Molecular marker for identifying citrus sinensis and application thereof

Abstract

This invention discloses a method for identifying Jiangan oranges ( Citrus reticulata The molecular marker 'Jiangan', with amplification primer pairs as shown in SEQ ID NO:1 and SEQ ID NO:2, belongs to the field of molecular biology. Jiangan is a local loose-skinned citrus variety, with the potential to produce Jiangan tangerine peel comparable to Guangchenpi. This invention, based on plant resequencing and bioinformatics analysis, uses specific primers to amplify the corresponding molecular markers in the sample DNA. The PCR products are then subjected to agarose gel electrophoresis, and the sample is identified as Jiangan based on the electrophoretic bands. This invention provides a rapid and accurate method for identifying Jiangan germplasm, offering important technical support for citrus variety improvement and genetic research.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and relates to a molecular marker for identifying Jiangan oranges. This invention also relates to a method for identifying the molecular marker for Jiangan oranges. Background Technology

[0002] Jiangan ( Citrus reticulata 'Jiangan' is a local mandarin orange variety from Yichang, Hubei Province. It is characterized by its strong adaptability and high yield, and is often used as rootstock for mandarin orange plants. [1] Guangchenpi is made from the local Guangdong citrus variety, Chazhigan (also known as tangerine peel). Citrus reticulata Dried tangerine peel (Chenpi) is made from the peel of the fruit of the 'Chachiensis' plant and is highly regarded for its rich nutritional value and unique functional properties. Besides Guangchenpi, other types of tangerine peel, such as Sichuan Chenpi and Zhejiang Chenpi, also have good edible and medicinal qualities, indicating a promising future for the diversified development of the tangerine peel industry. Jiangan-based Chenpi is a local specialty product made from the peel of Jiangan tangerines from the Yichang region through processes such as sun-drying and aging.

[0003] Currently, due to the low efficiency, long processing time, and high cost of traditional identification methods, the industrialization of Jian citrus-based original tangerine peel faces difficulties in tracing raw materials, thus limiting its development. Molecular marker technologies, such as restriction fragment length polymorphism (RFLP), simple repeat sequence (SSR), and random amplified polymorphic DNA (RAPD), can rapidly and accurately identify different citrus germplasm by analyzing specific fragments of the genome sequence, and are widely used in assessing the genetic diversity of citrus germplasm resources. [2,3,4] This provides a solution for the efficient identification of Jiangan citrus germplasm. However, there are currently no reports on molecular markers used to distinguish Jiangan from other loose-skinned citrus fruits such as Chazhigan. Therefore, developing an efficient and accurate molecular marker technology for Jiangan is of great significance for promoting the healthy, standardized, and sustainable development of the Jiangan citrus-derived dried tangerine peel industry. Summary of the Invention

[0004] This invention aims to establish a molecular marker technology for Jiangan citrus, which integrates plant resequencing technology, bioinformatics analysis methods, and polymerase chain reaction (PCR) verification to distinguish Jiangan citrus from other loose-skinned citrus fruits. This technology will provide important technical support for the genetic breeding, germplasm resource management, and industrial development of Jiangan citrus.

[0005] To achieve the above objectives, the applicant designed specific, high-quality primer pairs based on the genome resequencing data of Jiangan tangerines and screened the effectiveness of InDel-marked primer pairs. Ultimately, a pair of InDel primers capable of distinguishing Jiangan tangerines from other loose-skinned citrus fruits was selected, with the following nucleotide sequences:

[0006] JG-F: 5'-GCTAACTTAATTAGATTTCCAACGGT-3' (SEQ ID NO: 1);

[0007] JG-R: 5'-GGGCTTGGAGATAAGACAAGG-3' (SEQ ID NO: 2).

[0008] Studies have found that, compared to the tea-branch mandarin orange, the original plant of Guangchenpi (Guangdong tangerine peel), the Jiangan mandarin orange peel contains higher levels of total volatile substances, total flavonoids, hesperidin, and nobiletin. Therefore, Jiangan mandarin orange is expected to become a high-value candidate raw material for tangerine peel comparable to Guangchenpi. Furthermore, the molecular markers developed in this invention are expected to enable rapid identification of Jiangan mandarin orange germplasm resources and parental screening in citrus genetic breeding; traceability and quality control of tangerine peel raw materials; and genetic diversity analysis of loose-skinned citrus.

[0009] The present invention further provides a method for identifying Jiangan oranges, comprising the following steps:

[0010] (1) Extract DNA from the sample to be tested;

[0011] (2) Using the extracted DNA as a template, PCR amplification was performed on JG-F / JG-R using the primers described above.

[0012] (3) Perform agarose gel electrophoresis on the PCR products and judge the results based on the specific bands.

[0013] The PCR amplification reaction system consisted of: 5 μL 2×Phanta Max Buffer, 0.2 μL dNTPMix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 0.4 μL forward primer, 0.4 μL reverse primer, 1 μL DNA template, and 2.8 μL ddH2O.

[0014] The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 56℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 35 cycles; 72℃ final extension for 10 min.

[0015] The criteria for determining the results are as follows: if the electrophoresis results show two bands of approximately 750 bp and 200 bp, then the sample is a Jiangan orange.

[0016] The present invention also provides a molecular marker kit for identifying Jiangan oranges, comprising the primer pair JG-F / JG-R described above.

[0017] Furthermore, the molecular marker kit also includes PCR reaction buffer, dNTP Mix, and DNA polymerase.

[0018] The beneficial effects of this invention are:

[0019] The molecular marker PCR method established in this invention can specifically distinguish Jiangan from other loose-skinned citrus fruits, with clear product bands and accurate and reliable results. This provides a solution for the efficient identification of Jiangan, a high-quality citrus germplasm resource, which will greatly enhance the development of the citrus industry and provide important technical support for citrus variety improvement and genetic research. Attached Figure Description

[0020] Figure 1 Gel electrophoresis images of molecular markers in different loose-skinned citrus fruits. Note: M: Marker; NC: Negative control; Sample number and germplasm information are shown in Table 1. Detailed Implementation

[0021] The technical solution of the present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and not for limiting the scope of protection of the present invention. Various modifications or equivalent substitutions made by those skilled in the art based on the following embodiments should also be considered to fall within the scope of protection of the present invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions or reference books such as *Molecular Cloning: A Laboratory Manual* (New York: Cold Spring Harbor Laboratory, 2017), or according to the methods recommended in the manufacturer's operating manual. Materials in the embodiments that do not specify their source are all commonly used materials in the art and can be obtained commercially.

[0022] Example

[0023] 1. Materials and Methods

[0024] 1.1 Reagents and Materials

[0025] Phanta Max Super-Fidelity DNA Polymerase and PCR reagents were purchased from Vazyme Biotech Co., Ltd. PCR primers were synthesized by Tsingke Biotechnology Co., Ltd.

[0026] Information on 50 loose-skinned mandarin orange samples is shown in Table 1. All samples were collected from the National Citrus Germplasm Resource Nursery of the Citrus Research Institute of the Chinese Academy of Agricultural Sciences in Beibei District, Chongqing.

[0027] Table 1. Information on 50 loose-skinned mandarin orange samples

[0028]

[0029] 1.2 Experimental Methods

[0030] 1.2.1 InDel primer design and screening

[0031] Based on the genome resequencing data of Jiangan citrus, specific high-quality primer pairs were designed. Large insertion / deletion (InDel) sites of 50 bp or more were selected. Using SnpGene 4.1.9 software, primer pairs were designed 200 bp upstream and downstream of the insertion / deletion sites, and then the InDel-marked primer pairs were screened for effectiveness. Finally, a pair of InDel primers, JG-F / R, capable of distinguishing Jiangan citrus from other loose-skinned citrus fruits was selected. Their nucleotide sequences are as follows:

[0032] JG-F: GCTAACTTAATTAGATTTCCAACGGT5'-3'

[0033] JG-R:GGGCTTGGAGATAAGACAAGG5'-3'

[0034] Using JG-F / R as primers and Jiangan DNA as a template, two sequences can be amplified, namely SEQ ID NO: 3 (820bp) and SEQ ID NO: 4 (167bp).

[0035] SEQ ID NO: 3

[0036] TTTTATTCCGAATTTGACCTTTCTGCATTTGATACAAATTGTGTATTTGGCTGCCCAATGACTTGAATAATGCCCACAATGCCTTGTCTTATCTCCAAGCCCAATTCATGATGTCTTGCATCTTGAATTGCATTTTCAATCCATATTTTCTCAATTAATCCATTTAAAGCAGCTTGCATCTTTTTGGCTCTTGCTCTTGTAATTGGGCCTCCATGAATGTGCAAAGGATCACTTGAAGTTTTAATGGTCCCTTGATGGTTCTCATCACGCCACAAGAATGCAAATTCTTGATAAGTTCACTAGTTCTCAAAAGAACCAAAGAAAGAATAATCTTTCAAATTCAAATAACATTAATCTCTTAATTATCATACATAGCAAGGTTGCTGAGTTTAAATAGGCTAAAAGAAACC CAAGATCCTAAAAATACAAATGGAAACATTGGAACAACCCTCCAAGTATAGGTTTGTCAAAGGGTGCTTTAAAAGCCTTCCCCAACCCACTATTATTAATGATAGACTTACCTAACACATTGATAAACTTGACGAAAACAAATAAATGAAGTTGAATAATCAAAGGAGTCGATTGAATTCCCAAGCCTGAACAAGCTGTAATAAA TTGATCATAACTCCTTCTAGAGAACTCCAAATCCAACTCTGTAAAATGCATTGGAAAGCTAACTTAATTAGATTTCCAACGGTATATAGCTTGCACATTAATTCTGGCTCAATCAATACAGTTTTTATTCCGAATTTGACCTTTCTGCATTTGATACAAATTGTGTATTTGGCTGCCCAATAACTTGAATAATGCCCACAATGCC

[0037] SEQ ID NO: 4

[0038] GCTAACTTAATTAGATTTCCAACGGTATATAGCTTGCACATTAATTCTGGCTCAATCAATACAGTTTTTATTCCGAATTTGACCTTTCTGCATTTGATACAAATTGTGTATTCGGTTGCCCAATAACTTGAATAATGCCCACAATGCCTTGTCTTATCTCCAAGCCC

[0039] 1.2.2 PCR amplification and gel electrophoresis analysis methods

[0040] The 10 μL PCR amplification system consisted of: 5 μL 2×PhantaMax Buffer, 0.2 μL dNTP Mix, 0.2 μL PhantaMax Super-Fidelity DNA Polymerase, 0.4 μL forward primer, 0.4 μL reverse primer, 1 μL DNA template, and 2.8 μL ddH2O. The reaction program was: 95℃ pre-denaturation for 5 min; followed by 95℃ denaturation for 15 s, 56℃ annealing for 30 s, and 72℃ extension for 3 min, for 35 cycles; and a final extension at 72℃ for 10 min. After amplification, the PCR product was stored at 4℃ for later use.

[0041] PCR products were subjected to gel electrophoresis using a DYY-6C gel electrophoresis system. The voltage was set to 80 V, the current to 200 mA, and the electrophoresis time to 25 min. Electrophoresis images were saved.

[0042] 1.2.3 Methods for the determination of volatile substances

[0043] The collected peels of young Jiangan and Chazhigan tangerines were compared with those of Liu Yuan et al. [5]The method described is used to extract and detect volatile substances. The volatile substance extract was centrifuged at 12,000 rpm for 10 min at 4 °C. After centrifugation, the extract was filtered through a 0.22 μm filter into a sample vial for detection. Volatile substances were determined using gas chromatography-mass spectrometry (GC-MS) with a TRACEGC Ultra and DSQII mass spectrometer (Thermo Fisher Scientific, USA). The GC-MS was injected at 250 °C in split mode (20:1), with helium (>99.99% purity) at a flow rate of 1 mL / min, and passed through a TRACE TR-5 (30 m × 0.25 mm, 0.25 μm) column. The GC-MS instrument temperature program was as follows: 40 °C for 3 min; ramped to 160 °C at 2 °C / min; then ramped to 200 °C at 5 °C and held for 3 min; finally ramped to 240 °C at 8 °C / min and held for 3 min. The transfer line temperature was set to 280℃, and the ion source temperature was set to 260℃. The mass range of the analysis was 45–400 m / z.

[0044] Raw GC-MS data were processed and exported using Xcalibur 2.2 software. Qualitative analysis of volatile substances was based on standard samples, the NIST / EPA / NIH mass spectrometry database (NIST 2008), and the Wiley Registry mass spectrometry database. Standard curves were constructed using the standard samples in SIM mode. For each standard, six concentrations were diluted, peak areas were measured, and after correction with methyl nonanoate as an internal standard, standard curves were plotted (Table 2). Of all identified volatile substances, those from the standard samples were quantified based on the standard curves in SIM mode, while other volatile substances were quantified relatively using internal standards.

[0045] The formula for calculating the relative content of a substance is: Relative content of a substance (μg / g) =

[0046] Among them, S 物质 S represents the peak area of ​​the target substance. 内标 This represents the peak area of ​​the internal standard methyl nonanoate.

[0047] Table 2. Ten standard samples and standard curves used for GC-MS analysis

[0048]

[0049] 1.2.4 Methods for the determination of flavonoids

[0050] The extraction and detection of flavonoids were performed according to Chen Jiajing's method. [6]The method involved grinding the peels of Jiangan tangerines and Chazhi tangerines 60 days after flowering into powder in liquid nitrogen. After lyophilization using a low-temperature freeze dryer, 0.1 g of the lyophilized powder was weighed and placed in a 10 mL centrifuge tube. 5 mL of 80% methanol was added, and the mixture was ultrasonically extracted at 40℃ for 60 min. Then, it was centrifuged at 25℃ and 12000 r / min for 10 min. 1 mL of the supernatant was filtered through a 0.22 μm microporous membrane. The samples were then analyzed using high-performance liquid chromatography (HPLC). The chromatographic column was C10. 18 Hypersil GOLD (250 × 4.6 mm, 5 μm, Thermo Scientific, USA), mobile phase: A, 0.15% formic acid aqueous solution; B, acetonitrile containing 0.15% formic acid. Elution gradient: 0 min 10% B, 10 min 15% B, 20 min 17% B, 30 min 20% B, 40 min 25% B, 45 min 30% B, 55 min 35% B, 60 min 45% B, flow rate: 1 mL / min, column temperature: 35℃. UV detection range: 210 nm–400 nm.

[0051] 2. Results and Analysis

[0052] 2.1 Comparison of volatile substances and flavonoid content in the peel of Jiangan and Chazhigan 60 days after flowering

[0053] As shown in Table 3, 40 and 33 volatile substances were detected in the peel of young Jiangan and Chazhigan oranges, respectively. Volatile substance content is an important indicator for evaluating the quality of aged tangerine peel. The total volatile substance content in Jiangan was 42693.69±4131.77 μg / g, and in Chazhigan it was 16524.84±750.86 μg / g. The total volatile substance content of Jiangan is approximately 2.6 times that of Chazhigan. P <0.05).

[0054] Table 3. Volatile substances in fresh peel samples of Jiangan and Chazhigan citrus 60 days after flowering

[0055]

[0056] As shown in Table 4, 12 and 13 types of flavonoids were detected in the peels of young Jiangan and Chazhigan oranges, respectively. Flavonoids possess various biological activities. The Chinese Pharmacopoeia (2020) clearly specifies the relevant flavonoid content requirements for dried tangerine peel, such as hesperidin should be no less than 20 mg / g. The total flavonoid content in Jiangan oranges was 81.89±6.48 mg / g, and in Chazhigan oranges it was 36.59±0.61 mg / g. The total flavonoid content, hesperidin, and nobiletin content in Jiangan oranges were approximately 2.2, 1.55, and 7.3 times higher than those in Chazhigan oranges, respectively. P <0.05).

[0057] Table 4. Flavonoids in dried peel samples of Jiangan and Chazhigan 60 days after flowering

[0058]

[0059] In summary, compared to the tea branch mandarin orange, which is the original plant of Guangchenpi, the peel of Jiangan mandarin oranges contains the components that determine its aroma and health quality. d- The content of limonene, hesperidin, and nosenoside is higher than that of tea branch mandarin, making it a promising candidate raw material for high-value tangerine peel comparable to Guangchenpi.

[0060] 2.2 InDel molecular marker amplification in different loose-skinned citrus fruits

[0061] DNA was extracted from the above 50 samples of mandarin orange, and amplified using molecular marker primers JG-F / R. The amplified DNA was then subjected to agarose gel electrophoresis, and the results are shown below. Figure 1 As shown, no bands were observed in the negative control. Using Jiangan DNA as a template, one band of approximately 750 bp and another of approximately 200 bp were amplified, while most other loose-skinned mandarin orange varieties only yielded a 200 bp band, and a few yielded multiple bands. For example, variety 15, Ota Ponkan, only showed one band at 200 bp, while variety 25, Chazhi Mandarin, yielded three bands. This indicates that the molecular marker can effectively distinguish Jiangan from other loose-skinned mandarins.

[0062] References:

[0063] [1] Deng Xiuxin. Chinese Citrus Varieties, Second Edition. China Agriculture Press, 2023.

[0064] [2] Xi Xiuli, Huang Haibo, Lou Buqing, et al. Analysis of genetic polymorphism of SCoT molecular markers in Citrus reticulata and its closely related species [J]. Chinese Traditional and Herbal Drugs, 2018, (10): 2426-2431.

[0065] [3] Li Yingzhi. Loose-skinned citrus ( Citrus reticulata Genetic diversity and phylogenetic studies of Blanco [D]. Huazhong Agricultural University, 2006.

[0066] [4] Xi Xiuli. Molecular identification study of Citrus chazhigensis and its closely related species [D]. Guangzhou University of Chinese Medicine, 2017.

[0067] [5] Liu Yuan, Xiang Simin, Wang Jiangbo, et al. GC-MS analysis of volatile substances and primary metabolites of Korla fragrant pear[J]. Journal of Huazhong Agricultural University, 2020, 39(01): 44-52.

[0068] [6] Chen J, Zhang H, Pang Y, et al. Comparative study of flavonoidproduction in lycopene-accumulated and blonde-flesh sweet oranges ( Citrus sinensis ) during fruit development. Food Chem. 2015 Oct 1;184:238-46.

Claims

1. A method of identifying a grafted citrus plant, comprising, Includes the following steps: (1) Extract DNA from the sample to be tested; (2) Using the extracted DNA as a template, PCR amplification was performed using primer pair JG-F / JG-R. The primer pair is as follows: JG-F: 5'-GCTAACTTAATTAGATTTCCAACGGT-3'; JG-R: 5'-GGGCTTGGAGATAAGACAAGG-3'; (3) Perform agarose gel electrophoresis on the PCR products and judge the results based on the specific bands. If the electrophoresis results show two bands of 750 bp and 200 bp, the sample is Jiangan.

2. The method for identifying Jiangan oranges as described in claim 1, characterized in that, The PCR amplification reaction system consisted of: 5 μL 2×Phanta Max Buffer, 0.2 μL dNTP Mix, 0.2 μL Phanta Max Super-Fidelity DNA Polymerase, 0.4 μL forward primer, 0.4 μL reverse primer, 1 μL DNA template, and 2.8 μL ddH2O.

3. The method for identifying Jiangan oranges as described in claim 1, characterized in that, The PCR amplification reaction program was as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 56℃ annealing for 30 s, 72℃ extension for 3 min, for a total of 35 cycles; 72℃ final extension for 10 min.

Images