Digital PCR (Polymerase Chain Reaction) detection method for mouse microvirus

Through digital PCR detection methods, the problems of low detection sensitivity and complex operation of mice microviruses in the prior art are solved, and high sensitivity and high specificity detection of mice microviruses are achieved, which is suitable for rapid detection and quantitative analysis of clinical samples, research samples and environmental samples.

CN120060562APending Publication Date: 2025-05-30NAT INST FOR FOOD & DRUG CONTROL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510189307.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-05-30

AI Technical Summary

Technical Problem

Existing nucleic acid quantification techniques, such as conventional PCR and real-time quantitative PCR (qPCR), have problems such as low sensitivity, complex operation, and difficulty in distinguishing tiny concentration differences from susceptible to PCR inhibitors when detecting microviruses in mice.

Method used

By using digital PCR detection method, the quantitative reaction system of suitable probe method is prepared, and the reaction system is divided into single droplets using an automatic droplet generator, and PCR amplification and droplet reading are performed to achieve quantitative detection of mouse microviruses.

Benefits of technology

It significantly improves the sensitivity and specificity of the detection, and can be detected as low as a single copy of the mouse microviral nucleic acid molecule. It is suitable for detecting nucleic acid sequences with extremely low content, simplifying the operation process and improving the detection efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120060562A_ABST
    Figure CN120060562A_ABST
Patent Text Reader

Abstract

The invention discloses a digital PCR (Polymerase Chain Reaction) detection method for mouse microviruses, which relates to the technical field of digital PCR detection analysis and is technically characterized by comprising the following steps: preparing a reaction system, generating microdroplets, performing PCR amplification and reading the microdroplets. By optimizing a reaction system and using a proper probe method premixed solution and primers and probes with specific concentrations, the high efficiency and accuracy of detection are ensured. And after the micro-droplets are read, data are analyzed by utilizing QuantitaSoft software, so that a quantitative result of the mouse microvirus is obtained. The invention aims to solve the problems of low sensitivity, complex operation, difficulty in distinguishing tiny concentration difference, susceptibility to influence of inhibitors and the like of the existing nucleic acid quantification technology. The method has a good linear range, specificity and repeatability, the sensitivity is as low as that of single copy of mouse microvirus nucleic acid molecules, and the method is suitable for rapid detection and quantitative analysis of clinical samples, research samples and environmental samples.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of digital PCR detection and analysis, and particularly relates to a digital PCR detection method for minute virus of mice. Background Art

[0002] Digital Polymerase Chain Reaction (dPCR) technology is a nucleic acid quantification technology based on single-molecule PCR method, which represents the third-generation development of PCR technology after the first-generation conventional PCR and the second-generation real-time quantitative PCR (qPCR). The core advantage of digital PCR is that it can directly count the number of DNA molecules and achieve absolute quantification of the starting sample. By dividing the sample into a large number of reaction units, each unit contains at least one copy of the target molecule (DNA template), PCR amplification is carried out in each reaction unit, and the nucleic acid concentration of the original solution is deduced by counting the fluorescence signals. The development background of this technology is based on the demand for higher precision, higher sensitivity and more direct nucleic acid quantification methods, especially in the fields of clinical sample analysis, gene expression research and pathogen detection.

[0003] Minute Virus of Mice (MVM) is a small single-stranded DNA virus belonging to the family Parvoviridae. It was first discovered in 1957 and got its name because of its extremely small size under the electron microscope. Minute virus mainly infects mice and can cause extensive pathological changes in mice, including the formation of tumors. The research on minute virus began in the mid-20th century when scientists discovered this virus during the study of mouse tumors. Subsequently, minute virus has become the focus of research due to its unique biological characteristics and the diseases it causes in mouse models. It not only plays an important role in basic virology research, but also plays an important role in the fields of molecular biology and genetics.

[0004] The existing nucleic acid quantification technologies mainly include conventional PCR and real-time quantitative PCR (qPCR). Conventional PCR is a basic nucleic acid amplification technology that can quickly replicate specific DNA sequences, but it cannot provide accurate quantitative information. Nucleic acid quantification technology mainly relies on real-time quantitative PCR (qPCR) at present, which is a method of quantifying nucleic acids by monitoring the change of fluorescence signals. qPCR can provide relative quantitative results, but it requires standard products or standard curves and has limited detection ability for low-abundance nucleic acid sequences. The main problems faced by the existing qPCR technologies include: the need for standard products or standard curves, which increases the experimental complexity; insufficient detection sensitivity for low-abundance nucleic acid sequences; difficulty in distinguishing samples with tiny concentration differences; being easily affected by PCR inhibitors, which limits its application in complex samples. Summary of the Invention

[0005] The object of the present invention is to solve the above problems, and provide a digital PCR detection method for minute virus of mice, so as to solve the problems of low sensitivity, complex operation, difficulty in distinguishing minute concentration differences and susceptibility to inhibitors in the prior art.

[0006] In order to achieve the above object, the technical solution of the present invention is as follows: A digital PCR detection method for minute virus of mice, comprising the following steps:

[0007] Prepare the reaction system: Prepare a quantitative reaction system for the probe method, use a suitable probe method premix, mix well by shaking and then centrifuge to remove air bubbles;

[0008] Generate droplets: Use an automatic droplet generator to divide the reaction system into individual droplets;

[0009] PCR amplification: Transfer the generated droplets into a 96-well plate, seal the film, and place it in a PCR instrument for reaction;

[0010] Read droplets: Place the 96-well plate that has completed PCR into a droplet reader for reading, analyze the data, and obtain the quantitative result of minute virus of mice.

[0011] Further, the recommended final concentrations of the premix are primers at 900 nM and a probe at 250 nM.

[0012] Further, the sequences of the primers and the probe are as follows:

[0013] MVM-F: GGCTCCAGCCAAGTGACT;

[0014] MVM-R: GCTCTGTAACAGTTTTCAGCACTAC;

[0015] Probe: (FAM)CATGAGCCAGCTTAAC(NFQ).

[0016] Further, the heat sealer program is set to 180 °C for 5 seconds, and the reaction conditions for the PCR amplification are: pre-denaturation at 95 °C for 10 minutes, denaturation at 94 °C for 30 seconds, annealing at 53.9 °C for 60 seconds, 40 cycles, extension at 98 °C for 10 minutes, and hold at 4 °C.

[0017] Further, the linear range of the method is from 35000 copies / test to 4 copies / test, and the slope a of the linear regression equation satisfies 0.95 ≤ a ≤ 1.05, and R2 ≥ 0.99.

[0018] Furthermore, the method has good specificity, and the detection results for common pathogens such as murine norovirus, murine hepatitis virus, Sendai virus, murine pneumonia virus, and reovirus type III are all negative.

[0019] Furthermore, the method has good repeatability. A repeatability test was conducted on the dilution gradient of 3500 copies / test, and the coefficient of variation CV ≤ 10%.

[0020] Furthermore, the sensitivity of the method is as low as a single copy of minute virus of mice nucleic acid molecule, which is suitable for detecting nucleic acid sequences with extremely low content.

[0021] Furthermore, the method is applicable to the rapid detection and quantification of minute virus of mice, and is particularly suitable for the detection of clinical samples, research samples, and environmental samples.

[0022] Compared with the prior art, the beneficial effects of this solution are as follows: By optimizing the reaction system and detection steps, the present invention significantly improves the sensitivity and specificity of detection. First, the method uses digital PCR technology, which can directly count the number of DNA molecules and achieve absolute quantification of the starting sample, thus avoiding the complexity of the traditional qPCR technology that requires standard products or standard curves. Second, by precisely formulating the reaction system, using a suitable probe-based premix, and optimizing the concentration and sequence of primers and probes, the efficiency and accuracy of detection are ensured. In addition, the method has a wide linear range, and good linear relationships can be obtained from 35000 copies / test to 4 copies / test. The slope a of the linear regression equation satisfies 0.95 ≤ a ≤ 1.05, and R2 ≥ 0.99, which enables it to accurately detect minute virus of mice at different concentration levels. At the same time, the method has good specificity, and the detection results for common pathogens such as murine norovirus, murine hepatitis virus, Sendai virus, murine pneumonia virus, and reovirus type III are all negative, reducing the possibility of false detection. The repeatability test results show that the coefficient of variation CV ≤ 10%, indicating that the method has high stability and reliability and is suitable for the detection of large-scale samples.

[0023] In addition, the digital PCR detection method of the present invention is more convenient to operate, reduces experimental steps and time, and improves detection efficiency. Compared with existing nucleic acid quantification technologies, this method can effectively distinguish samples with minute concentration differences, significantly enhances the detection ability of low-abundance nucleic acid sequences, and the sensitivity is as low as a single copy of minute virus of mice nucleic acid molecule, which is particularly suitable for detecting nucleic acid sequences with extremely low content. This makes the method not only suitable for the basic research of minute virus of mice, but also particularly suitable for the rapid detection and quantitative analysis of clinical samples, research samples, and environmental samples. Its characteristics of high sensitivity and high specificity enable it to have broad application prospects in the fields of pathogen detection, gene expression research, etc., and can provide more accurate and reliable data support for related research and clinical diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is a flowchart of the digital PCR detection method for minute virus of mice in an embodiment of the present invention;

[0025] Figure 2 is a schematic diagram for exploring the optimal primer / probe concentration combination in an embodiment of the present invention;

[0026] Figure 3 is a schematic diagram for exploring the optimal annealing temperature (Tm) in an embodiment of the present invention;

[0027] Figure 4 is a linear regression curve graph in an embodiment of the present invention;

[0028] Figure 5 is a schematic diagram of the first repeat result of linear verification in an embodiment of the present invention;

[0029] Figure 6 is a schematic diagram of the second repeat result of linear verification in an embodiment of the present invention;

[0030] Figure 7 is a schematic diagram of the third repeat result of linear verification in an embodiment of the present invention;

[0031] Figure 8 is a schematic diagram of the experimental results of murine norovirus specificity in an embodiment of the present invention;

[0032] Figure 9 is a schematic diagram of the experimental results of murine hepatitis virus specificity in an embodiment of the present invention;

[0033] Figure 10 is a schematic diagram of the experimental results of murine Sendai virus specificity in an embodiment of the present invention;

[0034] Figure 11 is a schematic diagram of the experimental results of murine pneumonia virus specificity in an embodiment of the present invention;

[0035] Figure 12 is a schematic diagram of the experimental results of reovirus type III specificity in an embodiment of the present invention;

[0036] Figure 13 are the 6 repeatability verification results in an embodiment of the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0037] To enable those skilled in the art to better understand the solution of the present invention, the technical solution of the present invention will be further described in detail below in conjunction with the embodiments and drawings of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative work shall fall within the scope of protection of the present invention.

[0038] It should be noted that, without conflict, the embodiments in the present invention and the features in the embodiments can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0039] Experimental materials and equipment: Mouse minute virus samples, probe-based premix (One-Step RT-ddPCR Kit for Probes, suitable for RNA templates), restriction enzymes, plasmid templates, high-frequency enzyme digestion, 96-well plates, droplet generation cards DG32 cartridges, droplet generation oil (Probe or EveGreen type), PX1 heat sealer, Automated Droplet Generator, QX200 Droplet Reader, QuantaSoft software.

[0040] Example 1: A digital PCR detection method for mouse minute virus, as shown in the attached Figure 1 figure, includes the following steps:

[0041] Prepare the reaction system: Prepare a 22 μl probe-based quantitative reaction system, use a suitable probe-based premix, and recommend primers with a final concentration of 900 nM and a probe with a concentration of 250 nM. After mixing well by oscillation and centrifuging to remove air bubbles, ensure that the nucleic acid content of the sample is within the detection range (1 - 100,000 copy fragmented nucleic acids or 1 - 20,000 copy intact genomic DNA);

[0042] Currently, primers, probes and standard quality plasmids for the digital PCR detection method of mouse minute virus have been designed and synthesized, as shown in Table 1 below.

[0043] Table 1 Primer and probe sequences for the digital PCR detection method of mouse minute virus

[0044]

[0045] b. Prepare the sample plate: Add the prepared reaction system to a new 96-well plate, with 8 wells per column as a unit. If the sample is less than 8, supplement it with diluted control buffer. In this example, it is preferably 1×buffer control diluted by one fold; Use the PX1 heat sealer to seal the 96-well plate, and the PX1 heat sealer program is set to 180 °C for 5 seconds;

[0046] The digital PCR detection method includes three steps: droplet generation, PCR amplification, and droplet reading.

[0047] Droplet generation: Prepare a PCR amplification system (20 μl). The conventional system is shown in Table 2 below. After mixing evenly, put it into a droplet generator to generate droplets. The specific steps are as follows:

[0048] c. Use an automated droplet generator to divide the reaction system into individual droplets: Connect the power supply of the Automated Droplet Generator and perform a self-check. Turn on the power supply of the QX200 Droplet Reader and preheat for at least 30 minutes. Turn on the computer and the QuantaSoft software; Set the sample plate in the QuantaSoft software, select the corresponding well positions, and edit the reaction name; Place the droplet generation card DG32 cartridges and the pipette tips according to the instrument instructions; Put the 96-well plate containing 22 μl of the ddPCR reaction system into the designated position of the instrument; Open the special oil bottle for droplet generation, screw it onto the corresponding position of the instrument, and select the oil type in the software; Click the START icon, the instrument door will automatically close, and the droplet generation process will start; Remove the 96-well plate containing the droplets from the ice box and seal it again.

[0049] Table 2. Conventional PCR reaction system

[0050]

[0051]

[0052] PCR amplification: Transfer the generated droplets into a 96-well plate, seal it, and put it into a PCR instrument for reaction. The conventional reaction program is shown in Table 3 below. The specific steps are as follows:

[0053] d. PCR reaction: Complete the PCR reaction on any 96-well PCR instrument, noting that the heating and cooling rate ≤ 2.5 °C / s. The recommended reaction conditions are: pre-denaturation at 95 °C for 10 minutes, denaturation at 94 °C for 30 seconds, annealing at the Tm annealing temperature for 60 seconds, 40 cycles, extension at 98 °C for 10 minutes, and hold at 4 °C.

[0054] Table 3. Conventional reaction parameters

[0055]

[0056] Droplet reading: Put the well plate after the PCR reaction into a droplet reader to run, and it will be automatically analyzed after completion. The specific steps are as follows:

[0057] e. Droplet reading: Place the 96-well plate after PCR into the QX200 Droplet Reader, set the sample information in the QuantaSoft software, and then perform a Run. The results will be automatically analyzed.

[0058] Result analysis: Analyze the data of the droplet reader through the QuantaSoft software to obtain the quantitative results of minute virus of mice.

[0059] Verification examples: Verification of the optimal primer and probe concentrations, annealing temperature, specificity, repeatability, and accuracy for minute virus of mice

[0060] I. Verification of optimal primer and probe concentrations and annealing temperature

[0061] Experimental method: Set 6 groups with different primer and probe concentrations, namely 1200 nmol / L + 400 nmol / L, 1200 nmol / L + 250 nmol / L, 900 nmol / L + 400 nmol / L, 900 nmol / L + 250 nmol / L, 600 nmol / L + 400 nmol / L, 600 nmol / L + 250 nmol / L. Other reaction conditions are the same. Screen out the optimal primer and probe concentrations. The results are as follows Figure 2 shown; Set 8 annealing temperatures, namely 62.0 °C, 61.2 °C, 60.0 °C, 58.1 °C, 55.8 °C, 53.9 °C, 52.7 °C, 52.0 °C. Other reaction conditions are the same. Screen out the optimal annealing temperature. The results are as follows Figure 3 shown.

[0062] Experimental conclusion: In the digital PCR detection method for minute virus of mice (MVM), the amplification effects of each primer and probe concentration are good. The bands formed in the blue part are clearly separated from the negative droplets formed in the black part; when the annealing temperature is 55.8 °C - 52.0 °C, the fluorescence intensity of the positive droplets with bands formed in the blue part is relatively high, and they are clearly separated from the negative droplets formed in the black part, and the signal intensities are all strong. Referring to the recommended conventional reaction parameters, 900 nmol / L + 250 nmol / L is selected as the optimal primer / probe concentration, and 53.9 °C is the optimal annealing temperature.

[0063] II. Linear verification of the digital PCR detection method

[0064] In the present invention, the strongly positive reference product is gradient-diluted, and the dilution gradients are 35000 copies / test, 3500 copies / test, 350 copies / test, 35 copies / test, and 4 copies / test, a total of 5 gradients. Each dilution is repeated at least 3 times.

[0065] The present invention performs linear fitting on the detection results of 35,000 copies / detection - 35 copies / detection, and conducts linear regression analysis with the theoretical proportion of minute virus of mice as the abscissa and the actual detection proportion of minute virus of mice as the ordinate to obtain the linear regression formula y = ax + b, where the slope a of the linear regression curve should satisfy 0.95 ≤ a ≤ 1.05 and R2 ≥ 0.99. The experimental results are shown in Table 4 below and attached Figure 4 ~attached Figure 7 as shown.

[0066] In this experiment, gradient repeated tests were carried out. The comprehensive above results show that the repeated results of each gradient are good. According to the data, a = 0.9957; R2 = 1. The linear fitting is good.

[0067] Table 4. Copy number detection after gradient dilution

[0068]

[0069] III. Specificity verification of digital PCR detection method

[0070] The present invention evaluates the specificity of the established digital PCR detection system for minute virus of mice on other common virus samples, with 3 cases for each pathogen. Other pathogen samples include: murine norovirus, murine hepatitis virus, Sendai virus, murine pneumonia virus, and reovirus type III. The experimental results are shown in Table 5 below and attached Figure 8 ~attached Figure 12 as shown.

[0071] Table 5. Method specificity detection

[0072]

[0073]

[0074] In this experiment, specific tests were carried out on 5 common pathogens such as murine norovirus, murine hepatitis virus, Sendai virus, murine pneumonia virus, and reovirus type III, and the test results were all negative. The method specificity is good.

[0075] IV. Repeatability verification of digital PCR detection method

[0076] The present invention performs repeatability tests on the dilution gradient of 3,500 copies / test by gradient diluting the strongly positive reference product, and each sample is repeated at least 6 times. It is required that the detection results are positive 6 times, and the 6 test results are statistically analyzed and the coefficient of variation is analyzed, with CV ≤ 10%. The experimental results are shown in Table 6 and attached Figure 12 as shown.

[0077] Six repeated tests were conducted in this experiment, and all six repetitions were positive. Among them, 3500 copies / test, CV = 4.96%. The repeatability of the method was detected to be good.

[0078] Table 6. Verification of Method Repeatability

[0079]

[0080] The above specific embodiments are only explanations of the present invention, and they are not limitations of the present invention. After reading this specification, those skilled in the art can make modifications to these embodiments without creative contributions according to needs, but as long as they are within the scope of the claims of the present invention, they are protected by the patent law.

Claims

1. A digital PCR detection method for minute virus of mice, characterized by: The following steps are involved: Prepare the reaction system: Prepare the probe method quantitative reaction system, use the appropriate probe method premix, shake and mix, and then centrifuge to remove bubbles; Droplet generation: Use an automatic droplet generator to divide the reaction system into individual droplets; PCR amplification: transfer the generated droplets into a 96-well plate, seal the plate, and place it in a PCR instrument for reaction; Microdroplet reading: The 96-well plate that has completed PCR is placed in a microdroplet reader for reading, and the data is analyzed to obtain the quantitative results of mouse microvirus.

2. The digital PCR detection method according to claim 1, characterized in that: The recommended final concentrations of the premix are 900 nM primers and 250 nM probes.

3. The digital PCR detection method according to claim 1, characterized in that: The sequences of the primers and probes are: MVM-F: GGCTCCAGCCAAGTGACT; MVM-R:GCTCTGTAACAGTTTTCAGCACTAC; Probe: (FAM)CATGAGCCAGCTTAAC(NFQ).

4. The digital PCR detection method according to claim 1, characterized in that: The heat sealer program was set at 180°C for 5 seconds. The reaction conditions for the PCR amplification were: pre-denaturation at 95°C for 10 minutes, denaturation at 94°C for 30 seconds, annealing at 53.9°C for 60 seconds, 40 cycles, extension at 98°C for 10 minutes, and holding at 4°C.

5. The digital PCR detection method according to claim 1, characterized in that: The linear range of the method is 35000 copies / test to 4 copies / test, and the slope a of the linear regression equation satisfies 0.95≤a≤1.05, and R2≥0.

99.

6. The digital PCR detection method according to claim 1, characterized in that: The method has good specificity, and the detection results of common pathogens such as mouse norovirus, mouse hepatitis virus, mouse Sendai virus, mouse pneumonia virus, and reovirus type III are all negative.

7. The digital PCR detection method according to claim 1, characterized in that: The method has good repeatability. The repeatability test was performed on a dilution gradient of 3500 copies / test, and the coefficient of variation CV was ≤10%.

8. The digital PCR detection method according to claim 1, characterized in that: The sensitivity of the method is as low as a single copy of a nucleic acid molecule of minute virus of mice, and is suitable for detecting nucleic acid sequences with extremely low contents.

9. The digital PCR detection method according to claim 1, characterized in that: The method is suitable for rapid detection and quantification of minute virus of mice, and is particularly suitable for detection of clinical samples, research samples and environmental samples.