeding by the following steps: (1) Extract DNA from the offspring of natural wheat populations, amplify with primers, and perform genotyping on the products; (2) Determine the genotype by detecting the fluorescent signal of the amplified product. If the product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.1, the genotype of the wheat SNP marker to be tested is TT; if the product only shows the color of the fluorescent label connected to the 5′ end of the DNA molecule shown in SEQ ID NO.2, the genotype of the wheat SNP marker to be tested is GG; (3) The wheat genotype identified as TT is a variety with high starch content, falling number, and weakening degree.
2. The use of the wheat quality trait-related gene TaRNP1 molecular marker in assisted breeding according to claim 1, characterized in that The primer sequences are: KASP-TaRNP1-F1: 5'-GAAGGTCGGAGTCAACGGATTAGCTGATAGTAACTCTATGG GCTATCTA-3'; KASP-TaRNP1-R: 5'-GAACTGTCCGGCTATAAGTTTTCTAC-3'; KASP-TaRNP1-F2: 5'-GAAGGTGACCAAGTTCATGTCCACTCACTAAGAGGTCAGT GAAATC-3'; KASP-TaRNP1-R: 5'-GAACTGTCCGGCTATAAGTTTTCTAC-3'.
3. Molecular marker of wheat quality trait-related gene TaRNP1, characterized by The TaRNP1 molecular marker is a SNP variation site at -1898 bp from the start codon in the coding region of the gene TraesCS1A02G150600, which can be divided into two different haplotypes, TT and GG.
4. A method for obtaining a molecular marker of a wheat quality trait-related gene TaRNP1, characterized in that The method comprises the following steps: (1) extracting wheat DNA, (2) detecting SNP sites, and (3) analyzing data.