A major QTL for salt tolerance at the seedling stage in rice, its candidate genes, related molecular markers, and applications

Abstract

The present invention discloses a major QTL for salt tolerance in rice at the seedling stage, its candidate gene, related molecular markers and applications. The major QTL is major QTL qSR12, which is located on rice chromosome 12, located within an interval of 64kb relative physical distance, and contains 12 predicted genes. The present invention develops a molecular marker capable of identifying differences in the candidate gene LOC_Os12g17200 between parents through initial positioning and fine positioning of the major QTL qSR12 and determination of the candidate gene LOC_Os12g17200. This not only enriches the theoretical knowledge of salt tolerance in rice at the seedling stage, but also the developed molecular marker has important practical value. It can fully explore the salt tolerance characteristics carried by the salt-tolerant parent ST1050, and efficiently and accurately apply these characteristics to the rice breeding process.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular plant breeding, and in particular to a major effect QTL for salt tolerance in rice seedling stage, a candidate gene thereof, related molecular markers and applications. Background Art

[0002] Salinization is a common abiotic stress in rice production. Soil salinization is a global problem that seriously impacts agricultural production and the ecological environment. According to statistics, the global area of ​​saline land exceeds 990 million hectares, of which more than 100 million hectares are in my country. In rice cultivation, salt-affected paddies account for approximately one-fifth of the cultivated area. In recent years, the frequent occurrence of high temperatures and the continued depletion of groundwater have further exacerbated the trend of soil salinization. At the same time, the rapid development of industrialization and urbanization has posed a severe challenge to the protection of arable land. It is imperative to fully develop and utilize saline land resources, such as tidal flats, to expand arable land.

[0003] Rice, one of the world's most important food crops, is moderately salt-sensitive. Salinization of rice fields severely restricts its normal growth. Improving rice salt tolerance and promoting salt-tolerant varieties have become important topics and hot research directions in rice research worldwide. Rice salt tolerance is a very complex quantitative trait, genetically controlled by additive effects, dominance effects, epistatic interactions, and interactions between the environment and genotypes. With the continuous development of molecular marker-assisted breeding (MAS) technology, the physiological and genetic mechanisms of rice salt tolerance have been further analyzed. The use of MAS technology for genetic improvement of rice salt tolerance has shown strong application potential and is gradually gaining favor among rice breeders.

[0004] The two-leaf-one-heart stage and the panicle differentiation stage of rice are the periods most sensitive to salt concentration. Therefore, the analysis of rice salt tolerance QTLs and the response mechanism under salt stress are mostly concentrated in these two periods. Nearly a thousand QTLs related to rice salt tolerance have been identified so far, and more than half of them are related to salt tolerance in the seedling stage. However, the phenotypic contribution rate of most detected rice salt tolerance QTLs is relatively small, which makes fine positioning and map-based cloning extremely difficult. As a result, the research on the vast majority of salt tolerance QTLs is difficult to enter the cloning stage and cannot be applied to rice breeding and improvement. In addition, there is a lack of unified standards for the indicators for identifying rice salt tolerance. Whether it is morphological indicators that are easy to operate but highly subjective, or physiological indicators that are accurate in data but cumbersome to operate, there are certain limitations, which also increases the difficulty of map-based cloning of rice salt tolerance QTLs.

[0005] Currently, only a few salt-tolerance QTLs, such as SKC1 and Salto1, are used in rice breeding. SKC1, the first map-based salt-tolerance gene to be cloned, is located on rice chromosome 1 and is a major QTL for salt tolerance in rice, contributing over 40% to phenotypic variation. Its donor parent is the highly salt-tolerant rice variety Nona Bokra. The SKC1 gene encodes a 554-amino acid protein that belongs to the high-affinity K + A new member of the transporter family. When rice is subjected to salt stress, a large amount of Na + SKC1 can transfer excess Na + transported back to the roots, thereby alleviating Na + Gregorio et al. (1997) used the F8 recombinant inbred line of Pokkali / IR29 to detect a gene on chromosome 1 that controls the Na + , K + The major QTL for protein content was named Salto1, and its phenotypic contribution was 64.3%-80.2%. Summary of the Invention

[0006] In response to the shortcomings of the existing technology, the purpose of the present invention is to provide a major effect QTL for salt tolerance in rice seedlings, its candidate gene, related molecular markers and applications, so as to provide a new and successfully cloned QTL qSR12 related to rice seedling survival rate under salt stress. The developed molecular marker can better apply the salt tolerance characteristics of the salt-tolerant parent ST1050 to rice breeding.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] The present invention proposes a major QTL for salt tolerance in rice seedling stage, which is the major QTL qSR12. The major QTL qSR12 is located on rice chromosome 12, positioned within an interval of relative physical distance of 64 kb, and contains 12 predicted genes.

[0009] The present invention also proposes a candidate gene for the major QTL for salt tolerance in rice at the seedling stage as described above. The candidate gene is LOC_Os12g17200, and its nucleotide sequence is shown in SEQ ID No. 1.

[0010] The present invention also proposes an application of the major effect QTL or the candidate gene described above in the genetic improvement of the salt tolerance trait of rice.

[0011] The present invention also proposes a related molecular marker 200-IS for the major effect QTL of salt tolerance in rice seedling stage as described above, wherein the forward primer of the related molecular marker 200-IS is 200-KF, and the nucleotide sequence of the forward primer 200-KF is shown in SEQ ID NO.2, and the reverse primer is 200-SR, and the nucleotide sequence of the reverse primer 200-KF is shown in SEQ ID NO.3.

[0012] Preferably, the related molecular marker 200-IS is used as a functional marker of the candidate gene LOC_Os12g17200.

[0013] The present invention also proposes the use of the above-mentioned molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage in molecular marker-assisted rice breeding.

[0014] The present invention further proposes the use of the above-mentioned molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage in accelerating the breeding of salt-tolerant rice varieties.

[0015] The present invention further proposes the use of the above-mentioned molecular marker 200-IS related to the major QTL for salt tolerance at the rice seedling stage in molecular screening for salt tolerance at the rice seedling stage.

[0016] The present invention further proposes a molecular screening method for salt tolerance in rice seedlings, comprising the following steps:

[0017] (1) Take rice seedlings and extract genomic DNA;

[0018] (2) PCR amplification of the genomic DNA is performed using the molecular marker primers, and the PCR amplification products are detected by electrophoresis on 1% agarose gel. If a DNA fragment of corresponding size is amplified, it indicates the presence of the salt-tolerance gene enhancement allele.

[0019] Preferably, the PCR reaction system is: 2 μl 10× buffer (containing 25 mM MgCl2), 0.4 μl 10 mM dNTP, 0.8 μl upstream and downstream primers (10 pmol / μl), 0.7 μl genomic DNA to be tested, 0.4 μl Taq DNA polymerase (2 U / μl), and water is added to make up to 20 μl; the PCR reaction program is: pre-denaturation at 95°C for 4 min; 32 cycles: denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 1 min / 1 kb; and finally extension at 72°C for 8 min.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] (1) The present invention developed a molecular marker that can identify the differences in the candidate gene LOC_Os12g17200 between parents through the initial and fine positioning of the major effect QTL qSR12 and the determination of the candidate gene LOC_Os12g17200. This not only enriches the theoretical knowledge of salt tolerance in rice seedlings, but also has important practical value. It can fully explore the salt tolerance characteristics carried by the salt-tolerant parent ST1050 and apply these characteristics efficiently and accurately in the rice breeding process.

[0022] (2) The present invention provides a new and successfully cloned QTL qSR12 related to rice seedling survival under salt stress. By constructing recombinant inbred lines and backcross populations, combined with binmap resequencing and composite interval mapping, qSR12 was initially located to the 582kb interval of chromosome 12, and finally finely located to a 64kb interval (containing 12 genes) through exchange strain screening and whole-genome SNP association analysis. Compared with traditional QTL positioning (such as SKC1, which requires a phenotypic contribution rate of more than 40%), this method significantly improves the positioning accuracy through high-density genetic maps (3783 bins) and exchange strain screening, and is suitable for cloning minor QTLs (contribution rate <10%).

[0023] (3) Through parental sequence alignment (ST1050 vs. Koshihikari), the present invention found that the 60th base difference of the ORF of LOC_Os12g17200 (ST1050 is G, Koshihikari is C) leads to an amino acid substitution (Asp replaced by Glu), which is directly associated with the difference in salt tolerance phenotype. By combining the differences between the parents of LOC_Os12g17200 encoding an unknown functional protein and amino acid substitution analysis, the candidate gene is preferentially locked, avoiding the tedious process of one-by-one verification in traditional cloning.

[0024] (4) The present invention cloned the promoter + gene sequence of LOC_Os12g17200 from the genome of the parent ST1050, then connected the vector to construct a transgenic complementation vector, and the gene complementation vector was transferred into the japonica rice Zhonghua 11. The survival rate of the transgenic lines (TH11, TH14, TH15, TH17) under salt stress was significantly improved, close to that of the salt-tolerant parent ST1050, confirming that the complementation experiment was successful and LOC_Os12g17200 was the predicted gene of the major effect QTL qSR12 for salt tolerance in rice seedlings.

[0025] (5) Based on the difference between ST1050 and Koshihikari at 60 bp in LOC_Os12g17200, the present invention designed the molecular marker 200-IS, and achieved rapid screening of salt-tolerant alleles through specific primers (the C at the 3' end of the reverse primer matches the G of ST1050). The present invention does not require sequencing or complex equipment, and conventional PCR can distinguish genotypes, making it suitable for large-scale field screening. Compared with the traditional method that requires 2-3 years of phenotypic screening, the molecular marker-assisted breeding provided by the present invention greatly shortens the breeding cycle. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The phenotypic comparison diagram of the parent ST1050 of the present invention and the three-leaf stage seedlings of Koshihikari after 7 days of treatment with 125 mM NaCl (scale bar: 5 cm);

[0027] Figure 2 Figure 1 shows the relative physical positions of the Indel primers used for genotype identification and the initial positioning results of qSR12 in the present invention;

[0028] Figure 3 This is the qSR12 fine positioning map of the present invention;

[0029] Figure 4 Figure 2 is a comparison of the DNA and amino acid sequences of LOC_Os12g17200 between the parents of the present invention. The red box marks the 60 bp difference. 200-F and 200-R represent the forward and reverse primers for amplifying the full length of LOC_Os12g17200.

[0030] Figure 5 The phenotypic comparison diagram of ST1050 and Zhonghua 11 three-leaf stage seedlings after 7 days of 125 mM NaCl treatment (scale bar: 5 cm);

[0031] Figure 6 This is a graph showing the results of hygromycin labeling detection of ST1050, Zhonghua 11, and the complementary transgenic lines TH11, TH14, TH15, and TH17 of the present invention, with ddH2O as a negative control using pure water as a template;

[0032] Figure 7 Figure 5. Phenotype of three-leaf seedlings of the LOC_Os12g17200 transgenic complementation line of the present invention after 7-day treatment with 125 mM NaCl (scale bar: 5 cm). A: before treatment; B: 7-day treatment; C: statistical results of seedling survival rate after 7-day treatment, data were repeated three times.

[0033] Figure 8 Design location and related sequence information diagram of the molecular marker 200-KF / SR of the present invention;

[0034] Figure 9This is a graph showing the results of the molecular marker 200-IS detection of ST1050, Zhonghua 11, and the complementary transgenic lines TH11, TH14, TH15, and TH17 of the present invention, with ddH2O as the negative control using pure water as the template;

[0035] Figure 10 This is a diagram of the expression levels of qSR12 in various rice tissues detected by real-time quantitative RT-PCR in the present invention, seedling, three-leaf seedling; root, root; seed, mature seed (brown rice); leaf, leaf; stem, stem; node, node; young-panicle, young panicle; flowering-panicle, flowering panicle. DETAILED DESCRIPTION

[0036] The present invention is further described in detail below through specific preferred embodiments, but the present invention is not limited to the following embodiments.

[0037] It should be noted that, unless otherwise specified, all chemical reagents involved in the present invention were purchased through commercial channels.

[0038] Experimental Example 1: Fine Mapping and Candidate Gene Prediction of qSR12

[0039] 1. Salt treatment method for rice seedlings

[0040] The seeds were placed in a 42°C oven for 7 days to break dormancy. They were then soaked in a saturated sodium hypochlorite solution for 10 minutes, rinsed three times with tap water, soaked at room temperature for 2 days, and germinated at 37°C for 1 day. Seeds that were uniformly white were sown in a 96-well plate with perforations at the bottom, with 16 seedlings per line, in three replicates. After one week of incubation in tap water, the water was switched to rice nutrient solution and cultured for another week until the three-leaf stage. Salt stress was then applied to the nutrient solution containing 125 mM NaCl for one week, and the survival rate of the seedlings was recorded.

[0041] 2. Fine positioning and prediction of qSR12

[0042] After the three-leaf seedlings of ST1050 and Koshihikari were treated with 125 mM NaCl solution for 7 days, the phenotypes showed significant differences (e.g. Figure 1(shown in Figure 1), with seedling survival rates of 60% and 18.5%, respectively. Recombinant inbred lines and backcross populations were constructed to fine-tune the mapping of qSR-12. High-resolution DNA was first extracted from 124 F7 recombinant inbred lines of ST1050 / Koshihikari, as well as the parental lines ST1050 and Koshihikari, and resequenced using the binmap method to obtain a genetic map containing 3783 bins. Combined with seedling survival data under 125mM NaCl treatment, composite interval mapping was used to identify three QTLs with LOD peaks exceeding 6.0, located adjacent to each other on chromosome 12 (see Table 1). The three adjacent QTLs were merged into a single QTL, qSR12, with an interval size of 582kb. Based on the differences in parental sequences, indel primers were designed near qSR12 for genotyping. Due to the high sequence homology, two usable InDel primers, Bin12-S1 and Bin12-S5, were finally obtained. They were located on both sides of qSR12, with relative physical positions of 9180511 and 10045108, respectively, and a distance of 865 kb. That is, the qSR12 positioning interval was 865 kb (e.g. Figure 2 shown).

[0043] Table 1 QTL affecting seedling survival detected on chromosome 12 in RIL families under salt stress

[0044]

[0045]

[0046] a The favorable allele indicating improved survival was derived from the salt-tolerant parent ST1050.

[0047] To further localize qSR12 to a smaller physical interval, a BC1F2 population consisting of 1452 individual plants was screened using the linked markers Bin12-S1 and Bin12-S5 on both sides of qSR12 (see Table 2), and a total of 19 exchange plants were screened. Whole-genome sequencing was used to detect effective SNPs within an 865 kb interval in the 19 exchange plants. Association analysis was performed based on the seedling survival data under salt stress, and qSR12 was finally located within a relative physical distance of 64 kb, containing 12 predicted genes (such as Figure 3 Among them, five genes encode functional proteins, namely LOC_Os12g17160 encoding flavonol sulfhydryltransferase, LOC_Os12g17140 encoding NBS-LRR disease resistance protein, and LOC_Os12g17130, LOC_Os12g17150, and LOC_Os12g17200 encoding proteins of unknown functions.

[0048] Table 2 Sequence information of InDel primers Bin12-S1 and Bin12-S5

[0049]

[0050] Referring to the Nipponbare sequence provided by the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), multiple primer pairs were designed. Genomic DNA from the parents ST1050 and Koshihikari was used as templates (DNA sequence information is shown below). The full-length sequences of five genes, including LOC_Os12g17130, LOC_Os12g17140, LOC_Os12g17150, LOC_Os12g17160, and LOC_Os12g17200, were amplified and aligned (amplification primer sequence information is shown in Table 3). It was found that LOC_Os12g17200, encoding a protein of unknown function, was different between the parents. LOC_Os12g17200 has no introns and is 282 bases long. There is a difference between the parents at the 60th base after the ORF, with ST1050 being G and Koshihikari being C. The corresponding amino acid also changes from Asp in ST1050 to Glu in Koshihikari. It is speculated that this gene is a candidate gene for qSR12 (e.g. Figure 4 shown).

[0051] DNA sequence information of LOC_Os12g17200: (DNA and cDNA sequences are consistent. In the parent ST1050, the underline indicates that the 60th bp is G)

[0052] SEQ ID No. 1:

[0053] ATGTGTCAACACCGGCCAGCACAGACACAAAGGTGGAGGTGCATGGAAGAGCTCATGGA G CAAACCCGAGGACTCAGTGGTGGCACTGCTACTGGAGCTGTGTCTACAGGACGGCTGCTCTTCCCGCTGCTCGAATCGTCACCGCCGACATCATGTGTAAGGCCATAGCGCCATCGTCGCCGCAGATGTCGGCATGTCCGCTGTCCTCTCGCTTCCCTCCTACTTTGGGCGATGCCAGGAATGTGTTCCTCGACAGCAAGGAAAGTATTTTGACTCGTTAA

[0054] SEQ ID No. 4 (parent Koshihikari: underline indicates the 60th bp is C):

[0055] ATGTGTCAACACCGGCCAGCACAGACACAAAGGTGGAGGTGCATGGAAGAGCTCATGGA C CAAACCCGAGGACTCAGTGGTGGCACTGCTACTGGAGCTGTGTCTACAGGACGGCTGCTCTTCCCGCTGCTCGAATCGTCACCGCCGACATCATGTGTAAGGCCATAGCGCCATCGTCGCCGCAGATGTCGGCATGTCCGCTGTCCTCTCGCTTCCCTCCTACTTTGGGCGATGCCAGGAATGTGTTCCTCGACAGCAAGGAAAGTATTTTGACTCGTTAA

[0056] Table 3 Candidate gene amplification primer sequence information

[0057]

[0058]

[0059] Experimental Example 2: Complementary Validation of LOC_Os12g17200 and Development of Related Molecular Markers

[0060] To further verify whether LOC_Os12g17200 is a major QTL regulating salt tolerance at the seedling stage in rice, the promoter and gene sequences of LOC_Os12g17200 were cloned from the genome of the parent ST1050 and ligated to the vector pCAMBIA1300221-GFP to construct the transgenic complementation vector P 200 :LOC_Os12g17200+GFP. The gene complementation vector was transferred into japonica rice Zhonghua 11 by Agrobacterium transformation to verify gene function complementation. Since the transformation efficiency of japonica rice Koshihikari is extremely low, Zhonghua 11 was used instead of Koshihikari for complementation experiments. Zhonghua 11 has a high transformation efficiency and is a salt-sensitive japonica rice variety like Koshihikari (such as Figure 5 PCR identification showed that the sequence of LOC_Os12g17200 in Zhonghua 11 was consistent with that in Yueguang.

[0061] In order to verify whether the transgenic plants were positive, the vector hygromycin marker primers HYG-F (ATGAAATCACGCCATGTAGT) and HYG-R (ACTATCCTTCGCAAGACCTT) (see Table 4) were designed and the corresponding fragments were amplified using the DNA of the transgenic rice seedlings as templates, and the parent ST1050 and the recipient Zhonghua 11 as controls. The results showed that only the hygromycin fragments (such as Figure 6 ), indicating that the conversion was successful.

[0062] Table 4 Sequence information of hygromycin amplification primers and molecular marker 200-KF / SR

[0063]

[0064] Note: In 200-SR, lowercase bold letters represent mismatched bases; uppercase bold letters represent bases at differential sites

[0065] The seedlings of the transgenic complementary lines were treated with 125mM NaCl, with the parent ST1050 and the recipient Zhonghua 11 as controls. After 7 days of treatment, the Zhonghua 11 seedlings were basically dead. The survival rates of the four complementary transgenic lines TH11, TH14, TH15, and TH17 were higher than those of Zhonghua 11, and three of them were close to those of the salt-tolerant parent ST1050 (e.g. Figure 7 The results show that the complementation experiment was successful and LOC_Os12g17200 is the predicted gene of the major QTL qSR12 for salt tolerance at the seedling stage in rice.

[0066] Based on the difference between ST1050 and Koshihikari at 60 bp in LOC_Os12g17200, the molecular marker 200-IS was designed. The forward primer 200-KF (SEQ ID NO. 2: TGTCAAGGAAATACCCGA GAT) is located in the promoter of LOC_Os12g17200, and the reverse primer 200-SR (SEQ ID NO. 3: ACTGAGTCCTCGGGTCTGC) (see Table 4) is located within the LOC_Os12g17200 gene. The last base at the 3' end is C, which is complementary to the 60th base G in ST1050. The 4th base at the 3' end introduces a mismatch base, changing from T to C (e.g., Figure 8 PCR test results showed that the parent ST1050 and the complementary transgenic line could amplify the target fragment of 454 bp, while the recipient Zhonghua 11 had no band (as shown). Figure 9 As shown), it was confirmed that the molecular marker 200-IS can serve as a functional marker of LOC_Os12g17200.

[0067] PCR reaction system, reaction procedure, and detection method:

[0068] A 20 μL reaction system consisted of: 2 μL 10× buffer (containing 25 mM MgCl2), 0.4 μL 10 mM dNTPs, 0.8 μL upstream and downstream primers (10 pmol / μL), 0.7 μL genomic DNA to be tested, and 0.4 μL Taq DNA polymerase (2 U / μL). The volume was made up to 20 μL with water. The reaction protocol was: initial denaturation at 95°C for 4 min; 32 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 1 min / kb; and a final extension at 72°C for 8 min. PCR products were analyzed by electrophoresis on a 1% agarose gel, stained with ethidium bromide, and visualized under UV light.

[0069] Experimental Example 3: Tissue Expression Analysis of qSR12

[0070] 1. Sampling of various tissue parts of Zhonghua 11

[0071] Zhonghua 11 was planted in the Xinqiao Experimental Base of Taizhou Academy of Agricultural Sciences. Tissue samples including roots, stems, nodes, leaves, young panicles, and mature panicles were collected at the three-leaf seedling stage and adult plant stage. The samples were wrapped in aluminum foil, quickly frozen in liquid nitrogen, and stored at -80℃ for later use.

[0072] 2. RNA extraction and first-strand cDNA synthesis

[0073] RNA was extracted from various rice tissues using the Novozan FastPure Plant Total RNA Isolation Kit according to the protocol. Each sample was eluted and dissolved in 60 μl of RNase-free ddH₂O. First-strand cDNA synthesis was performed using the Novozan HiScript III 1st Strand cDNA Synthesis Kit according to the protocol. The synthesized cDNA stock solution was diluted 10-fold and used as a template for real-time quantitative RT-PCR analysis.

[0074] 3. Real-time quantitative RT-PCR analysis

[0075] qPCR dye used was MonAmp produced by Mona Biotechnology TM ChemoHS Specificity Plus qPCR Mix. A 10 μL reaction system consists of: 5 μL of mix, 0.5 μL of upstream and downstream primers (10 pmol / μL), 1.0 μL of the cDNA to be tested, and nuclease-free water to a total of 10 μL. The sample was loaded on a qTOWER fluorescence quantitative gene amplification instrument (analytikjena, Jena, Germany). 3The reaction procedure was a two-step method: pre-denaturation at 95°C for 10 min; 40 cycles of denaturation at 95°C for 10 s, annealing and extension at 60°C for 30 s. The rice 18S rRNA gene was used as an internal reference. The experimental results were obtained using 2 -ΔΔCT The data were analyzed by the method, and the calculation formula was as follows: expression difference fold = 2 -

(样品目的基因CT值-样品内参基因CT值)-(对照目的基因CT值-对照目的基因CT值)

[0076] 4. To detect the expression level of qSR12 in various parts of rice, Zhonghua 11 was used as the material, and samples were collected from three-leaf seedlings, young roots, mature leaves, stems, nodes, young panicles, flowering panicles, and seeds. RNA was extracted from various tissues at different stages of rice, and after reverse transcription of cDNA, the expression level of qSR12 was analyzed using real-time quantitative RT-PCR. The results showed that qSR12 was mainly expressed at high levels in mature seeds, stems, nodes, and flowering panicles, especially in mature seeds, where the expression level was much higher than that in other parts (such as Figure 10 shown).

[0077] Finally, it should be noted that the above embodiments do not limit the present invention in any form. Those skilled in the art will appreciate that modifications and improvements can be made based on the present invention. Therefore, any modifications or improvements made without departing from the spirit of the present invention are intended to fall within the scope of protection claimed in the present invention.

Claims

1. Application of a primer pair for a 200-IS molecular marker related to salt tolerance in rice seedling stage in accelerating the breeding of salt-tolerant rice varieties, characterized in that: The nucleotide sequence of the forward primer 200-KF of the primer pair is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer 200-SR of the primer pair is shown in SEQ ID NO.

3. If a DNA fragment of corresponding size is amplified, it indicates the presence of a salt-tolerance gene synergistic allele.

2. Application of a primer pair for a molecular marker 200-IS related to salt tolerance in rice seedling stage in molecular screening for salt tolerance in rice seedling stage, characterized in that: The nucleotide sequence of the forward primer 200-KF of the primer pair is shown in SEQ ID NO. 2, and the nucleotide sequence of the reverse primer 200-SR of the primer pair is shown in SEQ ID NO.

3. If a DNA fragment of corresponding size is amplified, it indicates the presence of a salt-tolerance gene synergistic allele.

3. A molecular screening method for salt tolerance in rice seedlings, characterized in that: The following steps are included: (1) Take rice seedlings and extract genomic DNA; (2) PCR amplification of the genomic DNA was performed using primers of the relevant molecular marker 200-IS, and the PCR amplification products were detected by electrophoresis on 1% agarose gel. If a DNA fragment of the corresponding size was amplified, it indicated the presence of the enhanced allele of the salt-tolerance gene; The forward primer of the related molecular marker 200-IS is 200-KF, and the nucleotide sequence of the forward primer 200-KF is shown in SEQ ID NO.

2. The reverse primer is 200-SR, and the nucleotide sequence of the reverse primer 200-SR is shown in SEQ ID NO.

3.

4. The molecular screening method for salt tolerance in rice seedlings according to claim 3, characterized in that: The PCR amplification reaction system was as follows: 2 μl 10× buffer, 0.4 μl 10 mM dNTPs, 0.8 μl upstream and downstream primers at 10 pmol / μl, 0.7 μl genomic DNA to be tested, 0.4 μl Taq DNA polymerase at 2 U / μl, and water was added to make up to 20 μl. The PCR amplification reaction procedure was as follows: initial denaturation at 95°C for 4 min; 32 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 1 min / 1 kb; and a final extension at 72°C for 8 min.

Images