Rice seedling stage salt-tolerant major QTL (Quantitative Trait Loci) as well as candidate gene, related molecular marker and application thereof

Abstract

The invention discloses a rice seedling stage salt-tolerant major QTL as well as candidate genes, related molecular markers and application thereof.The major QTL is a major QTL qSR12, and the major QTL qSR12 is located on a rice 12 # chromosome, located within the interval of the relative physical distance of 64 kb and comprises 12 predictive genes. Through initial locating and fine locating of the major QTL qSR12 and determination of the candidate gene LOCOs12g17200, the rice seedling stage salt-tolerant major QTL qSR12 and the candidate gene LOCOs12g17200, the rice seedling stage salt-tolerant major QTL qSR12 and the candidate gene LOCOs12g17200 are determined, and the rice seedling stage salt-tolerant major QTL qSR12 is determined. According to the present invention, the molecular marker capable of identifying the difference of the candidate gene LOCOs12g17200 between the parents is developed, such that the theoretical knowledge of the rice seedling stage salt tolerance is enriched, the developed molecular marker has important practical value, the salt tolerance characteristic carried by the salt-tolerant parent ST1050 can be completely excavated, and the characteristics can be efficiently and accurately applied to the rice breeding process.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular plant breeding, and particularly relates to a major QTL for salt tolerance at the seedling stage of rice, its candidate gene, related molecular markers and applications. Background Art

[0002] Salinization is a common abiotic stress in rice production. Soil salinization is a global problem that seriously affects agricultural production and the ecological environment. According to statistics, the global salinized land area exceeds 990 million hectares, among which, the salinized land area in China also exceeds 100 million hectares. In the field of rice cultivation, paddy fields affected by salt account for about one-fifth of the cultivated area. In recent years, the frequent occurrence of high-temperature climate and the continuous depletion of groundwater have further exacerbated the trend of soil salinization. At the same time, the rapid development of industrialization and urbanization has made the protection of cultivated land face a severe situation, and it has become extremely urgent to fully develop and utilize saline land resources such as tidal flats to broaden the cultivated land area.

[0003] As one of the important food crops in the world, rice is a moderately salt-sensitive crop, and the salinization of paddy fields severely restricts the normal growth of rice. Improving the salt tolerance level of rice and promoting salt-tolerant varieties have become an important topic and a hot research direction in rice research worldwide. The salt tolerance of rice is a very complex quantitative trait, which is genetically controlled by additive effects, dominant effects, epistatic interaction effects, and the interaction between the environment and genotypes. With the continuous development of molecular marker-assisted selection (MAS) technology, the physiological and genetic mechanisms of rice salt tolerance have been further deeply analyzed, and the use of MAS technology for genetic improvement of rice salt tolerance has shown strong application potential and has gradually been favored by rice breeders.

[0004] The two-leaf and one-heart stage and the young panicle differentiation stage of rice are the most sensitive periods to salt concentration. Therefore, the analysis of rice salt tolerance QTL and the response mechanism under salt stress mostly focus on these two periods. At present, nearly a thousand rice salt tolerance-related QTLs have been identified, and the number of salt tolerance QTLs at the seedling stage exceeds half. However, the phenotypic contribution rates of most detected rice salt tolerance QTLs are small, which makes it extremely difficult for fine mapping and map-based cloning, resulting in that the research on the vast majority of salt tolerance QTLs is difficult to enter the cloning stage and cannot be applied to rice breeding improvement. In addition, there is no unified standard for the indicators to identify the salt tolerance ability of rice. Whether it is the morphological indicators that are simple to operate but subjective, or the physiological indicators that are accurate in data but cumbersome to operate, there are certain limitations, which also increases the difficulty of map-based cloning of rice salt tolerance QTLs.

[0005] Currently, only a few salt-tolerant QTLs such as SKC1 and Salto1 are utilized in breeding. SKC1 is the first salt-tolerant gene in rice to be map-based cloned. It is located on chromosome 1 of rice and is a major QTL for rice salt tolerance, contributing more than 40% to the phenotypic variation. Its donor parent is derived from the highly salt-tolerant indica rice variety NonaBokra. The SKC1 gene encodes a protein containing 554 amino acids and belongs to a new member of the high-affinity K + transporter family. When rice is under salt stress, a large amount of Na + will accumulate in the above-ground parts (leaves, stems, etc.) of the rice plant. SKC1 can transport the excessive Na + in the above-ground parts back to the roots, thereby reducing the toxicity of Na + and enhancing the salt tolerance of rice. Gregorio et al. (1997) detected a major QTL controlling the Na 8 and K + contents in rice on chromosome 1 using the F + generation recombinant inbred lines of Pokkali / IR29, named Salto1, with a phenotypic contribution rate of 64.3%-80.2%. SUMMARY OF THE INVENTION

[0006] Aiming at the deficiencies of the prior art, the purpose of the present invention is to provide a major QTL for salt tolerance in rice seedlings, its candidate gene, related molecular markers and applications, so as to provide a brand-new and successfully cloned QTL qSR12 related to the survival rate of rice seedlings under salt stress, and the developed molecular markers can better apply the salt-tolerant characteristics of the salt-tolerant parent ST1050 to rice breeding.

[0007] In order to achieve the above purpose, the present invention adopts the following technical solutions:

[0008] The present invention proposes a major QTL for salt tolerance in rice seedlings, which is the major QTL qSR12. The major QTL qSR12 is located on chromosome 12 of rice and is located within an interval of 64 kb in relative physical distance, containing 12 predicted genes.

[0009] The present invention also proposes a candidate gene for the major QTL for salt tolerance in rice seedlings as described above, and the candidate gene is LOC_Os12g17200, and its nucleotide sequence is as shown in SEQ ID No.1.

[0010] The present invention also proposes an application of the major QTL or the candidate gene as described above in the genetic improvement of rice salt-tolerant traits.

[0011] The present invention also proposes a related molecular marker 200-IS of the major effect QTL of salt tolerance in rice seedling stage as described above, the forward primer of the related molecular marker 200-IS is 200-KF, the nucleotide sequence of the forward primer 200-KF is shown in SEQ ID NO.2, and the reverse primer is 200-SR, the nucleotide sequence of the reverse primer 200-KF is shown in SEQ ID NO.3.

[0012] Preferably, the related molecular marker 200-IS is used as a functional marker of the candidate gene LOC_Os12g17200.

[0013] The present invention also proposes an application of the above-mentioned molecular marker 200-IS related to the major QTL of salt tolerance at the rice seedling stage in molecular marker-assisted rice breeding.

[0014] The present invention further proposes the use of the above-mentioned major QTL-related molecular marker 200-IS for salt tolerance at the rice seedling stage in accelerating the breeding of salt-tolerant rice varieties.

[0015] The present invention further proposes an application of the above-mentioned major QTL-related molecular marker 200-IS for salt tolerance at the rice seedling stage in the molecular screening of salt tolerance at the rice seedling stage.

[0016] The present invention further proposes a molecular screening method for salt tolerance in rice seedlings, comprising the following steps:

[0017] (1) Taking rice seedlings and extracting genomic DNA;

[0018] (2) Using the molecular marker primers described in claim 4, the genomic DNA is amplified by PCR, and the PCR amplification product is detected by electrophoresis on 1% agarose gel. If a DNA fragment of a corresponding size is amplified, it indicates the presence of a salt-tolerance gene enhancement allele.

[0019] Preferably, the PCR reaction system is: 2 μl 10× buffer (containing 25 mM MgCl 2 ), 0.4 μl 10 mM dNTP, 0.8 μl upstream and downstream primers (10 pmol / μl), 0.7 μl genomic DNA to be tested, 0.4 μl Taq DNA polymerase (2 U / μl), add water to make up to 20 μl; the PCR reaction program is: 95°C pre-denaturation for 4 min; 32 cycles: 95°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 1 min / 1 kb; and finally 72°C extension for 8 min.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] (1) Through the primary mapping, fine mapping of the major-effect QTL qSR12 and determination of the candidate gene LOC_Os12g17200, the present invention develops molecular markers capable of identifying the differences in the candidate gene LOC_Os12g17200 between parents, which not only enriches the theoretical knowledge of salt tolerance at the rice seedling stage, but also the developed molecular markers have important practical value. They can fully exploit the salt-tolerant characteristics carried by the salt-tolerant parent ST1050 and apply these characteristics efficiently and accurately in the rice breeding process.

[0022] (2) The present invention provides a brand-new and successfully cloned QTL qSR12 related to the survival rate of rice seedlings under salt stress. Through the construction of recombinant inbred lines and backcross populations, combined with binmap-based resequencing and composite interval mapping, qSR12 is initially mapped to a 582-kb interval on chromosome 12, and finally fine-mapped to a 64-kb interval (including 12 genes) through the screening of exchange lines and genome-wide SNP association analysis. Compared with traditional QTL mapping (such as SKC1 which requires a phenotypic contribution rate of more than 40%), this method significantly improves the mapping accuracy through a high-density genetic map (3,783 bins) and the screening of exchange lines, and is applicable to the cloning of minor-effect QTLs (contribution rate < 10%).

[0023] (3) By comparing the parental sequences (ST1050 vs. Koshihikari), the present invention discovers a difference in the 60th base of the ORF of LOC_Os12g17200 (G in ST1050 and C in Koshihikari), which leads to an amino acid substitution (Asp is replaced by Glu), directly correlating with the difference in salt-tolerant phenotypes. By combining the differences in LOC_Os12g17200 encoding an unknown function protein between parents and amino acid substitution analysis, the candidate gene is preferentially locked, avoiding the cumbersome process of verifying one by one in traditional cloning.

[0024] (4) The present invention clones the sequence of the promoter + gene of LOC_Os12g17200 from the genome of the parent ST1050, then ligates the vector to construct a transgenic complementary vector, and transfers the gene complementary vector into japonica rice Zhonghua 11. The survival rate of the transgenic lines (TH11, TH14, TH15, TH17) under salt stress is significantly improved, approaching that of the salt-tolerant parent ST1050, confirming the success of the complementary experiment. LOC_Os12g17200 is the predicted gene of the major-effect QTL qSR12 for salt tolerance at the rice seedling stage.

[0025] (5) Based on the difference between ST1050 and Koshihikari at the 60bp position of LOC_Os12g17200, the present invention designs the molecular marker 200-IS, and realizes the rapid screening of salt-tolerant alleles through specific primers (the 3'-end C of the reverse primer matches the G of ST1050). The present invention does not require sequencing or complex equipment, and the genotype can be distinguished by conventional PCR, which is suitable for large-scale screening in the field. Compared with the traditional method that requires 2-3 years of phenotypic screening, the molecular marker-assisted breeding provided by the present invention greatly shortens the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is a phenotypic comparison diagram of the parental ST1050 and Koshihikari seedlings at the three-leaf stage after 7 days of treatment with 125 mM NaCl (scale bar: 5 cm);

[0027] Figure 2 It is a diagram showing the relative physical positions of the Indel primers for genotype identification in the present invention and the preliminary mapping results of qSR12;

[0028] Figure 3 It is a fine mapping diagram of qSR12 in the present invention;

[0029] Figure 4 It is a comparison diagram of the DNA sequence and amino acid sequence of LOC_Os12g17200 between the parents in the present invention. The difference at the 60th bp is marked by a red box, and 200-F and 200-R represent the forward and reverse primers for amplifying the full length of LOC_Os12g17200;

[0030] Figure 5 It is a phenotypic comparison diagram of the ST1050 and Zhonghua 11 seedlings at the three-leaf stage after 7 days of treatment with 125 mM NaCl (scale bar: 5 cm);

[0031] Figure 6 It is a hygromycin marker detection result diagram of ST1050, Zhonghua 11 and complementary transgenic lines TH11, TH14, TH15, TH17 in the present invention, ddH 2 O is the negative control with pure water as the template;

[0032] Figure 7 It is a phenotypic diagram of the transgenic complementary lines of LOC_Os12g17200 seedlings at the three-leaf stage after 7 days of treatment with 125 mM NaCl (scale bar: 5 cm). A: Before treatment; B: After 7 days of treatment; C: After 7 days of treatment, the statistical results of seedling survival rate, and the data are repeated three times;

[0033] Figure 8 It is a diagram showing the design position and related sequence information of the molecular marker 200-KF / SR in the present invention;

[0034] Figure 9 This is the detection result diagram of the molecular marker 200-IS for the ST1050, Zhonghua 11 and complementary transgenic lines TH11, TH14, TH15, TH17 of the present invention, ddH 2 O is the negative control with pure water as the template;

[0035] Figure 10 This is the diagram of the expression level of qSR12 detected by real-time quantitative RT-PCR in various tissues of rice. seedling, three-leaf stage seedling; root, root; seed, mature seed (brown rice); leaf, leaf; stem, stem; node, node; young-panicle, young panicle; flowering-panicle, flowering panicle. Specific implementation manners

[0036] The present invention will be further described in detail below through specific preferred embodiments, but the present invention is not limited to the following embodiments.

[0037] It should be noted that unless otherwise specified, the chemical reagents involved in the present invention are all purchased through commercial channels.

[0038] Experimental example 1: Fine mapping of qSR12 and prediction of candidate genes

[0039] 1. Rice seedling salt treatment method

[0040] The seeds were placed in an oven at 42 °C for 7 days to break dormancy, then soaked in saturated sodium hypochlorite solution for 10 min, rinsed three times with tap water, soaked at room temperature for 2 days, germinated at 37 °C for 1 day, and the seeds with consistent emergence of radicles were sown in a 96-well plate with perforations at the bottom, 16 seedlings for each line, with 3 replicates. After culturing with tap water for 1 week, it was changed to rice nutrient solution and continued to culture for 1 week until the three-leaf stage. Salt stress treatment was carried out for 1 week with a nutrient solution containing 125 mM NaCl, and the survival rate of the seedlings was observed and recorded.

[0041] 2. Fine mapping and prediction of qSR12

[0042] After the three-leaf stage seedlings of the parents ST1050 and Koshihikari were treated with 125 mM NaCl solution for 7 days, there were significant phenotypic differences (such as Figure 1As shown), the seedling survival rates were 60% and 18.5%, respectively. Recombinant inbred lines and backcross populations were constructed to finely locate qSR-12. First, high-precision DNA of 124 F7 recombinant inbred lines of ST1050 / Koshihikari and parents ST1050 and Koshihikari was extracted and resequenced by binmap method to obtain a genetic map containing 3783 bins. Combined with the seedling survival data under 125mM NaCl treatment, the composite interval mapping method was adopted to obtain three QTLs with LOD peak values ​​exceeding 6.0, which were located on chromosome 12 and adjacent to each other (see Table 1). The three adjacent QTLs were merged into one QTL, namely qSR12, with an interval size of 582kb. According to the differences in parental sequences, InDel primers were designed near qSR12 for genotype identification. Due to the high sequence homology, two usable InDel primers Bin12-S1 and Bin12-S5 were finally obtained, which were located on both sides of qSR12, with relative physical positions of 9180511 and 10045108, respectively, and a distance of 865 kb, that is, the positioning interval of qSR12 was 865 kb (e.g. Figure 2 shown).

[0043] Table 1 QTL affecting seedling survival rate detected on chromosome 12 in RIL families under salt stress

[0044]

[0045]

[0046] a The favorable allele indicating improved survival rate comes from the salt-tolerant parent ST1050.

[0047] To further localize qSR12 to a smaller physical interval, the BC consisting of 1452 individual plants was screened using the linked markers Bin12-S1 and Bin12-S5 (see Table 2) on both sides of qSR12. 1 F 2 The whole genome sequencing method was used to detect the effective SNPs in the 865kb interval of the 19 exchange strains, and the association analysis was performed in combination with the seedling survival rate data under salt stress. Finally, qSR12 was located in the interval of 64kb relative physical distance, including 12 predicted genes (such as Figure 3 Among them, five of them encode functional proteins, namely LOC_Os12g17160 encoding flavonol sulfhydryltransferase, LOC_Os12g17140 encoding NBS-LRR disease resistance protein, and LOC_Os12g17130, LOC_Os12g17150, and LOC_Os12g17200 encoding proteins of unknown functions.

[0048] Table 2 Sequence information of InDel primers Bin12-S1 and Bin12-S5

[0049]

[0050] Referring to the Nipponbare sequence provided by the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), multiple pairs of primers were designed. Using the genomic DNA of parents ST1050 and Koshihikari as templates (the DNA sequence information is shown below), the full-length sequences of 5 genes, namely LOC_Os12g17130, LOC_Os12g17140, LOC_Os12g17150, LOC_Os12g17160, and LOC_Os12g17200, were amplified and aligned (the primer sequence information for amplification is shown in Table 3). It was found that LOC_Os12g17200, which encodes an unknown function protein, has differences between the parents. LOC_Os12g17200 has no introns, with a full length of 282 bases. There is a difference between the parents at the 60th base after the ORF. It is G in ST1050 and C in Koshihikari, and the corresponding amino acid also changes from Asp in ST1050 to Glu in Koshihikari. It is speculated that this gene is a candidate gene for qSR12 (as Figure 4 shown).

[0051] DNA sequence information of LOC_Os12g17200: (The DNA sequence is the same as the cDNA sequence. In parent ST1050: The underlined part indicates that the 60th bp is G)

[0052] SEQ ID No.1:

[0053] ATGTGTCAACACCGGCCAGCACAGACACAAAGGTGGAGGTGCATGGAAGAGCTCATGGA G CAAACCCGAGGACTCAGTGGTGGCACTGCTACTGGAGCTGTGTCTACAGGACGGGCTGCTCTTCCCGCTGCTCGAATCGTCACCGCCGACATCATGTGTAAGGCCATAGCGCCATCGTCGCCGCAGATGTCGGCATGTCCGCTGTCCTCTCGCTTCCCTCCTACTTTGGGCGATGCCAGGAATGTGTTCCTCGACAGCAAGGAAAGTATTTTGACTCGTTAA

[0054] SEQ ID No.4 (In parent Koshihikari: The underlined part indicates that the 60th bp is C):

[0055] ATGTGTCAACACCGGCCAGCACAGACACAAAGGTGGAGGTGCATGGAAGAGCTCATGGA C CAAACCCGAGGACTCAGTGGTGGCACTGCTACTGGAGCTGTGTCTACAGGACGGGCTGCTCTTCCCGCTGCTCGAATCGTCACCGCCGACATCATGTGTAAGGCCATAGCGCCATCGTCGCCGCAGATGTCGGCATGTCCGCTGTCCTCTCGCTTCCCTCCTACTTTGGGCGATGCCAGGAATGTGTTCCTCGACAGCAAGGAAAGTATTTTGACTCGTTAA

[0056] Table 3 Candidate gene amplification primer sequence information

[0057]

[0058]

[0059] Experimental Example 2: Complementary verification of LOC_Os12g17200 and development of related molecular markers

[0060] To further verify whether LOC_Os12g17200 is the major QTL regulating salt tolerance at the rice seedling stage, the promoter + gene sequence of LOC_Os12g17200 was cloned from the genome of the parent ST1050, ligated to the vector pCAMBIA1300221-GFP, and the transgenic complementary vector P 200 : LOC_Os12g17200 + GFP was constructed. Rice calli were infected by Agrobacterium tumefaciens-mediated transformation method, and the gene complementary vector was transferred into japonica rice Zhonghua 11 for gene function complementary verification. Since the transformation efficiency of japonica rice Koshihikari is extremely low, Zhonghua 11 was used instead of Koshihikari for the complementary experiment here. Zhonghua 11 has a high transformation efficiency and is the same salt-sensitive japonica rice variety as Koshihikari (as Figure 5 shown). After PCR identification, the LOC_Os12g17200 sequence in Zhonghua 11 was consistent with that of Koshihikari.

[0061] To verify whether the transgenic plants are positive, the vector hygromycin marker primers HYG-F (ATGAAATCACGCCATGTAGT), HYG-R (ACTATCCTTCGCAAGACCTT) (see Table 4) were designed. Using the DNA of transgenic rice seedlings as a template, the corresponding fragments were amplified, and the parent ST1050 and the recipient Zhonghua 11 were used as controls. The results showed that only the hygromycin fragment could be amplified from the DNA of the transgenic lines (asFigure 6 as shown, indicating successful transformation.

[0062] Table 4 Hygromycin amplification primers and molecular marker 200-KF / SR sequence information

[0063]

[0064] Note: In 200-SR, lowercase and bold letters represent mismatched bases; uppercase and bold letters represent base differences at the sites.

[0065] The seedlings of transgenic complementary lines were treated with 125 mM NaCl, with the parental line ST1050 and the recipient Zhonghua 11 as controls. After 7 days of treatment, the seedlings of Zhonghua 11 were basically dead, and the survival rates of the 4 complementary transgenic lines TH11, TH14, TH15, and TH17 were higher than that of Zhonghua 11, and 3 of them were close to the salt-tolerant parental line ST1050 (as Figure 7 shown), confirming the success of the complementation experiment. LOC_Os12g17200 is the predicted gene of the major salt-tolerant QTL qSR12 at the seedling stage of rice.

[0066] Based on the difference at the 60 bp of LOC_Os12g17200 between ST1050 and Koshihikari, the molecular marker 200-IS was designed. The forward primer 200-KF (SEQ ID NO.2: TGTCAAGGAAATACCCGA GAT) is located at the promoter position of LOC_Os12g17200, and the reverse primer 200-SR (SEQ ID NO.3: ACTGAGTCCTCGGGTCTGC) (see Table 4) is located inside the LOC_Os12g17200 gene, where the last base at the 3' end is C, complementary to the 60th base G in ST1050, and a mismatched base is introduced at the 4th base from the 3' end, changing from T to C (as Figure 8 shown). The PCR detection results showed that the target fragment of 454 bp could be amplified from the parental line ST1050 and the complementary transgenic lines, while there was no band in the recipient Zhonghua 11 (as Figure 9 shown), confirming that the molecular marker 200-IS can be used as a functional marker for LOC_Os12g17200.

[0067] PCR reaction system, reaction program, and detection method:

[0068] The components of the 20 μL reaction system are: 2 μl of 10× buffer (containing 25 mM MgCl 2),0.4 μl of 10 mM dNTP, 0.8 μl of upstream and downstream primers (10 pmol / μl), 0.7 μl of genomic DNA to be tested, 0.4 μl of Taq DNA polymerase (2 U / μl), and water was added to make up to 20 μl. The reaction program was: pre-denaturation at 95°C for 4 min; 32 cycles: denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min / 1 kb; finally, extension at 72°C for 8 min. The PCR amplification products were observed under an ultraviolet lamp after electrophoresis on a 1% agarose gel and staining with ethidium bromide.

[0069] Experimental Example 3: Tissue Expression Analysis of qSR12

[0070] 1. Sampling of each tissue part of Zhonghua 11

[0071] Zhonghua 11 was planted in the Xinqiao Experimental Base of Taizhou Academy of Agricultural Sciences. Tissue samples at the three-leaf stage seedlings and adult stage were collected, including roots, stems, nodes, leaves, young panicles, mature panicles, etc. The samples were wrapped with aluminum foil during sampling, quickly frozen in liquid nitrogen and stored at -80°C for later use.

[0072] 2. RNA Extraction and First Strand cDNA Synthesis

[0073] RNA extraction from each tissue part of rice was carried out using the FastPure Plant Total RNA Isolation Kit of Novizan Company according to the steps. Finally, each sample was eluted and dissolved with 60 μl of RNase-free ddH 2 O. First strand cDNA synthesis was carried out using the HiScript III 1st Strand cDNA Synthesis Kit of Novizan Company according to the steps. The synthesized cDNA stock solution was diluted 10 times and used as a template for real-time quantitative RT-PCR analysis.

[0074] 3. Real-time Quantitative RT-PCR Analysis

[0075] The qPCR dye used was MonAmp TM ChemoHS Specificity Plus qPCR Mix produced by Monad Biotech Co., Ltd. The 10 μL reaction system components were: 5 μl of mix mixture, 0.5 μl of upstream and downstream primers (10 pmol / μl), 1.0 μl of cDNA to be tested, and nuclease-free water was added to make up to 10 μl. The instrument for loading samples was the qTOWER fluorescence quantitative gene amplification instrument of Analytik Jena, Germany 3G. The reaction procedure was a two-step method: pre-denaturation at 95°C for 10 min; 40 cycles: denaturation at 95°C for 10 s, annealing + extension at 60°C for 30 s. Using rice 18S rRNA gene as an internal reference, the experimental results were analyzed by the 2 -ΔΔCT method, and the calculation formula was as follows: fold change in expression = 2 -

(样品目的基因CT值-样品内参基因CT值)-(对照目的基因CT值-对照目的基因CT值)

[0076] 4. To detect the expression level of qSR12 in various parts of rice, using Zhonghua 11 as the material, samples were taken from three-leaf stage seedlings, young roots, mature leaves, stems, nodes, young panicles, flowering panicles, and seeds respectively. RNA from various tissue parts of rice at different stages was extracted. After reverse-transcribing into cDNA, the expression level of qSR12 was analyzed by real-time quantitative RT-PCR technology. The results showed that qSR12 was mainly highly expressed in mature seeds, stems, nodes, and flowering panicles, especially the expression level in mature seeds was much higher than that in other parts (as Figure 10 shown).

[0077] Finally, it should be noted that: the above embodiments do not limit the present invention in any form. For those skilled in the art, based on the present invention, some modifications and improvements can be made. Therefore, any modification or improvement made without departing from the spirit of the present invention falls within the scope of protection required by the present invention.

Claims

1. A major QTL for salt tolerance in rice seedlings, characterized in that: It is a major effect QTL qSR12, which is located on rice chromosome 12, located within an interval of a relative physical distance of 64 kb, and contains 12 predicted genes.

2. A candidate gene for the major QTL for salt tolerance in rice seedling stage as claimed in claim 1, characterized in that: The candidate gene is LOC_Os12g17200, and its nucleotide sequence is shown in SEQ ID No.

1.

3. Use of the major effect QTL according to claim 1 or the candidate gene according to claim 2 in the genetic improvement of salt tolerance traits in rice.

4. A molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage as claimed in claim 1, characterized in that: The forward primer of the related molecular marker 200-IS is 200-KF, and the nucleotide sequence of the forward primer 200-KF is shown in SEQ ID NO.

2. The reverse primer is 200-SR, and the nucleotide sequence of the reverse primer 200-KF is shown in SEQ ID NO.

3.

5. The molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage according to claim 4, characterized in that: The related molecular marker 200-IS is used as a functional marker of the candidate gene LOC_Os12g17200.

6. Use of the molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage as claimed in claim 4 in molecular marker-assisted rice breeding.

7. Use of the molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage as claimed in claim 4 in accelerating the breeding of salt-tolerant rice varieties.

8. Use of the molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage as claimed in claim 4 in molecular screening for salt tolerance at the rice seedling stage.

9. A molecular screening method for salt tolerance in rice seedlings, characterized in that: The following steps are included: (1) Taking rice seedlings and extracting genomic DNA; (2) Using the molecular marker primers described in claim 4, the genomic DNA is amplified by PCR, and the PCR amplification product is detected by electrophoresis on 1% agarose gel. If a DNA fragment of a corresponding size is amplified, it indicates the presence of a salt-tolerance gene enhancement allele.

10. The molecular screening method for salt tolerance of rice seedlings according to claim 9, characterized in that: The PCR reaction system is: 2μl 10× buffer (containing 25mM MgCl2), 0.4μl 10mM dNTP, 0.8μl upstream and downstream primers (10pmol / μl), 0.7μl genomic DNA to be tested, 0.4μl Taq DNA polymerase (2U / μl), and water is added to make up to 20μl; the PCR reaction program is: pre-denaturation at 95℃ for 4min; 32 cycles: denaturation at 95℃ for 30s, annealing at 56℃ for 30s, extension at 72℃ for 1min / 1kb; and finally extension at 72℃ for 8min.

Images