Glyphosate-resistant goosegrass genetic typing detection method

Abstract

The invention relates to the technical field of molecular biological detection, in particular to a method for detecting glyphosate-resistant goosegrass genotyping. A double-primer group is designed aiming at three mutation sites of Pro-106-Leu, Pro-106-Ser and Thr-102-Ile, two detection modes are established based on a double-primer group loop-mediated isothermal amplification technology in combination with a fluorescence monitoring system and a color developing dye closed tube interpretation system, the detection accuracy can be improved (greater than 95%) through cooperative use of the double-primer group loop-mediated isothermal amplification technology and the double-primer group loop-mediated isothermal amplification technology, and the double-primer group loop-mediated isothermal amplification technology and the double-primer group loop-mediated isothermal amplification technology and the double-primer group loop-mediated isothermal amplification technology and the double-primer group loop-mediated isothermal amplification technology can be independently used to adapt to various scene requirements. According to the method, typing detection of the LAMP technology against glyphosate weed target mutation is achieved for the first time, high sensitivity of laboratory detection and portability of field application are achieved at the same time, the detection cost is low, and the method is suitable for resistance evolution monitoring and precise herbicide treatment.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology detection, and in particular to a method for detecting the genotyping of glyphosate-resistant goosegrass (Eleusine indica). Background Art

[0002] As the world's most widely used broad-spectrum herbicide, the long-term single use of glyphosate has led to the accelerated evolution of resistant weeds. Glyphosate exerts its herbicidal effect by inhibiting the EPSPS gene in plants and interfering with the synthesis of aromatic amino acids. With the acceleration of the agricultural modernization process, the planting area of glyphosate-resistant transgenic crops (such as soybeans and corn) has been expanding year by year, and the frequency and amount of glyphosate use will inevitably increase significantly. Therefore, it is of great significance to establish a rapid detection technology for weed resistance, monitor the occurrence of glyphosate-resistant weeds in transgenic crop fields in different regions, and timely block the spread of glyphosate-resistant weeds to transgenic crop fields.

[0003] However, the current resistance detection technology faces two challenges: one is the limitation of laboratory technology: traditional sequencing and fluorescence quantitative PCR rely on sophisticated instruments and professional personnel, and it is difficult to meet the needs of rapid field screening; the other is the blank of field monitoring: the lack of detection technology adapted to the field environment makes it impossible to timely grasp the weed resistance situation in each region, resulting in a lag in the early warning of the spread of resistant populations.

[0004] For the detection methods for resistance caused by mutations in weed target sites, there are mainly traditional Sanger sequencing, fluorescence quantitative PCR, CAPS (Cleaved Amplified Polymorphic Sequences) / dCAPS (Derived Cleaved Amplified Polymorphic Sequences), and loop-mediated isothermal amplification (LAMP) methods, etc. However, the above methods all have some technical defects.

[0005] In the traditional Sanger detection method, mainly the DNA of resistant weeds is extracted, PCR primers are designed according to the conserved sequence of the known resistance gene, various reaction components are added to the PCR tube, reactions are carried out on a PCR instrument and agarose gel electrophoresis detection and other steps are performed, and finally the PCR products are subjected to Sanger sequencing, and whether there are mutations is analyzed according to the sequencing results; fluorescence quantitative PCR is to add a fluorescently labeled probe or dye to the conventional PCR, and the fluorescence signal intensity is monitored in real time, and the gene mutation is quantitatively detected in combination with the standard curve. These two detection methods not only have a long detection period, high cost, require expensive instruments to be purchased, and need professional experimental personnel to operate and analyze, etc., but also have poor field applicability and are not suitable for large-scale screening.

[0006] The CAPS / dCAPS detection method. The former utilizes the restriction enzyme cleavage sites formed by the original single nucleotide polymorphisms (SNPs) in the genome, while the latter constructs recognition sites by introducing mismatched bases at the 3` end of the primer, enabling the PCR products to be recognized and cleaved by specific restriction endonucleases. PCR products of different genotypes will produce products of different lengths after digestion, and the gene mutations are judged by separation through agarose gel electrophoresis. Compared with the previous two methods, this method can not only detect the presence of mutations but also perform rapid genotyping, yet it still faces the defects of the above traditional detection techniques.

[0007] Currently, although the conventional single-target LAMP technology avoids the above defects, it can only qualitatively judge the presence or absence of resistance genes and cannot perform resistance gene typing. Summary of the Invention

[0008] To solve the above technical problems, the present invention designs a set of LAMP primers for the specific sequences of two genotypes of goosegrass (resistant and sensitive) at three different mutation sites (Pro-106-Leu, Pro-106-Ser, Thr-102-Ile) of the goosegrass EPSPS gene. Using the LAMP technology, it can rapidly detect the unknown resistant and sensitive goosegrass, distinguish whether there are resistance mutations, and further distinguish the types of resistance mutations (homozygous mutation, heterozygous mutation). Based on this, the following technical solutions are proposed.

[0009] First of all, the present invention provides a set of primers, including: a specific primer set for the resistance gene and a specific primer set for the sensitive gene; the specific primer set for the resistance gene includes the Pro-106-Leu resistance primer set, the Pro-106-Ser resistance primer set, and the Thr-102-Ile resistance primer set; the specific primer set for the sensitive gene includes the Pro-106-Leu sensitive primer set, the Pro-106-Ser sensitive primer set, and the Thr-102-Ile sensitive primer set; The Pro-106-Leu resistance primer set includes: F3: CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCGCTA; The Pro-106-Ser resistance primer set includes: F3: CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCATAGA; The Thr-102-Ile resistant primer set includes: F3:AGCTGCCAAAAGAGCAGTAG B3:CGGGCATATTCTGAGGATGG FIP:ATGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC BIP:TTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC; The Pro-106-Leu sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCCTTG; The Pro-106-Ser sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC B3:CCAACTCACGTTGCATTTCC FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCAGCGG; The Thr-102-Ile sensitive primer set includes: F3:AGCTGCCAAAAGAGCAGTAG B3:CGGGCATATTCTGAGGATGG FIP:GTGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC BIP: CTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC。

[0010] The design method of the above primer sets is as follows: Use PrimerExplorer V5 to design primers for the goosegrass gene sequence with three-site mutations on the target gene as the resistance gene-specific primer set, and then design primers for the goosegrass gene sequence without mutations at the three sites as the sensitive gene-specific primer set.

[0011] Then introduce mismatches into the designed primer sets to improve reaction specificity. It includes a mutant gene-specific LAMP primer set, in which double mismatched bases are introduced at the 3rd - 4th positions at the 3' end of the FIP primer of the Pro-106-Leu primer set; double mismatched bases are introduced at the 3rd - 4th positions at the 3' end of the FIP primer of the Pro-106-Ser primer set; a mismatched base is introduced at the 3rd position at the 5' end of the FIP primer of the Thr-102-Ile primer set, and a mismatched base is introduced at the 3rd position at the 5' end of the BIP primer of the Thr-102-Ile primer set. A wild-type gene-specific LAMP primer set, in which double mismatched bases are introduced at the 3rd - 4th positions at the 3' end of the FIP primer of the Pro-106-Leu primer set; double mismatched bases are introduced at the 3rd - 4th positions at the 3' end of the FIP primer of the Pro-106-Ser primer set; a mismatched base is introduced at the 3rd position at the 5' end of the FIP primer of the Thr-102-Ile primer set, and a mismatched base is introduced at the 3rd position at the 5' end of the BIP primer of the Thr-102-Ile primer set. The positions of these mismatched bases are selected through multiple experiments of screening and verification. In the initial experiments, we tried to introduce mismatched bases at other positions, but the introduction at these positions did not obtain ideal specificity, and even non-specific amplification or low amplification efficiency occurred. Therefore, finally, we selected the current mismatch positions to ensure higher amplification specificity and reliability.

[0012] Furthermore, the present invention provides a reagent or kit containing the above primer sets.

[0013] In some embodiments, the reagent or kit is a LAMP reagent or kit.

[0014] In some embodiments, the reagent or kit includes a fluorescence resistance detection system and a fluorescence sensitivity detection system; The fluorescence resistance detection system includes: Bst 3.0 polymerase, TS LAMP Green, LAMP ReactionMIXⅠ, RNase-free Water, and the resistance gene-specific primer set; The fluorescence sensitive detection system comprises: Bst 3.0 polymerase, TS LAMP Green, LAMP Reaction MIX I, RNase-free Water and the sensitive gene specific primer set.

[0015] In some embodiments, the reagent or kit includes a chromogenic resistance detection system and a chromogenic sensitive detection system; The color development resistance detection system includes: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMP Reaction Mix, RNase-free Water and the resistance gene specific primer set; The colorimetric sensitive detection system comprises: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMP Reaction Mix, RNase-free Water and the sensitive gene specific primer set.

[0016] In some embodiments, the reagent or kit also includes a positive control, a heterozygous control and a negative control; the positive control includes homozygous resistance DNA containing Pro-106-Leu, homozygous resistance DNA containing Pro-106-Ser, and homozygous resistance DNA containing Thr-102-Ile; the heterozygous control includes mutant / wild-type mixed DNA containing Pro-106-Leu, homozygous resistance DNA containing Pro-106-Ser, and homozygous resistance DNA containing Thr-102-Ile; the negative control includes wild-type sensitive DNA.

[0017] Furthermore, the present invention provides the use of the primer set or the reagent or the kit in the genotyping of glyphosate-resistant Glechoma longituba.

[0018] Furthermore, the present invention provides a fluorescence detection method for genotyping of glyphosate-resistant Goosegrass, comprising: adding a Goosegrass DNA sample to be tested to the fluorescence resistance detection system and the fluorescence sensitivity detection system in the reagent or the kit, respectively, and then performing PCR amplification, and judging the genotyping result according to the Ct value and the ΔCt value; the conditions of the PCR amplification include: amplifying at 65°C for 45 minutes and terminating the reaction at 80°C (preferably the fluorescence signal collection interval is 1 minute).

[0019] In some embodiments, a resistance Ct value of <30 and a ΔCt value ≥10 is determined as a homozygous mutation; a resistance Ct value of <30 and a sensitive Ct value of <30 and a -5<ΔCt value <5 are determined as a heterozygous mutation; and a sensitive Ct value of <30 and a ΔCt value ≥10 are determined as no mutation.

[0020] In the present invention, the ΔCt value = Ct sensitive - Ct resistant.

[0021] Meanwhile, the present invention provides a colorimetric detection method for genotyping glyphosate-resistant goosegrass, comprising: adding the DNA sample of the goosegrass to be tested into the colorimetric resistant detection system and the colorimetric sensitive detection system in the reagent or kit respectively, then (preferably in a water bath) amplifying at 65 °C for 45 min and terminating the reaction at 80 °C, and judging the genotyping result according to the color change.

[0022] In some embodiments, when the resistant detection system is yellow and the sensitive detection system is red, it is determined as a homozygous mutation; when both the resistant detection system and the sensitive detection system are yellow, it is determined as a heterozygous mutation; when the resistant detection system is red and the sensitive detection system is yellow, it is determined as non-mutated; when both the resistant detection system and the sensitive detection system are red, it is determined as no template.

[0023] In the specific implementation process, the fluorescence detection method and the colorimetric detection method can be used synergistically to improve the overall accuracy, or can be used separately according to different experimental purposes in different scenarios (laboratory or field).

[0024] In the specific implementation process, the fluorescence detection method and the colorimetric detection method can be used for dual-mode collaborative detection. The colorimetric detection method is used as a preliminary screening to filter out most of the sensitive samples, and then the fluorescence detection method is further used to concentrate on detecting the suspected resistant samples. The two complement each other and cover different scenarios, so as to improve the efficiency and accuracy of the overall detection (when the results of the two methods conflict, the fluorescence detection method shall prevail).

[0025] In the specific implementation process, the DNA sample can be obtained by using the DNA extraction kit method or the crude extraction method.

[0026] The present invention realizes LAMP genotyping for the first time, breaks through the limitation of traditional LAMP technology which can only perform qualitative detection, and realizes genotyping through double primer cross-validation; for the first time, a way of mutual verification of dual-mode detection is established to improve the accuracy of rapid detection. The sensitivity of the LAMP detection method of the present invention is 1000 times higher than that of the conventional PCR detection. Moreover, the LAMP detection method of the present invention is simple and rapid to operate and can be completed within 1 hour. In addition, the primer set of the present invention is designed with 4 specific primers for 6 different regions in the gene sequences of resistant and sensitive goosegrass. If any region in the 6 regions does not match the primer, nucleic acid amplification cannot be carried out. Therefore, the detection method of the present invention has high specificity.

[0027] The present invention has achieved significant advantages in the genotyping detection of herbicide-resistant weeds through double primer set design, dual-mode collaborative verification and anti-pollution control technology, and is of great significance for early warning of the spread of resistant weeds and reducing crop losses.

[0028] Compared with the prior art, the beneficial effects of the present invention are as follows: The primer set designed by the present invention can quickly detect goosegrass that is sensitive to unknown resistance, distinguish whether there is a resistance mutation, and further distinguish the types of resistance mutations (homozygous mutation, heterozygous mutation). Furthermore, it can master the occurrence of herbicide resistance of this type of weed in the region, provide data support for the planting zoning of glyphosate-resistant crops, avoid the horizontal spread of resistance genes, and at the same time, by accurately identifying homozygous and heterozygous resistant populations, guide the rotation of herbicides and reduce the dosage of glyphosate. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the amplification curve of the sensitive primer set for the P106S mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0030] Figure 2 It is the amplification curve of the resistance primer set for the P106S mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0031] Figure 3 It is the amplification curve of the resistance primer set for the P106L mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0032] Figure 4 It is the amplification curve of the sensitive primer set for the P106L mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0033] Figure 5 It is the amplification curve of the resistance primer set for the T102I mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0034] Figure 6 It is the amplification curve of the sensitive primer set for the T102I mutation site. Among them, WT represents no mutation, MUT represents homozygous mutation, and Het represents heterozygous mutation.

[0035] Figure 7 It is the screening result of the colorimetric detection method. Among them, PL represents homozygous mutation of Pro→Leu at the 106th position of the goosegrass EPSPS gene, and PLWT represents heterozygous mutation of Pro→Leu; PS represents homozygous mutation of Pro→Ser at the 106th position of the goosegrass EPSPS gene, and PSWT represents heterozygous mutation of Pro→Ser; IS represents homozygous mutation of Thr→Ile at the 102nd position of the goosegrass EPSPS gene, and ISWT represents heterozygous mutation of Thr→Ile; WT represents no mutation; CK represents no-template control (water).

[0036] Figure 8 These are the sensitivity test results of the LAMP reaction, where CK is the template-free control (water).

[0037] Figure 9 These are the sensitivity test results of the PCR reaction.

[0038] Figure 10 These are the detection results of the fluorescence detection method for non-mutated samples.

[0039] Figure 11 These are the detection results of the fluorescence detection method for heterozygous samples.

[0040] Figure 12 These are the detection results of the fluorescence detection method for homozygous mutant samples.

[0041] Figure 13 These are the detection results of the fluorescence detection method for test samples (partially).

[0042] Figure 14 This is the statistical analysis graph of the CT values of the test samples.

[0043] Figure 15 These are the detection results of the colorimetric detection method.

[0044] Figure 16 These are the detection results of the colorimetric detection method for test samples (partially). Detailed implementation manners

[0045] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts fall within the protection scope of the present invention. In the embodiments provided in this specification, for those without specific technical or conditions, they shall be carried out according to the technologies or conditions described in the literature in the field or according to the product specifications. For the reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through regular channels. All primer sequences in the present invention are in the 5'-3' direction.

[0046] Example 1 Design and screening of specific primers for three target sites of glyphosate-resistant goosegrass EPSPS Download the gene sequence of EPSPS of Glechoma longituba published on NCBI, use the software SnapGene to locate the two target sites of gene Pro106 and Thr102, and select the sequence of about 400 bp before and after the target site. Use Primer Explorer V5 (https: / / primerexplorer.jp / e / ) to design LAMP primers online, and select primers that meet the principles of LAMP primers. The principles are as follows: (1) Tm value: For base sequences with normal GC content or GC content enrichment (more than 60%), select primers F1C / B1C with Tm of 64-66℃, primers F2 / B2 with Tm of 64-66℃, and primers F3 / B3 with Tm of 64-66℃. For base sequences with AT content enrichment (GC content less than 45%), select primers F1C / B1C with Tm of 59-61℃, primers F2 / B2 with Tm of 54-56℃, and primers F3 / B3 with Tm of 54-56℃. (2) Free energy: The 5' end free energy of primers F1C / B1C and the 3' end free energy of primers F2 / B2 / F3 / B3 are selected to be less than or equal to -4Kcal / mol. (3) Primer design: For base sequences with normal or GC-rich GC content, the GC content of the primers should be between 50-60% when designing. For base sequences with AT content, the GC content of the primers should be between 40-50% when designing. When designing primers, it is necessary to prevent the formation of secondary structures, especially for inner primers, and avoid 3' end sequence complementarity. All primers within the selection condition range are pending for subsequent screening.

[0047] The reaction system for fluorescence detection method is 25μL, including: 50ng / μL DNA Template 1μL, 10 U / μL Bst 3.0 polymerase 2μL, 4×LAMP Reaction MIXⅠ 6.25μL, TS LAMP Green (20×) 0.45μL, 10μM FIP / BIP 4μL each, 10μM F3 / B3 1μL each, and RNase-free water to 25μL.

[0048] The reaction system of the colorimetric detection method is 25 μL and includes: 1 μL DNA Template, 1 μL 30 U / μL Bst 2.0 polymerase, 10 μL 2.5× pH Sensitive LAMP Reaction Mix, 1.5 μL 2.5 mM N-Red Stain, 4 μL each of 10 μM FIP / BIP, 1 μL each of 10 μM F3 / B3, and RNase-free water to make up to 25 μL.

[0049] The DNA of the goosegrass samples was extracted using the TianGen High-efficiency Plant Genomic DNA Extraction Kit (Catalog No.: DP350).

[0050] For the target sites to be detected, resistant and sensitive primers for these sites were selected. The DNA of known homozygous mutants, heterozygous mutants, and non-mutant samples was respectively added to the reaction systems of the resistant primers and sensitive primers, and the reaction was carried out on a fluorescence quantitative PCR instrument (ABI7500 instrument). The reaction procedure was as follows: Amplification at 65°C for 1 min, 45 cycles, and fluorescence signals (FAM) were collected every minute at 65°C, and the reaction was terminated by incubation at 80°C for 2 min. The screening criteria were as follows: In the resistant primer system, homozygous mutants and heterozygous mutant samples were amplified, and non-mutant samples were not amplified or were amplified after at least 10 cycles of lag. In the sensitive primer system, non-mutant and heterozygous mutant samples were amplified, and homozygous mutant samples were not amplified or were amplified after at least 10 cycles of lag. Thus, the preliminary screening was completed.

[0051] The primer sets screened above were further screened by the principle of dye color development; for the target sites to be detected, resistant and sensitive primers for these sites were selected. The DNA of known homozygous mutants, heterozygous mutants, non-mutant samples, and no-template controls was respectively added to the reaction systems of the resistant primers and sensitive primers, and the reaction was carried out in a metal water bath. The reaction procedure was as follows: Amplification at 65°C for 45 min, and the reaction was terminated by incubation at 80°C for 5 min, and the color change in the tube was observed. The screening criteria were as follows: In the resistant primer system, homozygous mutants and heterozygous mutant samples changed from red to yellow, and non-mutant and no-template controls did not change color. In the sensitive primer system, non-mutant and heterozygous mutant samples changed from red to yellow, and homozygous mutant and no-template controls did not change color. Thus, the primer screening was completed.

[0052] After screening a large number of primer combinations and conducting experimental verification, the following primer sets were finally obtained, which could meet the requirements of both the fluorescence detection method and the color development detection method.

[0053] The primer sets include: a resistant gene-specific primer set and a sensitive gene-specific primer set; the resistant gene-specific primer set includes a Pro-106-Leu resistant primer set, a Pro-106-Ser resistant primer set, and a Thr-102-Ile resistant primer set; the sensitive gene-specific primer set includes a Pro-106-Leu sensitive primer set, a Pro-106-Ser sensitive primer set, and a Thr-102-Ile sensitive primer set; The Pro-106-Leu resistant primer set includes: F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1) B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2) FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3) BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCGCTA (SEQ ID No.4) The Pro-106-Ser resistance primer set includes: F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1) B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2) FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3) BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCATAGA (SEQ ID No.5) The Thr-102-Ile resistance primer set includes: F3:AGCTGCCAAAAGAGCAGTAG (SEQ ID No.6) B3:CGGGCATATTCTGAGGATGG (SEQ ID No.7) FIP:ATGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC (SEQ ID No.8) BIP:TTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC (SEQ ID No.9) The Pro-106-Leu sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC (SEQ ID No.1) B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2) FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3) BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCCTTG (SEQ ID No.10) The Pro-106-Ser sensitive primer set includes: F3: CTGAAAACCCTCGGACTCTC (SEQ ID No.1) B3: CCAACTCACGTTGCATTTCC (SEQ ID No.2) FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC (SEQ ID No.3) BIP: AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCAGCGG (SEQ ID No.11) The Thr-102-Ile sensitive primer set includes: F3: AGCTGCCAAAAGAGCAGTAG (SEQ ID No.6) B3: CGGGCATATTCTGAGGATGG (SEQ ID No.7) FIP: GTGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC (SEQ ID No.12) BIP: CTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC (SEQ ID No.13).

[0054] The amplification curves of the sensitive primer set for the P106S mutation site are as Figure 1 shown. The amplification curves of the resistant primer set for the P106S mutation site are as Figure 2 shown. The amplification curves of the resistant primer set for the P106L mutation site are as Figure 3 shown. The amplification curves of the sensitive primer set for the P106L mutation site are as Figure 4 shown. The amplification curves of the resistant primer set for the T102I mutation site are as Figure 5 shown. The amplification curves of the sensitive primer set for the T102I mutation site are as Figure 6 shown.

[0055] The screening results of the colorimetric detection method are as Figure 7 shown.

[0056] Example 2 Comparison of the sensitivities of the LAMP reaction and the conventional PCR reaction The DNA concentration was serially diluted by a 10-fold dilution method to 50, 5, 5×10 -1 , 5×10 -2 , 5×10 -3 , 5×10-4 , 5×10 -5 , 5×10 -6 ng / µL, with a total of 8 concentration gradients.

[0057] The LAMP reaction system was the same as that in Example 1; the PCR system was: 12.5 µL of 2×Taq Plantinum PCR Mix, 1 µL of Primer F (10 µM), 1 µL of Primer R (10 µM), 9.5 µL of ddH 2 O, 1 µL of DNA.

[0058] Primer F: GCCTTCTCCTTTTCGTTTC (SEQ ID No.14) Primer R: GGTAGCCCTCCGATTCC (SEQ ID No.15) LAMP and PCR were performed on the same DNA above, and the sensitivities of the two methods were compared. The LAMP program was 65 °C for 45 min, 80 °C for 5 min, and after the reaction, 1% agarose gel electrophoresis was carried out; the PCR program was 94 °C for 4 min, 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, and the above three steps were cycled 32 times, and then 72 °C for 5 min. After the reaction, 1% agarose gel electrophoresis was also carried out.

[0059] Detection results: The display result of the LAMP reaction ( Figure 8 ) The color change from red to yellow or the appearance of characteristic ladder bands of LAMP in the agarose gel could be observed, and the detection sensitivity could reach 5×10 -4 ng. The display result of the PCR reaction ( Figure 9 ) A single band could be observed at the corresponding position of the agarose gel, and the detection sensitivity could reach 5×10 -1 ng.

[0060] Example 3 Verification of Two LAMP Genotyping Methods A total of 150 goosegrass samples with unknown resistance and sensitivity were prepared, and the DNA of the above samples was extracted. Then, the genotypes were verified by cloning and sequencing, and subsequently, the accuracy verification experiments of the fluorescence detection method and the colorimetric detection method were carried out.

[0061] (1) Fluorescence detection method Add each of the above-extracted sample DNAs into a dual system containing the corresponding mutant resistance primer set and sensitive primer set (as a group), and place each reaction system on a qPCR instrument for reaction. The reaction program is as follows: 65°C for 1 minute, 45 cycles, collect fluorescence signals (FAM channel) every minute at 65°C, terminate the reaction at 80°C for 2 minutes, and then observe the amplification curve to interpret the results. Result determination: When the resistance Ct value < 30 and the ΔCt value ≥ 10, it is determined as a homozygous mutation; when the resistance Ct value < 30, the sensitive Ct value < 30, and -5 < ΔCt value < 5, it is determined as a heterozygous mutation; when the sensitive Ct value < 30 and the ΔCt value ≥ 10, it is determined as no mutation; ΔCt value = Ct sensitive - Ct resistance, and the Ct value without amplification is regarded as infinite.

[0062] The detection results of the fluorescence detection method for samples without mutation are as Figure 10 shown, and the detection results of the fluorescence detection method for heterozygous samples are as Figure 11 shown, and the detection results of the fluorescence detection method for homozygous mutant samples are as Figure 12 shown, and the detection results of the fluorescence detection method for the samples to be tested (partial) are as Figure 13 shown. The graph obtained by analyzing the CT values of the sample detection results is as Figure 14 shown. It can be seen from the figure that there are significant differences among the detection results (where there is no amplification and no CT value, and the default cycle number is 50 for convenient data analysis). The overall accuracy rate of the fluorescence detection method is 91.33%.

[0063] (2) Colorimetric detection method Add each of the above-extracted sample DNAs into the corresponding mutant resistance primer set (sensitive primer set can also be selected), and place each reaction system in a water bath for reaction. The reaction program is as follows: 65°C for 45 minutes, terminate the reaction at 80°C for 5 minutes, and observe the color change in the tube. Samples with the color in the tube changing from red to yellow are determined as homozygous mutant samples or heterozygous mutant samples, and samples without color change are samples without mutation.

[0064] Then, react the sample DNA with the color change above with the sensitive primer set again and observe the results. If the color in the tube changes from red to yellow again, it is determined as a heterozygous mutant sample; if there is no color change, it is a homozygous mutant sample; samples without template always have no color change, proving that the system is not contaminated.

[0065] The detection results of the colorimetric detection method are as Figure 15 shown, and the detection results of the colorimetric detection method for the test samples (partial) are as Figure 16 shown. The overall accuracy rate of the colorimetric detection method is 86.6%.

[0066] (3) Dual-mode collaborative detection The colorimetric detection method can quickly eliminate sensitive samples and only send suspected resistant samples to the laboratory for qPCR re-examination, reducing the amount of qPCR testing and concentrating resources on verifying key samples. The fluorescence detection method is used to centrally detect colorimetric positive samples, and accurate typing is performed through the ΔCt algorithm to avoid wasting laboratory resources. Dual-mode collaborative detection increases the overall accuracy rate from 91.33% for qPCR alone to 98.5% for collaborative detection at the system level.

[0067] Example 4 Laboratory-field joint monitoring 1. The investigation found areas where glyphosate-resistant Roundup Grass was suspected to have broken out.

[0068] 2. Rapid screening by field colorimetric detection method (100 samples can be tested in 1 hour using crude DNA extraction method) to preliminarily determine the weed resistance status in the area.

[0069] 3. Laboratory qPCR verification is performed on positive samples (mutations) using fluorescence detection method, and the resistance level (low / medium / high risk area) is determined based on the Ct value and ΔCt value.

[0070] 4. Develop differentiated weed control plans (rotate glyphosate / glufosinate or switch to pesticides with other mechanisms of action).

[0071] The above method is suitable for high-precision screening of weed resistance in a region and provides data support for the zoning of glyphosate-resistant crop planting. If you only need to roughly understand the weed resistance situation in a region, you can use the field colorimetric detection method for rapid detection and screening.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set, characterized in that: include: Resistance gene specific primer set and sensitive gene specific primer set; The resistance gene specific primer set includes a Pro-106-Leu resistance primer set, a Pro-106-Ser resistance primer set and a Thr-102-Ile resistance primer set; the sensitive gene specific primer set includes a Pro-106-Leu sensitive primer set, a Pro-106-Ser sensitive primer set and a Thr-102-Ile sensitive primer set; The Pro-106-Leu resistance primer set includes: F3: CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCGCTA; The Pro-106-Ser resistance primer set includes: F3: CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP: TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCATAGA; The Thr-102-Ile resistance primer set includes: F3:AGCTGCCAAAAGAGCAGTAG B3:CGGGCATATTCTGAGGATGG FIP:ATGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC BIP:TTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC; The Pro-106-Leu sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC B3: CCAACTCACGTTGCATTTCC FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCAGTTACGGCTGCTGTCCTTG; The Pro-106-Ser sensitive primer set includes: F3:CTGAAAACCCTCGGACTCTC B3:CCAACTCACGTTGCATTTCC FIP:TGGGAACTTGCCACCACAGCTGTGGAAGCGGACAAAGC BIP:AAGGATGCGAAAGAGGAGGTGCCAGTTACGGCTGCTGTCAGCGG; The Thr-102-Ile sensitive primer set includes: F3:AGCTGCCAAAAGAGCAGTAG B3:CGGGCATATTCTGAGGATGG FIP:GTGCCAGCATTCCCCAAGAAGGGCTGTGGTGGCAAGTTC BIP:CTCCAATGCGACCATTGACAGCCAACTCACGTTGCATTTCC.

2. A reagent or kit containing the primer set according to claim 1.

3. The reagent or kit according to claim 2, characterized in that The reagent or kit is a LAMP reagent or kit.

4. The reagent or kit according to claim 3, characterized in that The reagent or kit includes a fluorescence resistance detection system and a fluorescence sensitivity detection system; The fluorescent resistance detection system comprises: Bst 3.0 polymerase, TS LAMP Green, LAMP Reaction MIXⅠ, RNase-free Water and the resistance gene specific primer set; The fluorescence sensitive detection system comprises: Bst 3.0 polymerase, TS LAMP Green, LAMP Reaction MIXⅠ, RNase-free Water and the sensitive gene specific primer set.

5. The reagent or kit according to claim 3, characterized in that The reagent or kit includes a colorimetric resistance detection system and a colorimetric sensitive detection system; The color development resistance detection system includes: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMP Reaction Mix, RNase-free Water and the resistance gene specific primer set; The colorimetric sensitive detection system comprises: Bst 2.0 polymerase, N-Red Stain, pH Sensitive LAMP Reaction Mix, RNase-free Water and the sensitive gene specific primer set.

6. Use of the primer set according to claim 1 or the reagent or kit according to any one of claims 2 to 5 in genotyping of glyphosate-resistant Glechoma longituba.

7. A fluorescence detection method for genotyping of glyphosate-resistant Glechoma longituba, characterized in that: include: The Glechoma longituba DNA sample to be tested is added to the fluorescence resistance detection system and the fluorescence sensitivity detection system in the reagent or kit according to claim 4, and then PCR amplification is performed, and the genotyping result is determined according to the Ct value and the ΔCt value; The PCR amplification conditions include: amplification at 65°C for 45 minutes and termination of the reaction at 80°C.

8. A colorimetric detection method for genotyping of glyphosate-resistant sedge grass, characterized in that: include: The Glechoma longituba DNA sample to be tested is added to the colorimetric resistance detection system and the colorimetric sensitive detection system in the reagent or kit according to claim 5, and then amplified at 65°C for 45 minutes, and the reaction is terminated at 80°C, and the genotyping result is determined according to the color change.

9. The fluorescence detection method according to claim 7, characterized in that: Resistance Ct value <30, ΔCt value ≥10 was judged as homozygous mutation; resistance Ct value <30, sensitive Ct value <30, -5 < ΔCt value <5 was judged as heterozygous mutation; sensitive Ct value <30, ΔCt value ≥10 was judged as no mutation.

10. The color development detection method according to claim 8, characterized in that: A homozygous mutation is determined when the resistance detection system is yellow and the sensitive detection system is red; a heterozygous mutation is determined when both the resistance detection system and the sensitive detection system are yellow; a no mutation is determined when the resistance detection system is red and the sensitive detection system is yellow; and a template is absent when both the resistance detection system and the sensitive detection system are red.

Images