Digital PCR (Polymerase Chain Reaction) detection method for mouse norovirus

Abstract

The invention discloses a digital PCR (Polymerase Chain Reaction) detection method for mouse norovirus, which relates to the technical field of digital PCR detection analysis, realizes absolute quantitative detection of mouse norovirus through a digital PCR technology, and has high sensitivity and accuracy. The method comprises the following specific steps: preparing a probe method quantitative reaction system, generating micro-drops through an automatic liquid drop generator, carrying out PCR reaction, and reading an analysis result through a micro-drop reader so as to determine the virus copy number. According to the method, a standard substance or a standard curve is not needed, the experimental process is simplified, and meanwhile, the method has good linearity, specificity and repeatability. Compared with traditional qPCR, the method is not easily influenced by inhibitors in a complex sample, can effectively distinguish tiny concentration differences, and is suitable for rapid and accurate detection of mouse norovirus in experimental animal health management and scientific research.

Description

Technical Field

[0001] The present invention relates to the technical field of digital PCR detection and analysis, and in particular to a digital PCR detection method for mouse norovirus. Background Art

[0002] Murine Norovirus (MNV) is one of the most common viruses in experimental mice. It belongs to the Caliciviridae family and is mainly transmitted through the fecal-oral route. MNV infection usually does not cause clinical symptoms in immune-normal mice and most immunodeficient mice, but in some immunodeficient mice, such as mice with STAT1 gene deletion, it can cause clinical symptoms such as emaciation, diarrhea and death. Due to the high infection rate of MNV in experimental mice and its potential impact on certain immunological studies, the establishment of a rapid, accurate and efficient MNV detection method is crucial for the health management and scientific research of experimental animals.

[0003] The digital PCR system is a nucleic acid quantification technology based on the single-molecule PCR method. Compared with the traditional real-time quantitative PCR (qPCR), digital PCR can directly count the number of DNA molecules and achieve absolute quantification of the starting sample. The principle is to divide a sample into tens to tens of thousands of parts and distribute them to different reaction units, each of which contains at least one copy of the target molecule (DNA template). The target molecules are PCR amplified in each reaction unit, and the fluorescence signals of each reaction unit are statistically analyzed after the amplification. According to the relative proportion and the volume of the reactor, the nucleic acid concentration of the original solution can be calculated.

[0004] Current qPCR can provide relative quantitative results, but requires standards or standard curves, and has limited detection capabilities for low-abundance nucleic acid sequences. The main problems faced by existing qPCR technology include: the need for standards or standard curves, which increases experimental complexity; insufficient detection sensitivity for low-abundance nucleic acid sequences; difficulty in distinguishing samples with small concentration differences; and susceptibility to PCR inhibitors, which limits its application in complex samples. Summary of the invention

[0005] The purpose of the present invention is to provide a digital PCR detection method for mouse norovirus to solve the problems of low sensitivity, complex operation, difficulty in distinguishing small concentration differences and susceptibility to inhibitors in the prior art.

[0006] In order to achieve the above object, the technical scheme of the present invention is as follows: A digital PCR detection method for mouse norovirus comprises the following steps:

[0007] S1: Prepare a quantitative reaction system using the probe method. The reaction system includes 900 nM primers and 250 nM probes.

[0008] S2: Generate microdroplets using an automatic droplet generator.

[0009] S3: Perform PCR reactions. The reaction conditions include: pre-denaturation at 95 °C for 10 minutes, denaturation at 94 °C for 30 seconds, annealing temperature at 52.7 °C, extension time at 60 seconds, for a total of 40 cycles, and finally extension at 98 °C for 10 minutes and hold at 4 °C.

[0010] S4: Place the 96-well plate after completing PCR into a microdroplet reader for reading and analysis to determine the copy number of murine norovirus.

[0011] Further, the premix for the probe method is One-Step RT-ddPCR Kit for Probes, which is suitable for use when RNA is used as a template.

[0012] Further, the nucleic acid content of the sample does not exceed the specified detection range, that is, 1 - 100,000 copies of fragmented nucleic acid or 1 - 20,000 copies of intact genomic DNA.

[0013] Further, the sequences of the primers and probes are as follows:

[0014] Primer MNV-F: GGCTGGGTTGGGAACATG;

[0015] Primer MNV-R: GCCAGCAGTAAAGGCATTGC;

[0016] Probe Prope: (FAM)TTCAGCTGGTCCTCG(MGB).

[0017] Further, it also includes the step of performing linear verification on the detection method. The linear verification includes gradient dilution of a strong positive reference product, and the dilution gradients are 39,000 copies / test, 3,900 copies / test, 390 copies / test, 39 copies / test, and 4 copies / test respectively. Each dilution is repeated at least 3 times. The slope a in the linear regression formula y = ax + b satisfies 0.95 ≤ a ≤ 1.05, and R2 ≥ 0.99.

[0018] Further, it also includes the step of performing specificity verification on the detection method. The specificity verification includes detecting other common virus samples such as Sendai virus, mouse hepatitis virus, minute virus of mice, pneumonia virus of mice, and reovirus type III, and the results are all negative.

[0019] Furthermore, the method further includes a step of repeatability verification of the detection method, wherein the repeatability verification includes repeating the test at least 6 times on a dilution gradient of 3900 copies / test, and the test results are all positive, and the coefficient of variation CV≤10%.

[0020] Compared with the prior art, the present invention has the following beneficial effects: the present invention realizes absolute quantification of single DNA molecules through digital PCR technology, and can directly count the number of DNA molecules, thereby accurately detecting the presence of mouse norovirus even at extremely low concentrations. In addition, digital PCR is not affected by PCR inhibitors, making detection in complex samples more reliable, solving the problem that qPCR is easily affected by inhibitors in complex samples.

[0021] The digital PCR detection method of the present invention does not require a standard product or a standard curve, and the detection can be completed directly through three steps of droplet generation, PCR amplification, and droplet reading. Each step has clear operating conditions and parameters, such as the preparation of the reaction system, the temperature and time of the film sealing, the specific conditions of the PCR reaction, etc., so that the experimenter can quickly master and accurately execute. In addition, the present invention also provides detailed primer and probe sequences, as well as specific steps for linear verification, specificity verification, and repeatability verification of the detection method, which provides a strong guarantee for the standardization and repeatability of the experiment, and further simplifies the experimental operation process.

[0022] The present invention can effectively distinguish small concentration differences and improve the accuracy and reliability of detection. The absolute quantitative characteristics of digital PCR technology enable the present invention to provide accurate copy number data when detecting mouse norovirus of different concentrations, rather than just relative quantitative results. By performing gradient dilution and linear verification on the strong positive reference, the present invention can obtain a good linear relationship at different dilutions. The slope a in the linear regression formula y=ax+b satisfies 0.95≤a≤1.05, and R2≥0.99, indicating that the test results are highly consistent with the theoretical values. In addition, the specificity verification results show that the test results of the present invention for other common virus samples are all negative, indicating that it has good specificity and no cross-reaction. Repeatability verification also shows that the test results have high repeatability, with a coefficient of variation CV≤10%, ensuring the stability and reliability of the test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 is a flow chart of a digital PCR detection method for mouse norovirus in an embodiment of the present invention;

[0024] Figure 2 Schematic diagram of searching for the most suitable primer / probe concentration combination in an embodiment of the present invention;

[0025] Figure 3It is a schematic diagram for exploring the optimal annealing temperature (Tm) in the embodiment of the present invention;

[0026] Figure 4 It is a linear regression curve graph in the embodiment of the present invention;

[0027] Figure 5 It is a schematic diagram of the first repeated result of linear verification in the embodiment of the present invention;

[0028] Figure 6 It is a schematic diagram of the second repeated result of linear verification in the embodiment of the present invention;

[0029] Figure 7 It is a schematic diagram of the third repeated result of linear verification in the embodiment of the present invention;

[0030] Figure 8 It is a schematic diagram of the experimental result of mouse Sendai virus specificity in the embodiment of the present invention;

[0031] Figure 9 It is a schematic diagram of the experimental result of mouse hepatitis virus specificity in the embodiment of the present invention;

[0032] Figure 10 It is a schematic diagram of the experimental result of mouse minute virus specificity in the embodiment of the present invention;

[0033] Figure 11 It is a schematic diagram of the experimental result of mouse pneumonia virus specificity in the embodiment of the present invention;

[0034] Figure 12 It is a schematic diagram of the experimental result of reovirus type III specificity in the embodiment of the present invention;

[0035] Figure 13 It is the 6 repeated verification results in the embodiment of the present invention. Detailed implementation manners

[0036] In order to enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0037] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0038] Example 1: Example 1: A digital PCR detection method for murine norovirus, as Figure 1 shown, includes the following steps:

[0039] S1: Prepare a 22 μl reaction system for probe-based quantification (it is recommended to appropriately expand the reaction system to 24 μl). Select a suitable probe-based premix (note: when using RNA as a template, choose One-Step RT-ddPCR Kit for Probes). The recommended final concentration is 900 nM Primer + 250 nM Probe. Mix well by oscillation and centrifuge to remove air bubbles. Note that the nucleic acid content of the sample added to the 22 μl system should not exceed the specified detection range (1 - 100,000 copies of fragmented nucleic acid or 1 - 20,000 copies of intact genomic DNA). For example, for intact human genomic DNA, it should not exceed 66 ng / 20 μl. The sample can be pretreated with restriction enzymes in advance to increase the detection concentration. In addition, when using plasmid as a template, it is recommended to perform enzymatic digestion to eliminate complex structures. When performing CNV experiments, the DNA template must be digested frequently with enzymes.

[0040] S2: Add the 22 μl sample reaction system to a new 96-well plate. Taking 8 wells in a column as a unit, if there are less than 8 samples, make up with 22 μl of 1×buffer control diluted by one-fold, and pay attention not to introduce air bubbles.

[0041] S3: Place the side with the red line mark (the shiny side) of the film facing up on the 96-well plate and fix it. Seal the film with a preheated PX1 heat sealer. The recommended operating program is: 180 °C, 5 s. There is no need to reverse the direction for secondary sealing.

[0042] S4: Connect the power supply of the automatic droplet generator. Then the following startup screen will appear. After startup, the instrument will perform self-check. At this time, if the instrument door is open, it will close automatically; if the instrument is in standby mode, click on the color touch screen interface, and the instrument will perform self-check. At the same time, turn on the power supply at the back of the QX200 Droplet Reader, and turn on the computer and QuantaSoft software after preheating for at least 30 minutes.

[0043] S5: Set the sample plate

[0044] S5.1: Click the Configure Sample Plate button in the middle of the bottom of the touch screen interface, and then a schematic diagram of the 96-well plate will appear;

[0045] S5.2: Corresponding to the position where the sample is placed, click on the touch screen to select the corresponding wells in each column. You can select any wells in each column (click again to cancel the selection). At this time, you can also edit the name of this reaction in the upper left corner. After finishing, click OK;

[0046] S5.3: The system will calculate whether new consumables need to be added according to the total number of samples selected. If new consumables need to be added, the position of the corresponding consumable on the touch screen will flash a yellow light.

[0047] S6: Place the consumables. To avoid contamination, it is recommended to place the required consumables in sequence from the back to the front of the instrument:

[0048] S6.1: Open the instrument door by lifting the handle on the door upwards;

[0049] S6.2: The three innermost positions are for placing the DG32 cartridges of the droplet generator. When there is no DG32 cartridge placed, the indicator light shows yellow; after placing the DG32 cartridges, the indicator light shows green, and at the same time, the corresponding position on the touch screen also shows green for Ready. Note the placement direction of the DG32 cartridges. If the direction is incorrect, it cannot be smoothly placed into the instrument;

[0050] S6.3: The two middle positions are for placing the pipette tips. Similarly, when there are no pipette tips placed, the indicator light shows yellow; after removing the lid of the pipette tip box and placing the whole box of pipette tips, the indicator light shows green, and at the same time, the corresponding position on the touch screen also shows green for Ready. At the same time, place an empty pipette tip collection box into the groove in the middle of the instrument. Note: Currently, only the matching AutoDG pipette tips can be used, and pipette tips of other brands will damage the instrument.

[0051] S7: Place the 96-well plate sample plate containing the 22ul ddPCR reaction system prepared earlier at the left front position of the instrument. The indicator light changes from yellow to green, and at the same time, the corresponding position on the touch screen shows green for Ready. Note the direction of the sample plate. If the direction is incorrect, the color of the indicator light will not change.

[0052] S8: Place the droplet receiving plate for receiving droplets at the right front position of the instrument:

[0053] S8.1: Take out the ice box placed at -20°C (it should be placed at -20°C for at least 2 hours. The ice box is pink at room temperature and turns dark blue after freezing), and place it at the right front position of the instrument. The indicator light changes from yellow to green, and at the same time, the corresponding position on the touch screen shows green for Ready. Note the direction of the sample plate. If the direction is incorrect, the color of the indicator light will not change;

[0054] S8.2: Take a clean 96-well plate and place it on the ice box for receiving the generated droplets.

[0055] S9: Load the droplet generation oil:

[0056] S9.1: Open the lid of the special oil bottle for Auto DG droplet generation oil, and screw the oil bottle to the corresponding position on the left side of the instrument;

[0057] S9.2: Click the Oil Type icon on the touch screen to select the droplet generation oil type, Probe or EveGreen; at this time, the Oil level icon on the touch screen turns green and displays the remaining amount of the currently generated oil.

[0058] S10: Start running:

[0059] S10.1: When the consumables and the droplet generation oil are both placed in the instrument, the START icon in the lower right corner of the touch screen turns green;

[0060] S10.2: Clicking the START icon will pop up a dialog box containing the current settings;

[0061] S10.3: Click the Start Run icon, and the instrument door will automatically close. At this time, the touch screen shows initialization, and the initialization generally takes 1 - 5 minutes; then the instrument starts to work and displays the remaining time.

[0062] S11: After the droplet generation is completed, the Droplets Ready icon will be displayed on the touch screen, and the completion time will also be shown.

[0063] S12: Open the instrument door, remove the 96 - well plate containing the droplets from the ice box, place the side with the red - line mark (the shiny side) facing up on the 96 - well plate and fix it, and use the pre - heated PX1 heat sealer to seal the film. The recommended running program is: 180 °C, 5 s, and there is no need to reverse the direction for secondary film sealing.

[0064] S13: After sealing the film, the PCR reaction should be carried out within 30 minutes, or placed in a 4 °C refrigerator within 4 hours for PCR. It can be completed on any 96 - well PCR instrument. Note that the heating and cooling rate ≤ 2.5 °C / s.

[0065] A. Recommended reaction conditions for the probe method: 1. 95 °C, 10 min; 2. 94 °C, 30 s for 40 cycles, Tm (the annealing temperature is set according to the optimized conditions obtained), 60 s; 3. 98 °C, 10 min; 4. 4 °C, Hold. Note: The above are the PCR conditions when using DNA as the template. If using RNA as the template and a one - step premix, a reverse transcription step of 60 °C, 30 min needs to be added before the first step.

[0066] S14: Check whether the status indicator light on the droplet reader is normal (subject to the English instruction manual).

[0067] S15: Put the previously completed 96 - well plate into the plate holder and assemble it, paying attention to the diagonal orientation of the plate.

[0068] S16: After assembling, gently and steadily place it into the droplet reader.

[0069] S17: Open the QuantaSoft software. It is recommended to perform a Flush System before each experiment. If it has not been used for more than one week, it is recommended to perform a Prime first and then a Flush System. Then, set up the sample information in the 96-well plate, mainly providing the experiment name, experiment type (ABS, CNV, RED), assay, and probe information, etc. After completion, Run can be performed. After the end, the results will be automatically Analyzed. After manual verification and correction, save the results, and then a QX200 experiment is completed.

[0070] Example 2: Application of Digital PCR Detection Method in Detecting Mouse Norovirus

[0071] Currently, primers, probes, and standard quality plasmids for the digital PCR detection method targeting mouse norovirus have been designed and synthesized, as shown in Table 1 below. At the same time, the verification of the optimal primer and probe concentrations, annealing temperature, specificity, repeatability, and accuracy for mouse norovirus has also been completed.

[0072] Table 1. Primer and Probe Sequences of Digital PCR Detection Method for Mouse Norovirus

[0073]

[0074] I. Verification of Optimal Primer and Probe Concentrations and Annealing Temperature

[0075] The digital PCR detection method includes three steps: droplet generation, PCR amplification, and droplet reading. First, prepare the PCR amplification system (20 μl). The conventional system is shown in Table 2 below. After mixing evenly, put it into the droplet generator to generate droplets; then, transfer the generated droplets into a 96-well plate, seal the film, and put it into the PCR instrument for reaction. The conventional reaction program is shown in Table 3 below; finally, put the well plate after the PCR reaction is completed into the droplet reader to run, and it will be automatically analyzed after the end. Set 6 groups of different primer and probe concentrations, which are 1200 nmol / L + 400 nmol / L, 1200 nmol / L + 250 nmol / L, 900 nmol / L + 400 nmol / L, 900 nmol / L + 250 nmol / L, 600 nmol / L + 400 nmol / L, 600 nmol / L + 250 nmol / L, and other reaction conditions are the same. Screen out the optimal primer and probe concentrations, and the results are as follows Figure 2 shown; set 8 annealing temperatures, which are 62.0 °C, 61.2 °C, 60.0 °C, 58.1 °C, 55.8 °C, 53.9 °C, 52.7 °C, 52.0 °C, and other reaction conditions are the same. Screen out the optimal annealing temperature, and the results are as follows Figure 3 shown.

[0076] Table 2. Conventional PCR reaction system

[0077]

[0078]

[0079] Table 3. Conventional reaction parameters

[0080]

[0081] In the digital PCR detection method for murine norovirus (MNV), the amplification effects of the concentrations of each primer and probe were all good, and the bands formed in the blue part were clearly separated from the negative droplets formed in the black part; when the annealing temperature was 53.9°C - 52.0°C, the fluorescence intensity of the positive droplets with bands formed in the blue part was relatively high, clearly separated from the negative droplets formed in the black part, and the signal intensities were all strong. Referring to the recommended conventional reaction parameters, 600 nmol / L + 400 nmol / L was thus selected as the optimal primer / probe concentration, and 52.7°C was selected as the optimal annealing temperature.

[0082] II. Method linearity verification

[0083] In the present invention, a strong positive reference product was serially diluted with dilution gradients of 39000 copies / test, 3900 copies / test, 390 copies / test, 39 copies / test, and 4 copies / test, a total of 5 gradients, and each dilution was repeated at least 3 times.

[0084] For the detection results of 39000 copies / detection - 39 copies / detection, linear fitting was performed. Using the theoretical ratio of murine norovirus as the abscissa and the actual detected ratio of murine norovirus as the ordinate for linear regression analysis, the linear regression formula y = ax + b was obtained, where the slope a of the linear regression curve should satisfy 0.95 ≤ a ≤ 1.05, and R2 ≥ 0.99. The experimental results are shown in Table 4 below, Appendix Figure 4 ~Appendix Figure 7 as shown.

[0085] Table 4. Copy number detection after serial dilution

[0086]

[0087] In the present invention, serial repeated tests were carried out. The comprehensive above results showed that the repeated results of each gradient were good. According to the data, a = 1.0054 was obtained; R2 = 1. The linear fitting was good.

[0088] III. Method specificity verification

[0089] The present invention specifically evaluates other common virus samples through the established digital PCR detection system for murine norovirus, with 3 cases for each pathogen. Other pathogen samples include: Sendai virus, murine hepatitis virus, minute virus of mice, pneumonia virus of mice, and reovirus type III. The experimental results are shown in Table 5, Figures 8 to 12 .

[0090] Table 5. Specificity detection of the method

[0091]

[0092]

[0093] In this experiment, specific tests were conducted on 5 common pathogens such as Sendai virus, murine hepatitis virus, minute virus of mice, pneumonia virus of mice, and reovirus type III, and the test results were all negative. The method has good specificity.

[0094] IV. Verification of method repeatability

[0095] The present invention performs repeated tests on the dilution gradient of 3900 copies / test by gradient dilution of a strongly positive reference product, with at least 6 repetitions for each sample. It is required that the detection results are positive 6 times, and the 6 test results are statistically analyzed and the coefficient of variation is analyzed, with CV ≤ 10%. The experimental results are shown in Table 6 and Figure 13 .

[0096] Six repeated tests were conducted in this experiment, and all 6 repetitions were positive. Among them, CV = 2.24% for 4000 copies / test. The method has good repeatability detection.

[0097] Table 6. Verification of method repeatability

[0098]

[0099] The above specific embodiments are merely explanations of the present invention, and they are not limitations to the present invention. Those skilled in the art can make modifications without creative contributions to this embodiment according to needs after reading this specification, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A digital PCR detection method for mouse norovirus, characterized by: The following steps are involved: S1: preparing a probe method quantitative reaction system, wherein the reaction system includes 900 nM primers and 250 nM probes; S2: droplet generation by an automated droplet generator; S3: performing PCR reaction, wherein the reaction conditions include: pre-denaturation at 95°C for 10 minutes, denaturation at 94°C for 30 seconds, annealing temperature of 52.7°C, extension time of 60 seconds, a total of 40 cycles, and finally extension at 98°C for 10 minutes and maintaining at 4°C; S4: Place the 96-well plate that has completed PCR into a microdroplet reader for reading and analysis to determine the copy number of mouse norovirus.

2. The method according to claim 1, characterized in that: The probe method premix is ​​a One-Step RT-ddPCR Kit for Probes, which is suitable for use when RNA is used as a template.

3. The method according to claim 1, characterized in that: The nucleic acid content of the sample does not exceed the specified detection range, that is, 1 to 100,000 copies of fragmented nucleic acid or 1 to 20,000 copies of complete genomic DNA.

4. The method according to claim 1, characterized in that: The sequences of the primers and probes are: Primer MNV-F: GGCTGGGTTGGGAACATG; Primer MNV-R: GCCAGCAGTAAAGGCATTGC; Prope: (FAM)TTCAGCTGGTCCTCG (MGB).

5. The method according to claim 1, characterized in that: The method also includes a step of linear verification of the detection method, wherein the linear verification includes gradient dilution of a strong positive reference, wherein the dilution gradients are 39,000 copies / test, 3,900 copies / test, 390 copies / test, 39 copies / test, and 4 copies / test, respectively, and each dilution is repeated at least 3 times. The slope a in the linear regression formula y=ax+b satisfies 0.95≤a≤1.05, and R2≥0.

99.

6. The method according to claim 1, characterized in that: It also includes a step of specificity verification of the detection method, which includes testing other common virus samples such as mouse Sendai virus, mouse hepatitis virus, mouse parvovirus, mouse pneumonia virus, and reovirus type III, and the results are all negative.

7. The method according to claim 1, characterized in that: The method also includes a step of repeatability verification of the detection method, wherein the repeatability verification includes repeating the test at least 6 times on a dilution gradient of 3900 copies / test, and the test results are all positive, and the coefficient of variation CV is ≤10%.

Images