Detection composition, kit and method for rapidly identifying African swine fever wild strain and gene deletion vaccine strain on site

Abstract

The invention discloses a detection composition, a kit and a method for rapidly identifying an African swine fever wild strain and a gene deletion vaccine strain on site. According to the invention, a positive screening strategy is adopted, p72, eGFP and mCherry are taken as detection targets, and the reliability of a detection result is improved. The method is not limited to identification of single type of gene deletion vaccine strains, and widens the screening range of the gene deletion vaccine strains. The lowest identification detection limit of the detection method is 10 <-17 > M, and the detection method has no cross reaction with other hog cholera viruses, and shows good specificity and sensitivity. Besides, clinical sample detection verifies that the method is simple and convenient to operate, does not depend on complex instruments and equipment, can be used for fluorescent reading or visual reading, and is very suitable for quickly identifying wild strains and vaccine strains thereof on site; a scientific basis is provided for identification of vaccine strains, wild strains and vaccine strains can be effectively distinguished, and an important technical support is provided for detection, prevention and control of false vaccines.

Description

Technical Field

[0001] The present invention relates to the technical field of virus strain identification. More specifically, it relates to a detection composition, kit and method for rapidly identifying African swine fever wild strains and gene-deleted vaccine strains on-site based on a single-tube RPA-Cas12a reaction. Background Art

[0002] African swine fever is a fatal infectious disease that poses a major threat to the global pig farming industry. Currently, no effective prevention and control vaccine has been approved for marketing in China. Gene-deleted vaccine strains obtained through artificial screening and modification are potential means to control the disease. However, there are still significant controversies regarding the safety of gene-deleted vaccine strains. Due to the current lack of effective vaccines and therapeutic drugs, the illegal acquisition and use of so-called "fake vaccines" not only fail to provide effective prevention and control but may instead exacerbate the spread of the epidemic [1] , posing a huge challenge to the prevention and control of swine fever in China. Therefore, it is particularly crucial to detect African swine fever epidemic strains and vaccine strains.

[0003] Gene-deleted vaccine strains are generated through various methods such as gene editing and usually contain fluorescent marker genes such as eGFP or mCherry, etc., for verifying the success of gene editing and tracking the distribution of the virus in the host. For example, the Harbin Veterinary Research Institute (2020) developed a live African swine fever 7-gene-deleted vaccine, which deleted key virulence genes such as MGF, CD2v, 9GL, DP148r, and UK genes, and at the same time introduced eGFP and mCherry fluorescent tags [2] . Liu et al. (2023) constructed a vaccine strain with 5-gene deletions including I177L in their research and at the same time introduced eGFP and mCherry genes as screening markers [3] . The China Animal Disease Control and Prevention Center, in conjunction with the African Swine Fever Regional Laboratory (Guangzhou), issued the "Technical Guide for the Prevention and Control of African Swine Fever Virus Variant Strains in Farms" (2021) and also included p72 / eGFP / mCherry triple fluorescence in the diagnostic technical specifications (CN112646934B).

[0004] According to existing detection technologies, CN110551853B discloses a multiplex fluorescence quantitative qPCR for p72, CD2V, and MGF360 to distinguish wild strains and gene-deleted vaccine strains of African swine fever, and CN115094164A discloses a multiplex fluorescence quantitative qPCR for p72, CD2V, MGF505, and I177L to distinguish wild strains and gene-deleted vaccine strains of African swine fever; CN114015812A and CN110791591B also disclose a LAMP detection method for the CD2V and MGF360 regions to distinguish gene-deleted vaccine strains. The above methods for screening vaccine strains rely on a negative screening strategy, which identifies vaccine strains by detecting the deletion of key gene fragments such as I177L, MGF505, MGF360, and CD2v of African swine virus. Although this method has application value in preliminary screening, it has deficiencies in accuracy and reliability. The core limitations are specifically manifested as follows: (1) Negative screening can only identify one or two deletion strains in a limited manner and cannot detect vaccine strains of all gene deletion types. When deletions occur outside the detection target, other types of deletion strains will be missed; (2) The negative screening strategy relies on the deletion of specific gene fragments to identify vaccine strains, but the failure to detect the signal of the deleted gene may be due to the low content of vaccine strains in the sample, the presence of detection inhibitors, or the ineffectiveness of the detection system itself, rather than a real gene deletion. This uncertainty may lead to false positive misjudgments. In addition, CN111876527A, CN111172321B, and CN112646934B also disclose a multiplex fluorescence quantitative qPCR for gene-deleted vaccine strains by a positive screening strategy, targeting the fluorescent markers (such as eGFP or mCherry) introduced into the vaccine strains. However, the qPCR method has problems such as complex operation, time-consuming detection, and high equipment requirements, making it difficult to meet the needs of rapid on-site detection. Therefore, developing a rapid and accurate on-site detection method to distinguish wild strains and vaccine strains is crucial for the effective prevention and control of African swine fever and vaccine strains.

[0005] CN110106290B discloses a simple and efficient POCT detection method; CN220183277U discloses a portable on-site detection device based on a single-tube RPA-Cas12a detection reaction. On this basis, a positive screening strategy is adopted to directly detect the reporter genes (such as eGFP or mCherry) introduced into the vaccine strains and combine the p72 nucleic acid detection results to more directly and accurately identify gene-deleted vaccine strains through positive screening.

[0006] References:

[0007] [1] China Animal Health and Epidemiology Center, Volume 40, Issue 6, 2023, Progress in Clinical Research on Gene-Deleted Attenuated Live Vaccines for African Swine Fever in Vietnam.

[0008] [2] Chen, Weiye, et al. "A seven-gene-deleted African swine fever virus is safe and effective as a live attenuated vaccine in pigs." Science China Life Sciences 63(2020):623-634.

[0009] [3] Liu, Yingnan, et al. "Evaluation of an I177L gene-based five-gene-deleted African swine fever virus as a live attenuated vaccine in pigs." Emerging Microbes & Infections 12.1(2023):2148560. Summary of the Invention

[0010] In order to obtain a detection method that is suitable for on-site operation of classical swine fever quarantine and can quickly and efficiently identify or detect African swine fever vaccine strains and their vaccine strains. The present invention provides a detection composition, kit and method for quickly identifying African swine fever wild strains and gene-deleted vaccine strains on-site based on a single-tube RPA-Cas12a reaction.

[0011] The object of the present invention is achieved by the following technical solutions:

[0012] In the first aspect, the present invention provides a detection composition for quickly identifying African swine fever wild strains and gene-deleted vaccine strains on-site based on a single-tube RPA-Cas12a reaction, adopting the following technical solution:

[0013] A detection composition for quickly identifying African swine fever vaccine strains and gene-deleted vaccine strains on-site by RPA-Cas12, the detection composition is 3 pairs of detection compositions consisting of the following crRNA and RPA primer pairs:

[0014] (1) Detection composition 1 consisting of crRNA and RPA primer pairs designed for the p72 gene, wherein:

[0015] The nucleotide sequence of crRNA is: TAATTTCTACTAAGTGTAGATCATCGGTAAGAATAGGTT (SEQ ID No.1);

[0016] The described RPA primer pair consists of an RPA upstream primer and an RPA downstream primer, where:

[0017] The nucleotide sequence of the RPA upstream primer is:

[0018] ACATTCATGATTTGCACAAGCCGCACCAAAGCA (SEQ ID No.2);

[0019] The nucleotide sequence of the RPA downstream primer is:

[0020] TGAACATTACGTCTTATGTCCAGATACGTTG (SEQ ID No.3);

[0021] (2) Detection composition 2 consisting of crRNA designed for the inserted gene eGFP of the vaccine strain and the RPA primer pair, where:

[0022] The nucleotide sequence of the crRNA is: TAATTTCTACTAAGTGTAGATAGATCCGCCACAACATCGAG (SEQ ID No.4);

[0023] The described RPA primer pair consists of an RPA upstream primer and an RPA downstream primer, where:

[0024] The nucleotide sequence of the RPA upstream primer is:

[0025] CAACTACAACAGCCACAACGTCTATATCAT (SEQ ID No.5);

[0026] The nucleotide sequence of the RPA downstream primer is:

[0027] ATCGCGCTTCTCGTTGGGGTCTTTGCTCAG (SEQ ID No.6);

[0028] (3) Detection composition 3 consisting of crRNA designed for the inserted gene mCherry of the vaccine strain and the RPA primer pair, where:

[0029] The nucleotide sequence of the crRNA is: TAATTTCTACTAAGTGTAGATGGGAGGTGATGTCCAACTTG (SEQ ID No.7);

[0030] The described RPA primer pair consists of an RPA upstream primer and an RPA downstream primer, where:

[0031] The nucleotide sequence of the RPA upstream primer is:

[0032] GTAATGCAGAAGAAGACCATGGGCTGGGAG (SEQ ID No.8);

[0033] The nucleotide sequence of the downstream primer of RPA is:

[0034] GCGTTCGTACTGTTCCACGATGGTGTAGTC (SEQ ID No.9).

[0035] Furthermore, the detection composition includes crRNAs and RPA primer pairs targeting 3 target genes. The RPA (Recombinase Polymerase Amplification) primers are used to identify and amplify the target gene sequences under isothermal conditions; the crRNAs are used to specifically identify and bind to the target gene sequences for detection.

[0036] Furthermore, the crRNA also contains a structural sequence (scaffold sequence) that binds to the Cas12a protein and a targeting fragment targeting the gene to be detected. The nucleotide sequence of the structural sequence of the Cas12a protein-binding structural sequence (scaffold sequence) is the 1-21bp of SEQ ID No.1, SEQ ID No.4, or SEQ ID No.7; the nucleotide sequences of the structural sequences of the targeting fragments targeting the genes to be detected are the 22-39bp of SEQ ID No.1, the 22-41bp of SEQ ID No.4, and the 22-41bp of SEQ ID No.7, respectively.

[0037] Furthermore, the crRNA is obtained by in vitro transcription or chemical synthesis in the laboratory.

[0038] In a second aspect, the present invention provides an application of the above detection composition in the preparation of products for differentiating African swine fever wild strains from gene-deleted vaccine strains.

[0039] Furthermore, the products include test kits and the like.

[0040] In a third aspect, the present invention provides a single-tube RPA-Cas12a detection kit for differentiating African swine fever wild strains from gene-deleted vaccine strains, adopting the following technical solution:

[0041] A single-tube RPA-Cas12a detection kit for differentiating African swine fever wild strains from gene-deleted vaccine strains, the kit includes: a detection composition, an African swine fever virus plasmid standard, a gene-deleted vaccine strain plasmid standard, and a negative standard;

[0042] Furthermore, the kit further includes RPA reagents, Reaction Buffer, Cas12a protein, RNase inhibitor, and ssDNA Reporter for isothermal amplification. These components provide enzyme proteins, salt ion concentrations, and fluorescent probes for the reaction for detection or reaction.

[0043] Furthermore, the kit further includes a nucleic acid extraction kit, etc.

[0044] Furthermore, the RPA reagent further includes RPA enzyme, Rehydration Buffer, and magnesium acetate.

[0045] Furthermore, the Reaction Buffer is a reaction buffer adapted to the Cas12a protein in the commercial Cas12a reagent; the Cas12a protein is selected from one of the following commercial reagents: (1) Tolo Harbour LbCas12a (product number 32108); (2) LbCas12a (product number M0653S); (3) Aidy Gene LbCas12a (product number EDE0005-100).

[0046] Furthermore, the RPA reagent is selected from one of the following commercial isothermal amplification reagents: (1) AmpSure Future Basic Isothermal Amplification Kit (product number WLB8201KIT); (2) KEL Life RAA4.0 (basic type) (product number 901111042).

[0047] Furthermore: The RNase inhibitor is selected from Takara recombinant RNase inhibitor (product number 2313A).

[0048] Furthermore, the ssDNA reporter is selected from one of the following general probes: (1) FQ1: 5' 6-FAM-CCCCC-3' BHQ1; (2) FQ2: 5' 6-FAM-TTATT-3' BHQ1.

[0049] Fourthly, the present invention provides a detection method for differentiating African swine fever wild strains from gene-deleted vaccine strains based on a single-tube RPA-Cas12a reaction. This method is for non-diagnostic or therapeutic purposes and includes the following steps:

[0050] S1. Collect a target sample from the pig to be tested, and obtain a viral nucleic acid sample from the target sample;

[0051] S2. Using the viral nucleic acid sample as a template, perform a single-tube differential detection reaction on the nucleic acid sample using the above detection composition;

[0052] S3. Read the result of the reaction system after the detection reaction in a fluorescence detection system to achieve rapid identification of wild-type African swine fever virus and gene-deleted vaccine strains.

[0053] Further, the target samples described in step S1 include but are not limited to blood, tissue, saliva swabs, or other biological materials, etc. The methods for obtaining virus nucleic acid samples from the target samples include but are not limited to rapid nucleic acid lysis method, column method, and magnetic bead extraction method.

[0054] Further, the virus nucleic acid sample described in step S1 is: viral genomic DNA obtained by extraction or lysis of the target sample in a nucleic acid-free contamination environment.

[0055] More specifically, the reaction system of the single-tube differential detection reaction described in step S2 includes: in a 25 μL reaction system, RPA enzyme, Cas12a protein (25 - 200 nM, further 100 nM), Reaction Buffer (1×), Rehydration Buffer (10 μL), RNase inhibitor (1 U / μL), RPA primer pair (each primer 200 - 300 nM, further 240 nM), crRNA (25 - 200 nM, further 200 nM), ssDNA Reporter (500 - 1000 nM, further 800 nM), magnesium acetate (14 mM - 28 mM), 2 μL of template nucleic acid, and add enzyme-free water to make up to 25 μL.

[0056] More specifically, the single-tube differential detection reaction described in step S2 is a single-tube integrated detection system: the RPA primer pair is pre-incubated with RPA enzyme and Rehydration Buffer for 10 min and then added to the PCR reaction tube; the Cas12a protein is pre-incubated with crRNA, RNase inhibitor, and Reaction Buffer for 20 min and then added to the PCR reaction tube; the template nucleic acid and magnesium acetate are finally added to the detection PCR reaction tube for reaction.

[0057] Further, the differential detection reaction described in step S2 includes the following three groups of reactions: a single-tube RPA-Cas12a detection reaction constructed with detection composition 1, a single-tube RPA-Cas12a detection reaction constructed with detection composition 2; a single-tube RPA-Cas12a detection reaction constructed with detection composition 3.

[0058] Further, the reaction conditions of the detection reaction described in step S2 are: react at 37°C - 42°C for 40 min - 60 min.

[0059] Preferably, the reaction conditions are to react at 37°C for 40 min.

[0060] Further, the fluorescence detection system described in step s3 includes, but is not limited to, an enzyme-labeled instrument, a QPCR instrument, an LED blue light exposure instrument, and a portable visualization device.

[0061] Preferably, the fluorescence detection system is a portable visualization device.

[0062] Preferably, the portable visualization device is the on-site portable detection device disclosed in CN220183277U.

[0063] Further, the judgment basis for the rapid identification of wild-type African swine fever virus and gene-deleted vaccine strains in step s3 is as follows: (1) If the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 1 is positive, the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 2 is positive, and the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 3 is negative, then the sample is an African swine fever vaccine strain containing eGFP insertion; (2) If the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 1 is positive, the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 2 is negative, and the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 3 is positive, then the sample is an African swine fever vaccine strain containing mCherry insertion; (3) If the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 1 is positive, the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 2 is negative, and the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 3 is negative, then the sample is a wild strain of African swine fever; (4) If the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 1 is negative, the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 2 is negative, and the detection result of the single-tube RPA-Cas12a detection reaction constructed with detection composition 3 is negative, then the sample does not contain a wild strain or vaccine strain of African swine fever.

[0064] The present invention has the following advantages and effects compared with the prior art:

[0065] 1. The present invention establishes a detection method for rapid on-site identification of African swine fever wild strains and gene-deleted vaccine strains based on a single-tube RPA-Cas12a reaction. This method adopts a positive screening strategy. By selecting p72 as the target for wild strains and eGFP or mCherry as the specific targets for gene-deleted vaccine strains, it avoids the false positive or false negative misjudgment problems common in traditional negative screening methods and improves the reliability of the detection results. Compared with the prior art, this method is not limited to identifying a single type of gene-deleted vaccine strain and broadens the screening range of gene-deleted vaccine strains.

[0066] 2. The present invention provides a method for rapid on-site identification of African swine fever wild strains and gene-deleted vaccine strains based on a single-tube RPA-Cas12a reaction. The minimum discrimination detection limit of this detection method is 10 -17 M (about 10 copies / reaction), and there is no cross-reaction with other swine fever viruses, showing good specificity and sensitivity. In addition, verified by the detection of clinical samples, this method is easy to operate, does not rely on complex instruments and equipment, and the detection method can be used for fluorescence reading or visual reading, and is very suitable for rapid on-site identification of African swine fever wild strains and their vaccine strains. This detection method provides technical support for the identification of vaccine strains and has guiding significance for the prevention and control of fake vaccines. This detection method provides a scientific basis for the identification of vaccine strains, can effectively distinguish wild strains and gene-deleted vaccine strains, and provides important technical support for the detection and prevention and control of fake vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 is the validation diagram of the effectiveness of p72 crRNA (a) and the validation diagram of the effectiveness of RPA primers (b); among them, p72crRNA in a refers to p72-cr1.

[0068] Figure 2 is the validation diagram of the effectiveness of eGFP and mCherry crRNA.

[0069] Figure 3 is the validation diagram of the effectiveness of eGFP and mCherry RPA primers.

[0070] Figure 4 is the effectiveness screening diagram of the detection composition; among them, NTC: negative control.

[0071] Figure 5 is the detection sensitivity diagram based on a single-tube RPA-Cas12a reaction; among them, NTC: negative control.

[0072] Figure 6 is the fluorescence visualization diagram of the detection sensitivity based on a single-tube RPA-Cas12a reaction; among them, NTC: negative control.

[0073] Figure 7 It is a specific detection diagram based on a single-tube RPA-Cas12a reaction; among them, PFF represents the genome of porcine fibroblasts; NTC: negative control.

[0074] Figure 8 It is a diagram of detecting African swine fever virus samples using the detection composition in the present invention.

[0075] Figure 9 It is a diagram of the detection results of clinical samples by using a triple fluorescence qPCR detection kit (left) and a discrimination method based on the single-tube RPA-Cas12a reaction established in the present invention (right). Specific implementation mode

[0076] The present invention will be further described in detail below in conjunction with embodiments and drawings, but the implementation modes of the present invention are not limited thereto.

[0077] Unless otherwise specified, the technical methods adopted in the following embodiments are all general techniques in the art, and all equipment and raw materials, etc. are common products in this industry and can be purchased from the market.

[0078] The nucleic acid sequence of the p72 gene adopted in the following embodiments is shown as the 97807-99747bp in GenBank: MW723500.1; the nucleic acid sequence of the eGFP gene adopted is shown as the 1-717bp in GenBank: MS936674.1; the nucleic acid sequence of the mCherry gene adopted is shown as the 1-711bp in GenBank: AY678264.1; the GenBank accession number of the reference genome sequence of domestic pigs is GCA_000003025.6; other porcine viruses and their reference genome sequences adopted include foot-and-mouth disease virus (GCF_002816555.1), porcine pseudorabies virus (GCF_008791805.1), porcine circovirus type 2 (GCF_002819625.1), classical swine fever virus (GCF_000864685.1), transmissible gastroenteritis virus of swine (GCF_002985995.1), porcine reproductive and respiratory syndrome virus (GCF_000862745.1), porcine rotavirus (GCA_003155635.1), porcine epidemic diarrhea virus (LM645057.1); the GenBank accession number of the reference genome sequence of African swine fever wild strains adopted is MK333180.1.

[0079] The isothermal amplification reagent adopted in the following embodiments is the Ampfuture basic isothermal amplification kit, with the product number WLB8201KIT.

[0080] The Cas12a protein adopted in the following embodiments is LbCas12a, catalog number M0653S.

[0081] The RNase inhibitor used in the following examples is Takara recombinant RNase inhibitor, catalog number 2313A.

[0082] The reporter single-stranded DNA molecule used in the following examples is: 5' 6-FAM-TTATT-3' BHQ1.

[0083] The experiments in the following examples were all set with three replicates without special instructions.

[0084] The NTC in the following examples represents the negative control group without special instructions.

[0085] The following examples used GraphPad Prism statistical software to process the data. The experimental results were expressed as mean ± standard deviation. Unpaired t-test was used, P < 0.0001 (****), and ns indicates P > 0.05 with no significant difference.

[0086] Example 1

[0087] 1. Nucleic acid samples of strains

[0088] Nucleic acid samples of sample strains such as African swine fever wild strain (ASFV), foot-and-mouth disease virus (FMDV), porcine pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), transmissible gastroenteritis virus of swine (TGEV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine rotavirus (PoRV), Japanese encephalitis virus of swine (JEV), bovine coronavirus (BCV), Seneca virus A of swine (SVA), porcine circovirus (PCV), etc. are stored in the laboratory of the present inventors.

[0089] 2. Preparation of plasmid standards

[0090] 2.1 Obtaining plasmid standards

[0091] According to the location of the designed detection composition, the target gene segments (p72, eGFP, mCherry) containing the detection composition were selected and commissioned to a company for synthesis and cloning onto pUC57 or pBR vector or pUC-GW-Amp vector. The standard of the African swine fever wild strain among them is the pUC57-p72 plasmid; the standards of the African swine fever gene-deleted vaccine strains among them are pBR332-eGFP and pUC-mCherry. The obtained plasmid dry powder was dissolved in a fume hood and transformed into Escherichia coli DH5α competent cells. Positive clone strains were screened using ampicillin resistance and expanded in culture, and the plasmids were extracted and sent for sequencing. The positive plasmids with correct sequencing sequences were stored in the laboratory refrigerator at -20°C.

[0092] 2.2 Dilution of plasmid standards

[0093] Before diluting the plasmid standards, their concentrations and qualities were detected by an ultraviolet spectrophotometer to ensure the accuracy of the experiment. The entire dilution operation was carried out in a fume hood to prevent nucleic acid contamination. First, the dilution ratio was calculated according to the required working concentration, and the plasmid was diluted to a mother liquor with a higher concentration, such as 10 -8 M, using sterile and enzyme-free water. The diluted mother liquor should be aliquoted into sterile centrifuge tubes, labeled with the dilution ratio and the final concentration, and then stored in a -20°C refrigerator. Before subsequent experiments, the plasmid mother liquor was taken out of the refrigerator and serially diluted to the required working concentration. Finally, ensure that the diluted plasmid standards are used as soon as possible or properly stored to reduce the possibility of degradation.

[0094] 3. Design of the detection composition

[0095] 3.1 Design of the p72 detection composition

[0096] In this study, all ASFV strain genomic sequences, the reference genomic sequence of domestic pigs, and the reference genomic sequences of other swine viruses were downloaded from NCBI for sequence alignment, homology analysis, and specificity analysis. A large number of experiments showed that different crRNAs and primer pairs have a certain impact on the effect and sensitivity of the single-tube RPA-Cas12a detection method. Therefore, in this study, 2 crRNAs and 3 pairs of RPA primers were explored for the p72 gene, and the nucleotide sequences are shown in Table 1.

[0097] Table 1 Design of the p72 detection composition

[0098] Name Sequence 5'-3' SEQ ID No. p72-cr1 TAATTTCTACTAAGTGTAGATCATCGGTAAGAATAGGTT 1 p72-cr2 TAATTTCTACTAAGTGTAGATAGGATAGAGATACAGCTC 10 p72-R1 TGAACATTACGTCTTATGTCCAGATACGTTG 3 p72-F1 ACATTCATGATTTGCACAAGCCGCACCAAAGCA 2 p72-F2 CTCCTATGCAACATTCATGATTTGCACAAGCCG 11 p72-F3 AGTGGCCCTCTCCTATGCAACATTCATGATTTG 12

[0099] 3.2 Design of the eGFP detection composition and mCherry

[0100] Referring to the nucleic acid sequence information of the African swine fever gene-deleted vaccine strains published on GenBank (MZ566623.1, OR944091.1, OR944090.1, OR944089.1, OR944088.1, OR944087.1, OR944086.1, OR944085.1, PP353636.1, PP355087.1, PP505822.1, PP213439.1, PP213440.1, PP213441.1, PQ323358.1, OQ885056.1, OQ885055.1, MW701371.1, OR806652.1, etc.), the inserted fluorescent marker genes eGFP and mCherry in the gene-deleted vaccine strains were used as the detection targets for the African swine fever gene-deleted vaccine strains, and the African swine fever wild strain reference genome, domestic pig reference genome, and other pig virus reference genomes were downloaded as background genomes. The eGFP and mCherry genes were respectively aligned with the background genomes for sequence alignment, homology analysis, and specificity analysis to design several crRNAs and several pairs of RPA primers. The nucleotide sequences of the crRNAs and RPA primers explored in this study for the eGFP and mCherry genes are shown in Table 2.

[0101] Table 2 Design of eGFP detection composition and mCherry

[0102] Name Sequence 5'-3' SEQ ID No. eGFP-cr1 TAATTTCTACTAAGTGTAGATTCAAGTCCGCCATGCCCGAA 13 eGFP-cr2 TAATTTCTACTAAGTGTAGATAGATCCGCCACAACATCGAG 4 eGFP-cr3 TAATTTCTACTAAGTGTAGATAGCCGCTACCCCGACCACAT 14 mCherry-cr1 TAATTTCTACTAAGTGTAGATAGCGCATGAACTCCTTGATG 15 mCherry-cr2 TAATTTCTACTAAGTGTAGATGAGCCGTACATGAACTGAG 16 mCherry-cr3 TAATTTCTACTAAGTGTAGATGGGAGGTGATGTCCAACTTG 7 eGFP-F1 CAACTACAACAGCCACAACGTCTATATCAT 5 eGFP-R1 ATCGCGCTTCTCGTTGGGGTCTTTGCTCAG 6 eGFP-R2 GACCATGTGATCGCGCTTCTCGTTGGGGTC 17 eGFP-R3 CTTGTACAGCTCGTCCATGCCGAGAGTGA 18 mCherry_F1 GGTGAGCAAGGGCGAGGAGGATAACATGGC 19 mCherry_R1 CGTAGGCCTTGGAGCCGTACATGAACTGAG 20 mCherry_F2 CAAGGAGTTCATGCGCTTCAAGGTGCACAT 21 mCherry_R2 GGGGATGTCGGCGGGGTGCTTCACGTAG 22 mCherry_R3 GGAAGGACAGCTTCAAGTAGTCGGGGATGT 23 mCherry_F3 CCCCGTAATGCAGAAGAAGACCATGGGCTG 24 mCherry_F4 GTAATGCAGAAGAAGACCATGGGCTGGGAG 8 mCherry_R4 GCGTTCGTACTGTTCCACGATGGTGTAGTC 9

[0103] 4. Verification and screening of detection compositions for differentiating African swine fever wild strains from gene-deleted vaccine strains

[0104] In this experiment, multiple crRNAs were designed, optimized, and screened within the target sequence. Using a 10 -9 M (about 100,000 copies) plasmid standard as a positive control and water treated with DEPC and free of impurities (RNA, DNA, and protein) as a negative control, the cleavage activity of crRNAs on the target sequence was explored through the CRISPR reaction, and finally, the crRNAs suitable for the RPA-Cas12 single-tube RPA-Cas12a detection reaction were screened. The specific operations are as follows:

[0105] 4.1 In vitro transcription of crRNA

[0106] The crRNA transcription reaction was 20 μL: 1.5 μL of each NTP, 1.5 μL of 10×Reaction buffer, 1 μg of Template DNA, and 1.5 μL of T7 RNA Polymerase Mix.

[0107] The reaction conditions were: reacting at 37°C for 16 hours.

[0108] After the reaction, purification was carried out using an RNA column purification kit, and crRNA was obtained by eluting with DEPC water.

[0109] 4.2 Screening and verification of crRNA

[0110] The CRISPR reaction system was 25 μL: 100 nM LbaCas12a (NEB), 200 nM crRNA, 800 nM reporter single-stranded DNA molecule, 1 U RNase inhibitor (Takara), 2 μL of treated nucleic acid sample, 1×Reaction Buffer.

[0111] The reaction conditions were: reacting at 37 °C for 1 hour.

[0112] The reaction result was: The cleavage activity of the crRNA in Tables 1 - 2 above was detected and screened using a Thermo Fisher QuantStudio 1 fluorescence detector. Finally, the crRNA suitable for the RPA-Cas12 single-tube RPA-Cas12a detection reaction was screened out. The screening results were as Figure 1 a, Figure 2 shown, where the ordinate in the figure is the fluorescence signal intensity.

[0113] 4.3 Screening and verification of RPA primer pairs

[0114] In this experiment, multiple pairs of RPA primer pairs were designed within the target sequence for optimization and screening. Using 10 -13 M plasmid standard as a positive control, and at the same time using water treated with DEPC and free of impurities (RNA, DNA, and protein) as a negative control, the amplification efficiency of the primer pairs was explored through RPA amplification reaction. Finally, the primer pairs suitable for the RPA-Cas12 single-tube RPA-Cas12a detection reaction were screened out. The specific operations were as follows:

[0115] The RPA reaction system was 25 μL: 400 nM RPA upstream primer, 400 nM RPA downstream primer, RPA reagent (one tube of freeze-dried powder (Anpu Future WLB8201KIT), RPA resuspension, and magnesium acetate).

[0116] The reaction conditions were: reacting at 37 °C for 30 min.

[0117] The amplification products were purified and recovered, and the RPA primers suitable for the RPA-Cas12 single-tube RPA-Cas12a detection reaction were screened according to the electrophoresis bands of the recovered products. The effectiveness results of the selected primer pairs were as Figure 1 b, Figure 3 shown.

[0118] 4.4 Validation of the effectiveness of the detection composition based on the single-tube RPA-Cas12a detection reaction system

[0119] In this experiment, the RPA primers and crRNAs in Table 2 were combined. A plasmid standard was used as the positive control, and water treated with DEPC and free of impurities (RNA, DNA, and protein) was used as the negative control. Whether the detection composition was effective was explored based on the end-point fluorescence value of the single-tube RPA-Cas12a detection reaction. The specific operations were as follows:

[0120] The single-tube RPA-Cas12a detection reaction system was 25 μL: 240 nM RPA upstream primer, 240 nM RPA downstream primer, RPA reagent (lyophilized powder (Anpu Future WLB8201KIT), RPA resuspension, and magnesium acetate), 100 nM LbaCas12a (NEB), 200 nM crRNA, 800 nM reporter single-stranded DNA molecule, 1 U RNase inhibitor (Takara), 2 μL nucleic acid sample, 1×Reaction Buffer.

[0121] The reaction conditions were: reaction at 37 °C for 40 min to 60 min.

[0122] The reaction results were: The end-point fluorescence signal of the reaction was detected using a Thermo Fisher QuantStudio 1 fluorescence detector. The vertical axis in the figure was the fluorescence gray value. The effectiveness results of the single-tube RPA-Cas12a detection method system after the combination of the selected primer pairs and crRNAs were as Figure 4 shown.

[0123] Among them, the fluorescence gray value was obtained by extracting the green channel intensity value from the fluorescence image using ImageJ. Under the excitation light of 492 nm, the emission wavelength of FAM was 520 nm, and its fluorescence was mainly concentrated in the green channel of the image. Therefore, the gray value of the green channel directly reflected the intensity of FAM fluorescence.

[0124] Generally speaking, p72-cr1 (SEQ ID No.1) and p72-F1 / R1 (SEQ ID No.2-3), eGFP-cr2 (SEQ ID No.4) and eGFP-F1 / R1 (SEQ ID No.5-6), mCherry-cr3 (SEQ ID No.7) and mCherry_F4 / R4 (SEQ ID No.8-9) all had good effects and were used for subsequent performance evaluation.

[0125] Example 2: Performance evaluation of the detection method

[0126] 1. Sensitivity test

[0127] In this experiment, the combination of crRNA and RPA primer pairs obtained in Example 1 (SEQ ID No. 1-9) was selected to test the sensitivity of the established single-tube RPA-Cas12a reaction for differentiating African swine fever wild strains from gene-deleted vaccine strains. Using the positive plasmid constructed in the laboratory as a reference standard, 10 -11 M, 10 -13 M, 10 -14 M, 10 -15 M, 10 -16 M, 10 -17 M plasmid standards were detected. The fluorescence detection results using Thermo Fisher QuantStudio 1 are as Figure 5 shown, and the detection results using the portable blue light detection system are as Figure 6 shown. The results show that the detection sensitivity of the single-tube RPA-Cas12a for the p72 gene is 10 -16 M, the detection sensitivity of the single-tube RPA-Cas12a for eGFP is 10 -17 M, and the detection sensitivity of the single-tube RPA-Cas12a for mCherry is 10 -16 M.

[0128] 2. Specificity test

[0129] In this example, the reaction specificities of the detection method for African swine fever wild strains and gene-deleted vaccine strains with foot-and-mouth disease virus (FMDV), porcine pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine circovirus type 2 (PCV2), classical swine fever virus (CSFV), transmissible gastroenteritis virus of swine (TGEV), porcine reproductive and respiratory syndrome virus (PRRSV), porcine rotavirus (PoRV), Japanese encephalitis virus of swine (JEV), bovine coronavirus (BCV), Seneca virus A of swine (SVA), and porcine circovirus (PCV) were verified. Using the plasmid standard (10 -15 M) as a positive control, and at the same time using water treated with DEPC and free of impurities (RNA, DNA, and protein) as a negative control. The results are as Figure 7 shown. The results show that the single-tube RPA-Cas12a detection reaction established by the method of the present invention has no cross-reaction with the above viruses and has good specificity.

[0130] Example 3: Detection of clinical samples

[0131] In this example, the detection methodology established in Example 1 was utilized. A plasmid standard was used as a positive control, and water treated with DEPC and free of impurities (RNA, DNA, and proteins) was used as a negative control. The effectiveness of the detection composition was explored based on the end-point fluorescence value of the single-tube RPA-Cas12a detection reaction. When specifically performing sample detection, the following operations were carried out:

[0132] s1. Collect relevant samples (such as blood, tissues, or other biological materials) from the pigs to be tested, and obtain viral nucleic acid samples from the samples;

[0133] s2. Using the viral nucleic acid sample as a template, three pairs of detection compositions obtained in Example 1 were used to perform a single-tube discrimination detection reaction and an ASFV triple fluorescence quantitative PCR reaction on the nucleic acid sample. Among them, the ASFV triple fluorescence quantitative PCR reaction was carried out using an African swine fever virus VP72 / CD2V / MGF gene triple fluorescence PCR kit (model FZQ010T, purchased from Beijing Yisenbao Biotechnology Co., Ltd.);

[0134] s3. After the detection reaction was completed, the reaction system was read in a portable blue light detection system to achieve rapid discrimination between wild-type African swine fever virus and gene-deleted vaccine strains.

[0135] s4. Perform a PCR amplification reaction on the original nucleic acid sample of the African swine fever gene-deleted vaccine strain identified in step s3 to obtain an amplification product. Use Sanger sequencing technology to analyze the DNA sequence of the PCR amplification product to obtain complete DNA sequence information, and complete the further identification of the genotype of the African swine fever gene-deleted vaccine strain.

[0136] The single-tube RPA-Cas12a detection reaction system was 25 μL: 240 nM RPA upstream primer, 240 nM RPA downstream primer, RPA reagent (lyophilized powder (Anpu Future WLB8201KIT), RPA resuspension solution, and magnesium acetate), 100 nM LbaCas12a (NEB), 200 nM crRNA, 800 nM reporter single-stranded DNA molecule, 1 U RNase inhibitor (Takara), 2 μL nucleic acid sample, 1×Reaction Buffer;

[0137] The reaction conditions were: reaction at 37°C for 40 min to 60 min.

[0138] The reaction results were: The detection results of the triple fluorescence quantitative PCR reaction were as shown in Table 3 and Figure 9 as follows. The fluorescence signal at the end of the reaction was detected using a portable blue light detection system. The sample detection results for the p72 gene, eGFP gene, and mCherry gene were as Figures 8 - 9 shown in Table 4. Tables 3 - 4 andFigure 9 The results showed that the detection results were completely consistent with those of the ASFV triple fluorescence quantitative PCR, and the sequencing results showed that the PCR amplification product of S2 was an ASFV homologous fragment with the eGFP gene inserted and the MGF gene deleted. In summary, 4 African swine fever virus samples and 1 gene-deleted vaccine sample with eGFP inserted were detected.

[0139] Table 3. Detection results (CT values) of the ASFV triple fluorescence quantitative PCR reaction

[0140]

[0141] Table 4. Fluorescence gray scale values (VoG) of the differential detection reaction of the detection method established in the present invention

[0142]

[0143] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.

Claims

1. A detection composition for rapid on-site identification of African swine fever wild strains and gene-deficient vaccine strains based on a single-tube RPA-Cas12a reaction, characterized in that: The detection composition includes detection composition 1, detection composition 2 and detection composition 3, wherein: (1) A detection composition 1 consisting of a crRNA and an RPA primer pair designed for the p72 gene, wherein: The nucleotide sequence of crRNA is: TAATTTCTACTAAGTGTAGATCATCGGTAAGAATAGGTT, SEQ ID No. 1; The RPA primer pair consists of an RPA upstream primer and an RPA downstream primer, wherein: The nucleotide sequence of the RPA upstream primer is: ACATTCATGATTTGCACAAGCCGCACCAAAGCA, SEQ ID No. 2; The nucleotide sequence of the RPA downstream primer is: TGAACATTACGTCTTATGTCCAGATACGTTG, SEQ ID No. 3; (2) A detection composition 2 consisting of a crRNA and an RPA primer pair designed for the vaccine strain insertion gene eGFP, wherein: The nucleotide sequence of crRNA is: TAATTTCTACTAAGTGTAGATAGATCCGCCACAACATCGAG, SEQ ID No. 4; The RPA primer pair consists of an RPA upstream primer and an RPA downstream primer, wherein: The nucleotide sequence of the RPA upstream primer is: CAACTACAACAGCCACAACGTCTATATCAT, SEQ ID No.5; The nucleotide sequence of the RPA downstream primer is: ATCGCGCTTCTCGTTGGGGTCTTTGCTCAG, SEQ ID No. 6; (3) A detection composition 3 consisting of a crRNA and an RPA primer pair designed for the vaccine strain insertion gene mCherry, wherein: The nucleotide sequence of crRNA is: TAATTTCTACTAAGTGTAGATGGGAGGTGATGTCCAACTT G, SEQ ID No. 7; The RPA primer pair consists of an RPA upstream primer and an RPA downstream primer, wherein: The nucleotide sequence of the RPA upstream primer is: GTAATGCAGAAGAAGACCATGGGCTGGGAG, SEQ ID No.8; The nucleotide sequence of the RPA downstream primer is: GCGTTCGTACTGTTCCACGATGGTGTAGTC, SEQ ID No.

9.

2. Use of the detection composition described in claim 1 in the preparation of products for distinguishing African swine fever wild strains and gene-deficient vaccine strains.

3. A single-tube RPA-Cas12a detection kit for identifying African swine fever wild strains and gene-deficient vaccine strains, characterized in that: The kit comprises the detection composition according to claim 1.

4. The single-tube RPA-Cas12a detection kit according to claim 3, characterized in that: The kit also includes African swine fever virus plasmid standards, deleted vaccine strain plasmid standards and negative standards.

5. The single-tube RPA-Cas12a detection kit according to claim 3 or 4, characterized in that: The kit also includes RPA reagent, Reaction Buffer, Cas12a protein, RNase inhibitor, and ssDNAReporter for isothermal amplification.

6. The single-tube RPA-Cas12a detection kit according to claim 5, characterized in that: The ssDNA reporter is selected from one of the following universal probes: 1) FQ1: 5'6-FAM-CCCCC-3'BHQ1; 2) FQ2: 5'6-FAM-TTATT-3'BHQ1.

7. A detection method for identifying African swine fever wild strains and gene-deficient vaccine strains based on a single-tube RPA-Cas12a reaction, characterized in that: The method is for non-diagnostic or therapeutic purposes and comprises the following steps: s1. Collect target samples from the pig to be tested, and obtain viral nucleic acid samples from the target samples; s2. Using the viral nucleic acid sample as a template, the detection composition according to claim 1 is used to perform a single-tube identification detection reaction on the nucleic acid sample; s3. After the detection reaction is completed, the reaction system is read in the fluorescence detection system to achieve rapid identification of wild-type African swine fever virus and gene-deficient vaccine strains.

8. The detection method according to claim 7, characterized in that: The target sample described in step s1 includes but is not limited to blood, tissue or saliva swab; The reaction system of the single-tube identification detection reaction described in step s2 includes: RPA enzyme, 25-200nM Cas12a protein, 1× Reaction Buffer, 10μL Rehydration Buffer, 1U / μL RNase inhibitor, 200-300nM concentration of each primer in the RPA primer pair, 25-200nM crRNA, 500-1000nM ssDNA Reporter, 14mM-28mM magnesium acetate, 2μL template nucleic acid, and enzyme-free water is added to 25μL in a 25μL reaction system; The identification detection reaction described in step s2 includes the following three groups of reactions: a single-tube RPA-Cas12a detection reaction constructed using detection composition 1, a single-tube RPA-Cas12a detection reaction constructed using detection composition 2; and a single-tube RPA-Cas12a detection reaction constructed using detection composition 3.

9. The detection method according to claim 7, characterized in that: The reaction conditions of the detection reaction described in step s2 are: reaction at 37°C to 42°C for 40min to 60min, and further reaction at 37°C for 40min.

10. The detection method according to claim 7, characterized in that: The judgment basis for the rapid identification of wild-type African swine fever virus and gene-deficient vaccine strain described in step s3 is the following four situations: (1) The detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 1 is positive, the detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 2 is positive, and the detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 3 is negative, then the sample is an African swine fever vaccine strain containing eGFP insertion; (2) The test result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 1 is positive, the test result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 2 is negative, and the test result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 3 is positive, then the sample is an African swine fever vaccine strain containing mCherry insertion; (3) The detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 1 is positive, the detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 2 is negative, and the detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 3 is negative, then the sample is a wild strain of African swine fever; (4) The detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 1 is negative, the detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 2 is negative, and the detection result of the single-tube RPA-Cas12a detection reaction constructed using the detection composition 3 is negative, then the sample does not contain African swine fever wild strain or vaccine strain.

Images