LAMP primer group and detection method for detecting porcine epidemic diarrhea virus

Abstract

The invention relates to the technical field of virus detection, and particularly discloses an LAMP (loop-mediated isothermal amplification) primer group and a detection method for detecting a porcine epidemic diarrhea virus, an N gene sequence of a PEDV (porcine epidemic diarrhea virus) strain is obtained from NCBI GenBank, DNAMAN9.0 software is utilized for comparison, specific primers are designed and screened out, and an RT-LAMP detection method taking the N gene sequence of the PEDV strain as a detection object is established. The detection limit is close to the detection limit of 30 times of circulation of a PCR (Polymerase Chain Reaction) method. Compared with a PCR (Polymerase Chain Reaction) method, the RT-LAMP detection method for the porcine epidemic diarrhea virus provided by the invention has the advantages that the reaction time is shorter, the detection result can be obtained more quickly, and in clinical sample detection, the RT-LAMP detection method is consistent with the PCR method in result and is high in repeatability.

Description

Technical Field

[0001] The present invention relates to the technical field of virus detection, and specifically to a LAMP primer set for detecting porcine epidemic diarrhea virus and a detection method therefor. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) belongs to the genus Alphacoronavirus, and its genome contains seven open reading frames: ORF1a, ORF1b, S, ORF3, E, M, and N, which can be translated into four structural genes and three non-structural genes. The currently prevalent PEDV is divided into three categories: classical strains (GⅠ group), variant strains (GⅡ group), and recombinant strains represented by S-INDEL. In recent years, genetic analysis of PEDV strain sequences has shown that the current variant PEDV strains (GⅡ group) account for more than 90% and are the main prevalent strains, and also coexist with PEDV S-INDEL strains. PEDV can be transmitted indirectly between pig farms, and can cause a lethality rate of up to 100% in neonatal piglets, with the main characteristics of bleeding in the intestinal wall of pigs, diarrhea, and dehydration. PEDV is widely prevalent globally, resulting in a positive rate of more than 60% in suckling piglets, becoming the most threatening porcine enteric virus in the breeding industry.

[0003] Early laboratory detection is a very valuable detection method for virus diagnosis. By detecting the secretions, excretions, and tissue cells of pathogens produced after a corresponding virus infects an organism, the screening of diseases in the organism can be completed, and then corresponding diagnoses can be made, and corresponding prevention and control measures can be specified. In the early stage, immunological methods were used to diagnose viral infections, and the methods included virus agglutination tests, enzyme-linked immunosorbent assays, and colloidal gold test strips. In addition, nucleic acids are biological macromolecules widely present in organisms and play a very important role in the life activities and genetic information transmission of organisms. Compared with traditional immunological detections, molecular biology detections targeting nucleic acids, including nucleic acid amplification technologies, have higher sensitivity and specificity, and molecular biology detection technologies have made great progress in scientific research and diagnosis and treatment. Currently, molecular biology detections include polymerase chain reaction (PCR) technology, loop-mediated isothermal amplification technology (LAMP), and recombinase polymerase amplification technology (RPA), and are currently widely used in coronavirus detection. Nowadays, although existing traditional detection methods can accurately and sensitively detect virus infections, the detection results take a long time, are costly, require more advanced equipment and experimental personnel, and more and more studies show that there is a need to develop a method with high sensitivity, convenient operation, portability, and simplicity for easy promotion to achieve virus detection. Summary of the Invention

[0004] The object of the present invention is to provide an RT-LAMP primer set for detecting porcine epidemic diarrhea virus and a detection method, so as to solve the problems of long detection result time, high cost, need for more advanced equipment and experimental personnel in the existing traditional detection methods.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] An RT-LAMP detection primer set for porcine epidemic diarrhea virus, the detection primer set includes an outer primer F3-1, an outer primer B3-1, an inner primer FIP-1, an inner primer BIP-1, a loop primer LF-1 and a loop primer LB-1, and the nucleotide sequences of each primer are as follows:

[0007] Outer primer F3-1: GGTACTCGCAAACAACGCT;

[0008] Outer primer B3-1: TCTTTGCGCCTTCTTTAGCA;

[0009] Inner primer FIP-1: TCAATTCGCTCACCACGGCGAAGGGGAATAAGGACCAGCA;

[0010] Inner primer BIP-1: ACTACCTCGGAACAGGACCTCAACCCAGAAAACACCCTCAGT;

[0011] Loop primer LF-1: GCGAATTTGCTCATTCCAGTATCCA;

[0012] Loop primer LB-1: GCCGACCTCCGTTATAGGACT.

[0013] An RT-LAMP detection primer set for porcine epidemic diarrhea virus, the detection primer set includes an outer primer F3-2, an outer primer B3-2, an inner primer FIP-2, an inner primer BIP-2, a loop primer LF-2 and a loop primer LB-2, and the nucleotide sequences of each primer are as follows:

[0014] Outer primer F3-2: ACCTCCGTTATAGGACTCGT;

[0015] Outer primer B3-2: TTGCCATTGCCACGACTC;

[0016] Inner primer FIP-2: ACGCCTTTCTGACACCCAAGTTGAGGGTGTTTTCTGGGTTGC;

[0017] Inner primer BIP-2: TCTCTCAACAGCTCCCCAGTGTTGCTACGCGAATTTGTACGT;

[0018] Loop primer LF-2: AGTGGGTTCAGTCTTTGCGC;

[0019] Loop primer LB-2: AGATTGTTGAACCTAACACACCTCC.

[0020] An RT-LAMP detection primer set for porcine epidemic diarrhea virus, the detection primer set includes outer primer F3-3, outer primer B3-3, inner primer FIP-3, inner primer BIP-3, loop primer LF-3 and loop primer LB-3, and the nucleotide sequences of each primer are:

[0021] Outer primer F3-3: AAAGTCTGACAACAGCGGAA;

[0022] Outer primer B3-3: AACTGGCGATCTGAGCATAG;

[0023] Inner primer FIP-3: TTCGCCCTTGGGAATTCTCCTCGAACAAATCCAGGGCCACT;

[0024] Inner primer BIP-3: GCAGCTTGCTTCGGACCCAGCCTGACGCATCAACACCTT;

[0025] Loop primer LF-3: CTTTGAGGTCACGTTCCTTCGA;

[0026] Loop primer LB-3: GGGGGCTTCAAAAATTTTGGAG.

[0027] An RT-LAMP detection primer set for porcine epidemic diarrhea virus, the detection primer set includes outer primer F3-4, outer primer B3-4, inner primer FIP-4, inner primer BIP-4, loop primer LF-4 and loop primer LB-4, and the nucleotide sequences of each primer are:

[0028] Outer primer F3-4: TGCCCCTGAGCCTGTAC;

[0029] Outer primer B3-4: GGGCTGCTCGATCCTCTC;

[0030] Inner primer FIP-4: GCACGGCGTTGTTGGCCAGCCCCCTGAGGGTGACCAA;

[0031] Internal primer BIP-4: CAAGGGCAACAAGGACCAGCAGCCCCTCCTCATCCTCCA;

[0032] Loop primer LF-4: TGCTCAGGGGCTTGTCG;

[0033] Loop primer LB-4: ATCGGCTACTGGAACGAGCAGAT.

[0034] A porcine epidemic diarrhea virus detection kit, comprising any one of the above RT-LAMP detection primer sets, a positive control, and a negative control. Among them, the positive control is the pUC19-PEDV N standard plasmid, and the negative control is RNase-Free ddH 2 O.

[0035] As a limitation of the present invention, the preparation method of the pUC19-PEDV N standard plasmid is:

[0036] Using the pUC19-PEDV N gene sequence as a reference sequence, designing full-length amplification primers for the PEDV N gene, extracting the target gene fragment, and recombining it into the digested pUC19 plasmid to form the pUC19-PEDV N standard plasmid.

[0037] A visual RT-LAMP detection method for porcine epidemic diarrhea virus, and the detection method is:

[0038] (1) Construct an RT-LAMP reaction system and amplify

[0039] After extracting the sample to be tested, using the pUC19-PEDV N standard plasmid as a positive control and RNase-Free ddH 2 O as a negative control, construct an RT-LAMP reaction system containing any one of the above three RT-LAMP detection primer sets, perform an RT-LAMP reaction, and obtain an RT-LAMP amplification product;

[0040] (2) Judge the result of the sample to be tested

[0041] After the amplification reaction, centrifuge briefly to mix the fluorescent dye with the RT-LAMP amplification product. If it shows yellow-green and has fluorescence, it is positive; if it shows orange-yellow and has no fluorescence, it is judged as negative. After amplifying the RT-LAMP reaction system constructed with the sample to be tested as a template, compare it with the RT-LAMP reaction systems constructed with the positive control and the negative control respectively. If it is consistent with the positive control, showing yellow-green and having fluorescence, it indicates that the sample to be tested is positive; otherwise, it indicates that it is negative.

[0042] As a limitation of the present invention, the RT-LAMP reaction system is as follows: 0.5 μL of Bst 3.0 DNA / RNA polymerase, MgCl 2 1.0 μL, 3.5 μL of dNTP Mixture, 2.5 μL of 10×Isothermo Buffer, 2.5 μL of primer premix, 1.0 μL of template, 14 μL of RNase-Free ddH 2 O, and 10 μL of SYBR Green I working solution; the RT-LAMP reaction conditions are: 60 - 65 °C, amplification for 30 - 40 min.

[0043] An RT-LAMP detection method for porcine epidemic diarrhea virus, the detection method is as follows:

[0044] (1) Construct an RT-LAMP reaction system and amplify

[0045] After extracting the sample to be tested, using pUC19-PEDV N standard plasmid as a positive control and RNase-Free ddH 2 O as a negative control, construct an RT-LAMP reaction system containing the above-mentioned fourth RT-LAMP detection primer set, perform RT-LAMP reaction to obtain RT-LAMP amplification products;

[0046] (2) Judge the result of the sample to be tested

[0047] After the amplification reaction, heat to inactivate the enzyme in the reaction system, store at 4 °C for 15 min to reduce aerosol contamination, and finally judge the result by whether there are ladder-like bands in electrophoresis. After amplifying the RT-LAMP reaction system constructed with the sample to be tested as a template, compare the electrophoresis results with those of the RT-LAMP reaction systems constructed with the positive control and negative control respectively. If the electrophoresis result is consistent with that of the positive control, it indicates that the sample to be tested is positive; otherwise, it indicates that it is negative.

[0048] As a limitation of the present invention, the RT-LAMP reaction system is as follows: 0.125 μL of Bst 4.0 DNA / RNA polymerase, MgCl 2 1.5 μL, 3.5 μL of dNTP Mixture, 2.5 μL of 10×Isothermo Buffer, 2.5 μL of primer premix, 1.0 μL of template, 13.875 μL of RNase-Free ddH 2 O; the RT-LAMP reaction conditions are: 60 - 65 °C, amplification for 30 - 40 min.

[0049] Compared with the prior art, the beneficial effects of the present invention are:

[0050] The RT-LAMP detection primers for porcine epidemic diarrhea virus proposed by the present invention have strong specificity and good detection effect. The primer set only recognizes its own template and performs specific amplification. This primer set does not bind to other viruses, has good specificity, and can accurately and specifically amplify the target gene.

[0051] The detection method provided by the present invention realizes visual detection by adding SYBR Green I working solution. It can directly observe whether the dye changes color to judge the detection result. When the naked eye cannot judge, it can be assisted by ultraviolet irradiation to check for fluorescence. The fluorescence intensity of the positive result is strong, and there is no fluorescence in the negative result. The operation is simple.

[0052] The detection limit of the detection method provided by the present invention is 1.67×10 4 copies / μL, which is the same as the detection limit of the PCR method after 30 cycles. However, at this time, the total reaction time of the PCR reaction is nearly 2 hours, while the overall reaction time of the detection method provided by the present invention only takes 35 minutes. Compared with the PCR method, the detection method provided by the present invention has a shorter reaction time and can obtain the detection result faster. Description of the Drawings

[0053] Figure 1 For the specific test results and fluorescence effect diagrams of Example 2;

[0054] Figure 2 For the sensitivity test results and fluorescence effect diagrams of Example 2;

[0055] Figure 3 For the result diagrams of the clinical detection in Example 2. Among them, part A is the PCR electrophoresis result diagram, and part B is the result diagram of the visual RT-LAMP detection method;

[0056] Figure 4 For the specific test electrophoresis result diagram of Example 3;

[0057] Figure 5 For the sensitivity test electrophoresis result diagram of Example 3. Detailed Embodiments

[0058] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0059] Source of Materials

[0060] PEDV (CV777 strain), TGEV, HCoV-OC43, VSV, PRV, HSV-1 are all preserved by the Key Laboratory of Animal Epidemiology of the Ministry of Agriculture and Rural Affairs; Vero-E6 cells (African green monkey kidney cells) are preserved by the Key Laboratory of Animal Epidemiology of the Ministry of Agriculture and Rural Affairs; 5α Chemically Competent Cell (chemically competent cell) is purchased from Beijing Tsingke Biotechnology Co., Ltd.; fetal bovine serum (PBS) is purchased from BI Company of Israel; Bst3.0 DNA / RNA enzyme (8U / μL) is purchased from Xinhai Gene Detection Co., Ltd.; endotoxin-free plasmid large extraction kit, viral genomic RNA extraction kit, and universal DNA purification and recovery kit are all purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; dNTP (deoxyribonucleoside triphosphate, 10 mM each), Ⅱ OneStep Cloning Kit (one-step cloning kit) is purchased from Nanjing Novozymes Biotech Co., Ltd.; EcoRⅠ (EcoRⅠ rapid restriction enzyme), BamHⅠ (BamHⅠ rapid restriction enzyme), one-step reverse transcription kit, 6×DNA Loading Buffer (electrophoresis loading buffer) are all purchased from Beijing TransGen Biotech Co., Ltd.; PowerPol 2×PCR Mix (PCR mixture) is purchased from ABP Biosciences Co., Ltd.; Plus DNA Marker (DNA ruler), pUC19 (plasmid vector) are all purchased from Beijing Tsingke Biotechnology Co., Ltd.; the rest of the experimental materials and reagents, if not otherwise specified, can be obtained from commercial channels.

[0061] Reagent preparation

[0062] LB liquid medium: 2 g of NaCl, 2 g of tryptone, 1 g of yeast extract, 200 mL of distilled water, mix well, autoclave at 121 °C for 30 min, then cool to room temperature and store at 4 °C for later use;

[0063] LB liquid medium containing 1% Amp resistance: Add 100 mg of ampicillin to 100 mL of LB liquid medium, mix well, and store at 4 °C for later use;

[0064] LB solid medium: 2 g of NaCl, 2 g of tryptone, 1 g of yeast extract, 2 g of agar powder, 200 mL of distilled water, dissolve thoroughly, autoclave at 121 °C for 30 min, then add ampicillin to obtain an ampicillin solution with a final concentration of 100 mg / mL, pour the plate quickly, cool at room temperature, and then store at 4 °C for later use;

[0065] SYBR GreenⅠ working solution: After brief centrifugation of SYBR GreenⅠ (10000×), take 4μL and add it to 396μL RNase-Free ddHO 2 Place the tube in a centrifuge tube with 10% MgCl2O in a centrifuge tube, cover the tube tightly, mix by inverting, wrap the centrifuge tube completely with tin foil, and store at -20°C away from light.

[0066] Example 1: Synthesis of pUC19-PEDV N standard plasmid

[0067] 1.1 Extraction of viral RNA

[0068] Vero-E6 cells were infected with PEDV (CV777 strain) and cultured for 36 h. After the culture was completed, the cells were frozen and thawed at -80 °C for 3 times to rupture the Vero-E6 cells infected with PEDV (CV777 strain). The virus solution was filtered out with a 0.22 μM filter. Extract viral genomic RNA according to the TIANamp Virus RNA Kit instruction manual and store the obtained RNA in a -20℃ refrigerator for short-term use, or in a -80℃ refrigerator for long-term use.

[0069] 1.2 Synthesis of cDNA

[0070] use The reaction reagents provided by the One-Step gDNA Removal and cDNA Synthesis SuperMix Reverse Transcription Kit were used to prepare the reverse transcription system in a reaction tube. The reverse transcription system was as follows: RT / RI Enzyme Mix 1μL, Oligo(dT) 18 Primer 1μL, gRNA Remover 1μL, 2×TS Reaction Mix 10μL, Total RNA 5μL, RNase-Free ddH 2 O to make up 20μL, after preparing the reverse transcription system, place the reaction tube on the PCR instrument and set the reaction program, which is incubation at 42℃ for 30min and inactivation at 85℃ for 5s. After the reaction is completed, take out the reaction tube in time and place the obtained cDNA on ice for subsequent experiments or store it in a -20℃ refrigerator for later use.

[0071] 1.3 Preparation of linearized vector

[0072] Import the sequence of the pUC19 plasmid into the software SnapGene to obtain the plasmid map. Compare the restriction sites in the plasmid MCS region and the PEDVN gene, and select two suitable restriction sites. The selection principles are as follows:

[0073] 1) The restriction sites are present in the MCS region and absent from the target gene sequence;

[0074] 2) There are several bases between the two restriction sites.

[0075] According to the above two requirements, the plasmid was digested with the restriction endonucleases EcoRⅠ and BamHⅠ for linearization. The double digestion system was prepared as follows: 10× Buffer 10 μL, EcoRⅠ 2 μL, BamHⅠ 2 μL, pUC19 4 μL, RNase-Free ddH 2 O was added to make up 40 μL. After preparing the reaction system, gently flick to mix evenly and briefly centrifuge to collect the liquid. The reaction tube was placed in a metal bath at 37 °C for 2 h. An appropriate amount of 6× DNA Loading buffer was added to the reaction product, and the result was observed by electrophoresis.

[0076] 1.4 Recovery of linear vector

[0077] Use the reaction reagents provided by the Universal DNA Purification Kit gel recovery kit to recover and purify the target gene fragment in the agarose gel strip. The steps are as follows:

[0078] 1) To improve the uniformity and stability of the adsorption column and eliminate the influence of adverse factors on the adsorption column, before the recovery and purification, the column was equilibrated with the equilibration buffer BL, that is, 500 μL of the equilibration buffer BL was added to the adsorption column CB2. (If the equilibration buffer BL appears turbid, place it in a water bath at 37 °C for a few minutes to restore clarity), centrifuge at 13400×g for 1 min, remove the adsorption column, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0079] 2) Under ultraviolet light irradiation, cut off the specific band of the linearized vector. The gel cutting operation should be as fast as possible to reduce the damage of ultraviolet light to DNA. At the same time, try to cut off the redundant part to avoid affecting the recovery rate. Put the gel block into a clean 1.5 mL centrifuge tube and weigh the gel block;

[0080] 3) According to the ratio relationship, add the corresponding amount of solution PC to the gel block. (If the gel block weighs 0.1 g and the volume at this time is 100 μL, then 100 μL of solution PC is added). Put the centrifuge tube into a metal bath at 50 °C and heat for 10 min. (The time can be adjusted according to the gel dissolution situation). During this period, gently turn the centrifuge tube up and down from time to time, and the action should be gentle to ensure that the gel is fully dissolved;

[0081] 4) After waiting for the lysate to reach room temperature, add it to the adsorption column, centrifuge at 13,400×g for 1 min, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0082] 5) Pipette 600 μL of wash buffer PW into the adsorption column, let it stand for 2 - 5 min, centrifuge at 13,400×g for 1 min, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0083] 6) Repeat step 5);

[0084] 7) Centrifuge at 13,400×g for 2 min, the time can be extended to remove the wash buffer as much as possible, discard the waste liquid in the collection tube, open the tube cap, and let it stand at room temperature for 5 - 10 min to completely volatilize the ethanol in the wash buffer;

[0085] 8) Select RNase-Free ddH 2 O as the elution buffer and preheat it in a metal bath at 65 - 70°C;

[0086] 9) Place the adsorption column into a clean centrifuge tube, suspend and add the preheated elution buffer to the center of the adsorption membrane, note that the pipette tip should not touch the adsorption membrane, let it stand at room temperature for 2 min, then centrifuge at 13,400×g for 2 min to collect the DNA solution;

[0087] 10) Add the DNA solution to the adsorption column, repeat step 9 to increase the DNA recovery amount, collect the DNA solution, and store it at -20°C for later use.

[0088] 1.5 Amplification of target gene

[0089] Using the N gene sequence of the classical PEDV strain CV777 (accession number: KT323979.1) as the reference sequence, apply the Novoprotein online primer design tool (https: / / crm.vazyme.com / cetool / single fragment.html), import the sequences of the plasmid and the target gene, according to the two restriction endonucleases selected for double digestion, select the EcoRⅠ as the linearization cleavage site at the 5' end of the sequence and BamHⅠ as the linearization cleavage site at the 3' end of the sequence, and design the full-length amplification primers for the PEDV N gene. The specific primers are shown in Table 1:

[0090] Table 1: Full-length primer sequences of PEDV N gene

[0091]

[0092]

[0093] Using the cDNA synthesized in 1.2 as a template, prepare a 50 μL reaction system in a reaction tube with PowerPol 2×PCR Mix. The reaction system is as follows: 25 μL of PowerPol 2×PCR Mix, 2 μL of N full-F (10 μM), 2 μL of N ful-R (10 μM), 5 μL of template, and RNase-Free ddH 2 O to make up 50 μL. After mixing the reaction system, place the reaction tube in a PCR instrument and set the reaction program. The reaction program is as follows: pre-denaturation at 98 °C for 45 s, denaturation at 98 °C for 10 s, annealing at 60 °C for 20 s, extension at 72 °C for 30 s, post-extension at 72 °C for 5 min, and set 30 cycles for the denaturation-annealing-extension program.

[0094] 1.6 Recovery and purification of the target gene

[0095] Use the reaction reagents provided by the Universal DNA Purification Kit to recover and purify the target gene fragment in the agarose gel strip. The steps are as follows:

[0096] 1) To improve the uniformity and stability of the adsorption column and eliminate the influence of adverse factors on the adsorption column, before the recovery and purification, first perform column equilibration with equilibration buffer BL, that is, add 500 μL of equilibration buffer BL to the adsorption column. (If the equilibration buffer BL shows turbidity, place it in a 37 °C water bath for a few minutes to restore clarity), centrifuge at 13400×g for 1 min, remove the adsorption column, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0097] 2) Under ultraviolet light irradiation, cut off the specific band of the linearized vector. The gel cutting operation should be as fast as possible to reduce the damage of ultraviolet light to DNA, and at the same time try to cut off the excess part to avoid affecting the recovery rate. Put the gel block into a clean 1.5 mL centrifuge tube and weigh the gel block;

[0098] 3) According to the ratio relationship, add the corresponding amount of solution PC to the gel block. (If the gel block weighs 0.1 g and the volume is 100 μL at this time, then add 100 μL of solution PC), put the centrifuge tube into a 50 °C metal bath and heat for 10 min (the time can be adjusted according to the gel dissolution situation), and turn the centrifuge tube up and down gently from time to time to ensure that the gel is fully dissolved;

[0099] 4) After waiting for the dissolution solution to cool to room temperature, add it to the adsorption column, centrifuge at 13400×g for 1 min, discard the waste liquid in the collection tube, and place the adsorption column back into the collection tube;

[0100] 5) Pipette 600 μL of wash buffer PW into the adsorption column, let it stand for 2 - 5 min, centrifuge at 13400×g for 1 min, discard the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0101] 6) Repeat step 5);

[0102] 7) Centrifuge at 13400×g for 2 min, the time can be extended to remove the wash buffer as much as possible, discard the waste liquid in the collection tube, open the tube cap, and place it at room temperature for 5 - 10 min to completely volatilize the ethanol in the wash buffer;

[0103] 8) Select RNase-Free ddH 2 O as the eluent and preheat it in a 65 - 70 °C metal bath;

[0104] 9) Put the adsorption column into a clean centrifuge tube, suspend and drip the preheated eluent onto the center of the adsorption membrane, note that the pipette tip should not touch the adsorption membrane, let it stand at room temperature for 2 min, then centrifuge at 13400×g for 2 min to collect the DNA solution;

[0105] 10) Add the DNA solution to the adsorption column, repeat step 9 to increase the DNA recovery, collect the DNA solution, and store it at -20 °C for later use.

[0106] 1.7 Calculate the usage amounts of the linearized vector and the inserted fragment

[0107] Select Ⅱ One Step Cloning Kit to perform the recombination reaction of the linearized vector and the inserted fragment. The optimal addition amount of the linearized vector in this system is 0.03 pmol, and the optimal addition amount of the inserted fragment is 0.06 pmol. The corresponding DNA masses can be calculated using the following two formulas:

[0108] Optimal addition amount of the inserted fragment = (0.03 × length of the inserted fragment) ng;

[0109] Optimal addition amount of the linearized vector = (0.02 × length of the linearized vector) ng.

[0110] 1.8 Prepare the recombination reaction system

[0111] Using the cDNA synthesized in 1.2 as the template, prepare the recombination reaction system in a reaction tube on ice. The recombination reaction system is: 25 μL of PowerPol 2×PCR Mix, 2 μL of Nfull-F (10 μM), 2 μL of Nful-R (10 μM), 5 μL of template, RNase-Free ddH 2Make up to 50 μL with O. After preparing the reaction system, gently pipette up and down to mix well, and briefly centrifuge to collect the liquid. Place the reaction tube in a PCR instrument, set a two-step reaction program. First, perform the recombination reaction at 37 °C for 30 min, then lower the temperature of the reaction tube to 4 °C. Store the recombination reaction product in a -20 °C refrigerator.

[0112] 1.9 Transformation of the recombinant product

[0113] Select 5α chemically competent cells and perform transformation according to the following steps:

[0114] 1) Take out the competent cells stored in a -80 °C refrigerator and place them on ice to thaw.

[0115] 2) Pipette 10 μL of the recombinant product and add it to 100 μL of completely thawed competent cells. Gently flick the tube wall to mix well and let it stand on ice for 5 min.

[0116] 3) Preheat a water bath to 42 °C, transfer the reaction tube to the 42 °C water bath, heat shock for 45 s, and then quickly place it on ice to cool for 2 min.

[0117] 4) Add 500 μL of LB liquid medium to the reaction tube, gently pipette to mix well, evenly drip the liquid in the reaction tube onto a solid medium containing Amp resistance, spread it evenly, and place it in an inverted position in a 37 °C incubator for 16 h.

[0118] 1.10 Extraction and identification of the recombinant product

[0119] After culturing for 16 h, hundreds of monoclonal colonies are formed on the transformation plate. Pick 5 single colonies and add them to 5 mL of LB liquid medium containing 1% Amp resistance respectively. Place them in a 37 °C shaker and expand the culture at 200 rpm for 5 h. Select the bacterial liquid with good growth conditions and add it to 200 mL (1% Amp) of LB liquid medium. Place it in a 37 °C constant temperature shaker and culture overnight at 200 rpm. Then use the Tiangen Biotech endotoxin-free plasmid large extraction kit to extract the pUC19-PEDV N standard plasmid. The steps are as follows:

[0120] 1) Use a 15 mL centrifuge tube to measure 2.5 mL of equilibration buffer BL and pour it into the adsorption column. Centrifuge at 8000 rpm for 2 min, pour out the liquid in the collection tube, and place the adsorption column back into the collection tube. The adsorption column treated by column equilibration should be used immediately.

[0121] 2) Take 100 mL of the overnight cultured bacterial liquid and add it to 4 50 mL centrifuge tubes, 25 mL of bacterial liquid in each tube. Centrifuge at 8000 rpm for 3 min at room temperature to collect the bacterial cell precipitate. Aspirate as much supernatant as possible and use a clean absorbent paper to absorb the residual liquid on the tube wall.

[0122] 3) Add 8 mL of Solution P1 provided in the kit to one of the centrifuge tubes with cell pellets, pipette to mix well, and use a vortex mixer to vigorously shake to completely suspend the cell pellets. Pour the cell suspension into the next centrifuge tube with cell pellets, and repeat the above steps until all the cell pellets in the 4 tubes are collected in one centrifuge tube;

[0123] 4) Add 8 mL of Solution P2 provided in the kit to the centrifuge tube, immediately gently invert the tube up and down 6 - 8 times to fully lyse the cells, and let it stand at room temperature for 5 min;

[0124] 5) Add 8 mL of Solution P4 provided in the kit to the centrifuge tube, immediately gently invert the tube up and down 6 - 8 times until white flocculent precipitates appear, and let it stand at room temperature for 10 min;

[0125] 6) Centrifuge at 8000 rpm for 10 min to precipitate the white flocculent matter. Pour the supernatant into the filter, avoiding pouring in the precipitate, and slowly push the handle to filter the supernatant into a clean 50 mL centrifuge tube;

[0126] 7) Weigh the volume of the filtrate, add isopropanol solution with 0.3 times its own volume to it, invert the tube up and down to mix well, add the solution to the adsorption column in 2 portions, centrifuge at 8000 rpm for 2 min at room temperature, and discard the waste liquid;

[0127] 8) Measure 10 mL of wash buffer PW and add it to the adsorption column, centrifuge at 8000 rpm for 2 min at room temperature, and discard the waste liquid;

[0128] 9) Repeat step 8);

[0129] 10) Measure 3 mL of absolute ethanol and add it to the adsorption column, centrifuge at 8000 rpm for 2 min at room temperature, and discard the waste liquid;

[0130] 11) Place the adsorption column back into the collection tube, centrifuge at 8000 rpm for 5 min at room temperature to remove the residual wash buffer, discard the liquid in the collection tube, open the lid and let it stand at room temperature for 10 min to completely dry the residual wash buffer;

[0131] 12) Place the adsorption column in a new collection tube, suspend and add 1 - 2 mL of ddH 2 O dropwise to the center of the adsorption membrane, let it stand at room temperature for 5 min, and centrifuge at 8000 rpm for 2 min at room temperature;

[0132] 13) Centrifuge the solution in the collection tube a second time to increase the plasmid recovery rate, and collect the eluate into a clean 1.5 mL centrifuge tube;

[0133] 14) Directly perform electrophoresis identification on the extracted plasmid, perform double digestion on the obtained plasmid, prepare a 1.2% agarose gel, observe the results by electrophoresis, measure the DNA concentration, and store it at -20 °C for later use.

[0134] Example 2: A Visual RT-LAMP Detection Method for Porcine Epidemic Diarrhea Virus

[0135] 2.1 Primer Design and Synthesis

[0136] Obtain the N gene sequence of the PEDV strain from NCBI GenBank, use the DNAMAN 9.0 software for alignment, select the relatively conserved sequence of the N gene among multiple PEDV strains to design LAMP primers, and at the same time run the NCBI BLAST program on the selected conserved sequence to determine its specificity. According to the design principle of LAMP primers, use the online software LAMPPrimer Des i gn Tool (https: / / lamp.neb.com) to screen the universal primers for the conserved region. A total of 3 groups of primers were screened out. Each group of primers includes inner primers (FIP / BIP), outer primers (F3 / B3), and loop primers (LF / LB), and they were sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for synthesis. The results are shown in Table 2:

[0137] Table 2: Results of RT-LAMP Detection Primer Design

[0138]

[0139]

[0140] 2.2 Primer Screening

[0141] Use the pUC19-PEDV N standard plasmid as the positive template for RT-LAMP amplification, and use RNase-Free ddH 2 O to replace the template of the negative control. After the RT-LAMP amplification is completed, centrifuge the SYBR Green Ⅰ working solution to the bottom of the tube, vortex and mix well, and observe the color change of each tube with the naked eye. It is found by the naked eye that the negative tubes of primer groups 2 and 3 show amplification, while the negative tube of primer group 1 does not show amplification, indicating that the amplification of primer groups 2 and 3 is not caused by contamination, indicating that primer groups 2 and 3 have non-specific amplification. The negative control of primer group 1 is still orange-yellow and does not emit fluorescence under ultraviolet irradiation, proving that this primer group does not have non-specific amplification. Therefore, primer group 1 is selected for subsequent optimization experiments.

[0142] 2.2 Preparation of Primer Premix

[0143] Dilute the synthesized dry powder primers according to the water addition requirements on the tube body to obtain outer primers, inner primers and loop primers with a concentration of 100 μM. The working concentrations of each primer in the primer premix are 2 μM for each outer primer, 16 μM for each inner primer, and 8 μM for each loop primer.

[0144] Take a clean 1.5 mL centrifuge tube, add 2 μL of each outer primer, 16 μL of each inner primer, and 8 μL of each loop primer to it. The total primer addition amount is 52 μL. Add 48 μL of RNase-Free ddH 2 O to obtain a 100 μL primer mixture.

[0145] Place the primer mixture in a metal bath preheated to 95 °C, heat for 10 min, then quickly take it out and cool it on ice. After complete cooling, store it in a -4 °C refrigerator for later use.

[0146] 2.3 Establish the RT-LAMP reaction system

[0147] Prepare each reaction tube with reference to the RT-LAMP reaction system. Specifically, see Table 3. After adding each component in Table 3 to the bottom of the reaction tube, finally take 10 μL of SYBR Green Ⅰ working solution and add it to the inside of the tube cap. Tighten the tube cap and use the pUC19-PEDV N standard plasmid as the positive template for RT-LAMP amplification. Use RNase-Free ddH 2 O to replace the template for the negative control.

[0148] Table 3: RT-LAMP reaction system

[0149]

[0150]

[0151] After the RT-LAMP reaction system is prepared, amplify at 61 °C for 35 min. After the amplification is completed, centrifuge briefly to mix the fluorescent dye working solution with the reaction product. Judge whether there is amplification by observing the color of each reaction tube. The negative tube is orange-yellow, and the positive is yellow-green. When it cannot be judged by the naked eye, ultraviolet irradiation can be used to assist in the judgment. The positive tube has strong fluorescence intensity, and the negative tube has no fluorescence.

[0152] Detection experiment 1:

[0153] Specificity test:

[0154] Prepare the reaction system according to the concentrations of each component in the RT-LAMP reaction system in Example 2. Use the pUC19-PEDV N standard plasmid as the positive control, and use RNase-Free ddH 2Instead, six kinds of viral nucleic acids of PEDV, TGEV, HCoV-OC43, VSV, PRV, and HSV-1 that have passed the virus's own verification were used for visual LAMP / RT-LAMP amplification. The addition amount of the viral template in the reaction system was 1 μL. After the reaction ended, the SYBR Green I working solution was mixed with the reaction product. After thorough mixing, the color of each tube was observed with the naked eye to judge the specificity of the visual RT-LAMP detection method.

[0155] Two outer primers (F3 / B3) of the selected RT-LAMP primer set 1 were used as the upstream and downstream primers. F3 was the upstream primer and B3 was the downstream primer. The pUC19-PEDV N standard plasmid was used as the positive control, and the negative control template was RNase-Free dH 2 Instead, the PCR reaction system was prepared according to Table 4, and the above nucleic acid samples were amplified by PCR or RT-PCR. The PCR amplification process was pre-denaturation at 98 °C for 45 s, denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 5 min to end the reaction. After the reaction ended, 7 μL of the amplification product was taken, and the result was observed by 1.2% agarose gel electrophoresis. According to the specific bands, the specificity of the PCR method was judged.

[0156] Table 4: PCR reaction system

[0157] Component Volume PowerPol2×PCR Mix 12.5 μL Forward primer 1 μL Reverse primer 1 μL Template 1 μL <![CDATA[RNase-Free ddH 2 O]]> Add up to 25 μL

[0158] Sensitivity test:

[0159] The concentration of the pUC19-PEDV N standard plasmid was measured using a micro-spectrophotometer and converted into copy numbers. Dilution solutions with different dilution multiples were prepared according to Table 5. Each time a tube of dilution solution was prepared, vortex mixing was performed to ensure uniform concentration in the sample tube. After all the dilution solutions were prepared, they were prepared according to the concentrations of each component in the RT-LAMP reaction system of the example. Each dilution solution was used as a positive template, with an addition amount of 1 μL. The positive control template was the undiluted pUC19-PEDV N standard plasmid, with an addition amount of 1 μL. The negative tube template was RNase-Free ddH 2 O, with an addition amount of 1 μL as well. After the reaction ended, the SYBR Green I working solution was mixed with the reaction product. After thorough mixing, the color of each tube was observed with the naked eye to judge the sensitivity of the visual RT-LAMP detection method.

[0160] Table 5: Dilution of pUC19-PEDV N standard plasmid

[0161] Dilution factor <![CDATA[10 1 > <![CDATA[10 2 > <![CDATA[10 3 > <![CDATA[10 4 > <![CDATA[10 5 > ...... <![CDATA[10 11 > <![CDATA[10 12 > Plasmid (μL) 5 / / / / ...... / / Superior diluent (μL) / 5 5 5 5 ...... 5 5 <![CDATA[RNase-Free ddH 2 O(μL)]]> 45 45 45 45 45 ...... 45 45

[0162] Use the two outer primers of the selected RT-LAMP primer set 1 as the upstream and downstream primers for the PCR test. Use F3 as the upstream primer and B3 as the downstream primer. Use each dilution as a positive template, the positive control template is the undiluted pUC19-PEDV N standard plasmid, and the negative tube template is RNase-Free ddH 2 O. Prepare the PCR reaction system according to Table 4. Set the PCR reaction cycles to 25 times and 30 times respectively. The PCR amplification process is pre-denaturation at 98°C for 45 s, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min to end the reaction. After the reaction ends, take 7 μL of the amplification product, observe the specific band by electrophoresis, and compare it with the sensitivity test results of the visual RT-LAMP detection method.

[0163] Clinical detection:

[0164] An outbreak of porcine infectious diarrhea occurred in a pig farm in a certain place. Randomly select 11 pigs in the pig farm as the detection objects. Use anal swabs to collect intestinal wall cells from these 11 pigs as clinical samples. After vortex mixing the collected intestinal wall cells with ddH 2 O, centrifuge at 5000×g for 3 min to collect the supernatant. Filter the supernatant through a 0.22 μM filter into a clean centrifuge tube. The filtrate is used to extract RNA or stored at -20°C for later use. Prepare the virus template to be tested using the extracted RNA according to the method of the example. Use the synthesized pUC19-PEDV N standard plasmid as the positive control template. Refer to the RT-LAMP reaction system in Example 2 to prepare each reaction tube. After the RT-LAMP reaction system is prepared, amplify at 61°C for 35 min. After the amplification ends, briefly centrifuge to mix the fluorescent dye working solution with the reaction product, and observe the color of each reaction tube.

[0165] Obtain the N gene sequence of the PEDV strain from NCBI GenBank, use the DNAMAN 9.0 software for alignment, select the relatively conserved sequence of the N gene among multiple PEDV strains to design PCR primers, and at the same time run the NCBI BLAST program on the selected conserved sequence to determine its specificity. Import the selected PEDV N sequence into the SnapGene software, manually pull the gene sequence to design the upstream and downstream primers, and send them to Beijing Ruibo Xingke Biotechnology Co., Ltd. for synthesis. The results are shown in Table 6.

[0166] Table 6: PCR primers for clinical samples

[0167]

[0168]

[0169] Using the synthesized pUC19 - PEDV N standard plasmid as the positive control template and RNase - Free ddH 2 O as the negative control template, prepare the PCR reaction system for each clinical sample in the reaction tube and perform the PCR reaction. The primer sequences of the upstream primer and the downstream primer in the reaction system are shown in Table 6. The PCR reaction cycle is set to 30 times. The PCR reaction process is pre - denaturation at 98°C for 45 s, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min to end the reaction. After the reaction, take 7 μL of the amplification product, perform electrophoresis at 120 V for 30 min, observe the specific bands, and compare with the test results of the visual RT - LAMP detection method.

[0170] Results of Detection Experiment 1:

[0171] Specificity test: As Figure 1 shown, where N: negative control; P: positive control; 1: PEDV; 2: TGEV; 3: HCoV - OC43; 4: VSV; 5: PRV; 6: HSV - 1. Only the systems adding the positive plasmid and PEDV nucleic acid turn from orange - yellow to yellow - green after mixing with the SYBR Green Ⅰ working solution. The systems adding other viruses remain orange - yellow, proving that the primer set of the visual RT - LAMP detection method only recognizes its own template and performs specific amplification. This primer set does not bind to other viruses and has good specificity. Using the two outer primers of primer set 1 as the upstream and downstream primers, perform the PCR / RT - PCR specificity test on the nucleic acid verified by the virus itself. The electrophoresis results show that the two outer primers of primer set 1 only recognize the PEDV plasmid and the PEDV nucleic acid sample, and successfully amplify a band of about 250 bp, which is consistent with the expected size. And through sequence alignment, it is found that the homology between the amplification product and the reference sequence is as high as 99.54%, proving that the two outer primers of primer set 1 have good specificity.

[0172] Sensitivity test: As Figure 2 shown, where N: negative control, 1 - 12: plasmid concentrations are 1.67×10 11 、1.67×10 10 、1.67×10 9 、1.67×10 8 、1.67×10 7 、1.67×10 6 、1.67×10 5 、1.67×10 4 、1.67×10 3 、1.67×10 2 、1.67×10 1 、1.67×100 copies / μL. Visual observation results showed that the obtained plasmid concentration was 1.67×10 11 ~1.67×10 4 copies / μL (dilution factor 10 0 ~10 7 ). When the reaction tube was yellowish green in color and showed fluorescence under ultraviolet irradiation, it indicated that specific amplification occurred in the RT-LAMP reaction system within this concentration range; when the plasmid concentrations were 1.67×10 3 copies / μL and 1.67×10 2 copies / μL (dilution factors 10 8 and 10 9 ), one tube was yellowish green and the other was orange yellow, indicating that the RT-LAMP reaction system could amplify at this plasmid concentration, but the amplification was unstable; when the plasmid concentrations were 16.7 copies / μL and 1.67 copies / μL (dilution factors 10 10 and 10 11 ), the colors of the reaction tubes were both orange yellow, indicating that the RT-LAMP reaction system could not perform specific amplification at this plasmid concentration, that is, the RT-LAMP reaction system could not detect plasmid samples with concentrations of 16.7 copies / μL and 1.67 copies / μL. Using the two outer primers of primer set 1 as the upstream and downstream primers, a sensitivity test of the PCR method was performed on the diluted plasmid samples. The PCR products of each cycle number were electrophoresed and observed to determine the detection limit of the PCR method. When the PCR cycle was 25 times, the detection limit was 1.67×10 6 copies / μL, and when the PCR cycle was 30 times, the detection limit was 1.67×10 4 copies / μL.

[0173] Clinical detection: As Figure 3 shown, among them, Figure 4 part A is the result of PCR electrophoresis, and part B is the result of the visual RT-LAMP detection method. In part A and part B, N: negative control; P: positive control; 1 - 11 represent each clinical sample. From Figure 4It can be seen from the PCR electrophoresis results that: among the 11 groups of clinical samples, the electrophoresis results of samples 1, 2, 3, 4, 6, 7, 9, and 11 are consistent with those of the positive control, and the electrophoresis results of samples 5, 8, and 10 are consistent with those of the negative control. The positive samples are 1, 2, 3, 4, 6, 7, 9, and 11, and the negative samples are 5, 8, and 10. The result feedback of the visual RT-LAMP detection method shows that: among the 11 groups of clinical samples, samples 1, 2, 3, 4, 6, 7, 9, and 11 are yellow-green and fluorescent, and samples 5, 8, and 10 are consistent with the negative control, without color change and fluorescence. The results of the visual RT-LAMP detection method correspond to those of the PCR electrophoresis, indicating that the visual RT-LAMP detection method proposed in the present invention has the ability to detect clinical samples and a relatively high accuracy rate.

[0174] Example 3: An RT-LAMP detection method for porcine epidemic diarrhea virus

[0175] 3.1 Primer design, synthesis and screening

[0176] Obtain the N gene sequence of the PEDV strain from NCBI GenBank, use DNAMAN 9.0 software for alignment, select the relatively conserved sequence of the N gene among multiple PEDV strains to design LAMP primers, and at the same time run the NCBI BLAST program on the selected conserved sequence to determine its specificity. According to the design principle of LAMP primers, use the online software LAMP Primer Design Tool (https: / / lamp.neb.com) to screen the universal primers for the conserved region. Each group of primers includes inner primers (FIP / BIP), outer primers (F3 / B3) and loop primers (LF / LB), and send them to Beijing Ruibo Xingke Biotechnology Co., Ltd. for synthesis. Finally, a set of RT-LAMP detection primers as shown in Table 7 is obtained:

[0177] Table 7: Design results of RT-LAMP detection primers

[0178]

[0179] 3.2 Preparation of primer premix

[0180] Dilute the synthesized dry powder primers according to the water addition amount required on the tube body to obtain outer primers, inner primers and loop primers with a concentration of 100 μM. The use concentrations of each primer in the primer premix are 2 μM for each outer primer, 16 μM for each inner primer, and 8 μM for each loop primer;

[0181] Take a clean 1.5 mL centrifuge tube, and add 2 μL of each outer primer, 16 μL of each inner primer, and 8 μL of each loop primer thereto. The total primer addition amount is 52 μL. Add 48 μL of RNase-Free ddH 2 O to obtain a 100 μL primer mixture;

[0182] Place the primer mixture in a metal bath preheated to 95°C, heat for 10 min, then quickly take it out and cool it on ice. After complete cooling, store it in a -4°C refrigerator for later use.

[0183] 3.3 Establish the RT-LAMP reaction system

[0184] Prepare each reaction tube according to the RT-LAMP reaction system, as shown in Table 8 specifically. Use the pUC19-PEDV N standard plasmid as the positive template for RT-LAMP amplification, and use RNase-Free ddH 2 O to replace the template for the negative control;

[0185] Table 8: RT-LAMP reaction system

[0186] Component Component concentration Final concentration Volume Bst4.0 DNA / RNA enzyme 32 U / μL 4U 0.125 μL <![CDATA[MgCl 2 > 100 mM 6 mM 1.5 μL dNTP Mixture 10 mM 1.4 mM 3.5 μL 10×Isothermo Buffer 10× 1× 2.5 μL Primer premix / / 2.5 μL Template / >10 ng 1.0 μL <![CDATA[RNase-Free ddH 2 O]]> / / Add up to 25 μL

[0187] After the RT-LAMP reaction system is prepared, vortex and mix well, briefly centrifuge to collect the liquid adhering to the tube cap and tube wall, then immediately place the reaction tube in a metal bath and heat at 61°C for 35 min. After the amplification reaction is completed, heat at 85°C for 5 min to terminate the reaction. Place the reaction tube at 4°C for 15 min to cool the reagent to reduce aerosol contamination. 5 μL of 6×DNA Loading Buffer should be added to each reaction tube, vortex and mix well, then load the sample into the wells of a 1.2% agarose gel. Load 7 μL of sample into each well, and observe the results by electrophoresis. If the electrophoresis result is the same as that of the positive control, showing a ladder-like band, it indicates that the test sample is positive; otherwise, it indicates that it is negative.

[0188] Detection experiment 2:

[0189] Specificity test:

[0190] Prepare the reaction system according to the concentrations of each component in the RT-LAMP reaction system in Example 3. Use the pUC19-PEDV N standard plasmid as the positive control, and use RNase-Free ddH 2Instead, six kinds of viral nucleic acids of PEDV, TGEV, HCoV-OC43, VSV, PRV, and HSV-1 that passed the virus self-verification were amplified by LAMP / RT-LAMP. The added amount of virus template in the reaction system was 1 μL. After the amplification reaction was completed, the reaction was terminated by heating at 85 °C for 5 min. The reaction tube was placed at 4 °C for 15 min to cool the reagent to reduce aerosol contamination. 5 μL of 6×DNA Loading Buffer was added, and after vortex mixing, the sample was loaded into the wells of a 1.2% agarose gel. Whether ladder-like amplification bands appeared was observed by 1.2% agarose gel electrophoresis to judge the specificity of the RT-LAMP method.

[0191] Two outer primers (F3 / B3) of the RT-LAMP primer set 1 screened in Example 3 were used as the upstream and downstream primers. F3 was the upstream primer and B3 was the downstream primer. The pUC19-PEDV N standard plasmid was used as a positive control, and the negative control template was RNase-Free ddH 2 Instead, the PCR reaction system was prepared according to Table 4, and the above nucleic acid samples were amplified by PCR or RT-PCR. The PCR amplification process was pre-denaturation at 98 °C for 45 s, denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, extension at 72 °C for 30 s, and final extension at 72 °C for 5 min to end the reaction. After the reaction was completed, 7 μL of the amplification product was taken, and the result was observed by 1.2% agarose gel electrophoresis. According to the specific bands, the specificity of the PCR method was judged.

[0192] Sensitivity test:

[0193] The concentration of the pUC19-PEDV N standard plasmid was measured using a micro-spectrophotometer and converted into copy numbers. Dilution solutions with different dilution multiples were prepared according to Table 5. Each time a tube of dilution solution was prepared, it was vortex-mixed to ensure uniform concentration in the sample tube. After all dilution solutions were prepared, they were prepared according to the concentrations of each component in the RT-LAMP reaction system in Example 3. Each dilution solution was used as a positive template, with an added amount of 1 μL. The positive control template was the undiluted pUC19-PEDV N standard plasmid, with an added amount of 1 μL. The negative tube template was RNase-Free ddH 2 O, with an added amount of also 1 μL. After the reaction was completed, the reaction was terminated by heating at 85 °C for 5 min. The reaction tube was placed at 4 °C for 15 min to cool the reagent to reduce aerosol contamination. 5 μL of 6×DNA Loading Buffer was added, and after vortex mixing, the sample was loaded into the wells of a 1.2% agarose gel. Whether ladder-like amplification bands appeared was observed by 1.2% agarose gel electrophoresis to judge the sensitivity of the visual RT-LAMP detection method.

[0194] Use the two outer primers of the RT-LAMP primer set screened in Example 3 as the upstream and downstream primers for the PCR test. Use F3 as the upstream primer and B3 as the downstream primer. Use each dilution as the positive template, the positive control template is the undiluted pUC19-PEDV N standard plasmid, and the negative tube template is RNase-Free ddH 2 O. Prepare the PCR reaction system according to Table 4. Set the PCR reaction cycles to 25 times and 30 times respectively. The PCR amplification process is pre-denaturation at 98°C for 45 s, denaturation at 98°C for 10 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, and final extension at 72°C for 5 min to end the reaction. After the reaction, take 7 μL of the amplification product, observe the specific band by electrophoresis, and compare it with the sensitivity test results of the visual RT-LAMP detection method.

[0195] Results of Detection Experiment 2:

[0196] Specificity test: As Figure 4 shown, where the left part is the electrophoresis result diagram of the RT-LAMP detection method, and the right part is the electrophoresis result diagram of the PCR method. In both parts, N: negative control; P: positive control; 1: PEDV; 2: TGEV; 3: HCoV-OC43; 4: VSV; 5: PRV; 6: HSV-1. It can be seen that in the electrophoresis result diagram of the RT-LAMP detection method, only the systems adding the positive plasmid and PEDV nucleic acid amplified typical ladder bands, and the systems adding other viruses did not amplify, proving that the primer set of this RT-LAMP method only recognizes its own template and amplifies, does not bind to TGEV, HCoV-OC43, VSV, PRV, and HSV-1, and will not amplify either, showing good specificity; in the electrophoresis result diagram of the PCR method, only the primer recognizing the PEDV plasmid and the PEDV nucleic acid sample successfully amplified a band of about 250 bp, which is consistent with the expected size, and through sequence alignment, it is found that the homology of the amplification product with the reference sequence is as high as 99.54%, proving that the two outer primers in the detection primer set have good specificity.

[0197] Sensitivity test: As Figure 5 shown, where the left part is the electrophoresis result diagram of the RT-LAMP detection method, and the right part is the electrophoresis result diagram of the PCR method. In both parts, N: negative control, 1 - 12: plasmid concentrations are 1.67×10 11 、1.67×10 10 、1.67×10 9 、1.67×10 8 、1.67×10 7 、1.67×10 6 、1.67×10 5 、1.67×104 , 1.67×10 3 , 1.67×10 2 , 1.67×10 1 , 1.67×10 0 copies / μL. It can be seen that when the plasmid concentration is 1.67×10 11 ~1.67×10 3 copies / μL (dilution factor 10 0 -10 8 ), amplification bands all appear, proving that amplification occurs in the reaction systems within this range; when the plasmid concentration is diluted to 1.67×10 2 copies / μL, no amplification band appears, indicating that the RT-LAMP system cannot amplify at this plasmid concentration, that is, the plasmid sample with a concentration of 1.67×10 2 copies / μL cannot be detected, and the detection limit of the RT-LAMP method is 1.67×10 3 copies / μL; when the number of PCR cycles is set to 25 times, the lowest detectable concentration of the plasmid sample is 1.67×10 6 copies / μL, and when the number of cycles is set to 30 times, the detection limit is 1.67×10 4 copies / μL;.

[0198] In summary, the RT-LAMP detection method for porcine epidemic diarrhea virus proposed by the present invention has excellent specificity and can accurately and specifically amplify the target gene; the detection limit of the RT-LAMP detection method for porcine epidemic diarrhea virus proposed by the present invention is similar to the detection limit of the PCR method with 30 cycles, but at this time the total time-consuming of the PCR reaction is close to 2 h, while the overall reaction time of the RT-LAMP detection method for porcine epidemic diarrhea virus proposed by the present invention is only 35 min. Compared with the PCR method, the RT-LAMP detection method for porcine epidemic diarrhea virus proposed by the present invention takes less time and can obtain the detection result faster. In the detection of clinical samples, the results of the RT-LAMP detection method are consistent with those of the PCR method and have strong repeatability.

[0199] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and without departing from the spirit or basic characteristics of the present invention, the present invention can be implemented in other specific forms. Therefore, in any aspect, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, it is intended to include all changes falling within the meaning and scope of the equivalent elements of the claims in the present invention.

Claims

1. A RT-LAMP detection primer set for porcine epidemic diarrhea virus, characterized in that: The detection primer set includes outer primer F3-1, outer primer B3-1, inner primer FIP-1, inner primer BIP-1, loop primer LF-1 and loop primer LB-1, and the nucleotide sequence of each primer is: External primer F3-1: GGTACTCGCAAACAACGCT; Outer primer B3-1: TCTTTGCGCCTTCTTTAGCA; Inner primer FIP-1: TCAATTCGCTCACCACGGCGAAGGGGAATAAGGACCAGCA; Internal primer BIP-1: ACTACCTCGGAACAGGACCTCAACCCAGAAAACACCCTCAGT; Loop primer LF-1: GCGAATTTGCTCATTCCAGTATCCA; Loop primer LB-1: GCCGACCTCCGTTATAGGACT.

2. A RT-LAMP detection primer set for porcine epidemic diarrhea virus, characterized in that: The detection primer set includes outer primer F3-2, outer primer B3-2, inner primer FIP-2, inner primer BIP-2, loop primer LF-2 and loop primer LB-2, and the nucleotide sequence of each primer is: Outer primer F3-2: ACCTCCGTTATAGGACTCGT; Outer primer B3-2: TTGCCATTGCCACGACTC; Inner primer FIP-2: ACGCCTTTCTGACACCCAAGTTGAGGGTGTTTTCTGGGTTGC; Inner primer BIP-2:TCTCTCAACAGCTCCCCAGTGTTGCTACGCGAATTTGTACGT; Loop primer LF-2: AGTGGGTTCAGTCTTTGCGC; Loop primer LB-2: AGATTGTTGAACCTAACACACCTCC.

3. A RT-LAMP detection primer set for porcine epidemic diarrhea virus, characterized in that: The detection primer set includes outer primer F3-3, outer primer B3-3, inner primer FIP-3, inner primer BIP-3, loop primer LF-3 and loop primer LB-3, and the nucleotide sequence of each primer is: Outer primer F3-3: AAAGTCTGACAACAGCGGAA; Outer primer B3-3: AACTGGCGATCTGAGCATAG; Internal primer FIP-3: TTCGCCCTTGGGAATTCTCCTCGAACAAATCCAGGGCCACT; Internal primer BIP-3: GCAGCTTGCTTCGGACCCAGCCTGACGCATCAACACCTT; Loop primer LF-3: CTTTGAGGTCACGTTCCTTCGA; Loop primer LB-3: GGGGGGCTTCAAAAATTTTGGAG.

4. A RT-LAMP detection primer set for porcine epidemic diarrhea virus, characterized in that: The detection primer set includes outer primer F3-4, outer primer B3-4, inner primer FIP-4, inner primer BIP-4, loop primer LF-4 and loop primer LB-4, and the nucleotide sequence of each primer is: Outer primer F3-4: TGCCCCTGAGCCTGTAC; Outer primer B3-4: GGGCTGCTCGATCCTCTC; Inner primer FIP-4: GCACGGCGTTGTTGGCCAGCCCCCTGAGGGTGACCAA; Inner primer BIP-4: CAAGGGCAACAAGGACCAGCAGCCCCTCCTCATCCTCCA; Loop primer LF-4: TGCTCAGGGGCTTGTCG; Loop primer LB-4: ATCGGCTACTGGAACGAGCAGAT.

5. A porcine epidemic diarrhea virus detection kit, characterized in that: include: The RT-LAMP detection primer set, positive control, and negative control according to any one of claims 1 to 4, wherein the positive control is the pUC19-PEDV N standard plasmid and the negative control is RNase-Free ddH2O.

6. A porcine epidemic diarrhea virus detection kit according to claim 5, characterized in that: The preparation method of pUC19-PEDVN standard plasmid is: Using the pUC19-PEDV N gene sequence as a reference sequence, primers for full-length amplification of the PEDV N gene were designed, the target gene fragment was extracted, and it was recombined into the pUC19 plasmid after restriction digestion to form the pUC19-PEDV N standard plasmid.

7. A visual RT-LAMP detection method for porcine epidemic diarrhea virus, characterized in that: The detection method is: (1) Construction of RT-LAMP reaction system and amplification After extracting the sample to be tested, using the pUC19-PEDV N standard plasmid as a positive control and RNase-Free ddH2O as a negative control, constructing an RT-LAMP reaction system comprising the RT-LAMP detection primer set according to any one of claims 1 to 3, performing an RT-LAMP reaction, and obtaining an RT-LAMP amplification product; (2) Determine the results of the sample to be tested After the amplification reaction is completed, centrifuge briefly to allow the fluorescent dye to mix with the RT-LAMP amplification product. If it is yellow-green and fluorescent, it is positive, and if it is orange-yellow and no fluorescence, it is negative. After amplification of the RT-LAMP reaction system constructed with the sample to be tested as a template, it is compared with the RT-LAMP reaction system constructed with the positive control and negative control after amplification. If it is consistent with the positive control, that is, yellow-green and fluorescent, it means that the sample to be tested is positive, otherwise, it means it is negative.

8. The visual RT-LAMP detection method for porcine epidemic diarrhea virus according to claim 7, characterized in that: The RT-LAMP reaction system was: Bst3.0 DNA / RNA enzyme 0.5 μL, MgCl2 1.0 μL, dNTP Mixture 3.5 μL, 10×Isothermo Buffer 2.5 μL, primer premix 2.5 μL, template 1.0 μL, RNase-Free ddH2O 14 μL, SYBRGreenⅠ working solution 10 μL; RT-LAMP reaction conditions were: 60-65°C, amplification 30-40 min.

9. A RT-LAMP detection method for porcine epidemic diarrhea virus, characterized in that: The detection method is: (1) Construction of RT-LAMP reaction system and amplification After extracting the sample to be tested, using the pUC19-PEDV N standard plasmid as a positive control and RNase-Free ddH2O as a negative control, constructing an RT-LAMP reaction system comprising the RT-LAMP detection primer set described in claim 4, performing an RT-LAMP reaction, and obtaining an RT-LAMP amplification product; (2) Determine the results of the sample to be tested After the amplification reaction is completed, the enzyme in the reaction system is inactivated by heating and stored at 4°C for 15 minutes to reduce aerosol pollution. Finally, the result is judged by whether there are ladder-like bands by electrophoresis. After the RT-LAMP reaction system constructed with the sample to be tested as a template is amplified, the electrophoresis results are compared with those of the RT-LAMP reaction system constructed with the positive control and negative control. If the electrophoresis result is consistent with that of the positive control, it means that the sample to be tested is positive, otherwise, it is negative.

10. The RT-LAMP detection method for porcine epidemic diarrhea virus according to claim 9, characterized in that: The RT-LAMP reaction system was: Bst4.0 DNA / RNA enzyme 0.125 μL, MgCl2 1.5 μL, dNTP Mixture 3.5 μL, 10×Isothermo Buffer 2.5 μL, primer premix 2.5 μL, template 1.0 μL, RNase-Free ddH2O 13.875 μL; the RT-LAMP reaction conditions were: 60-65°C, amplification 30-40 min.

Images