RPA (recombinase polymerase amplification) composition and RPA kit for detecting white spot syndrome virus of prawns and application of RPA composition and RPA kit

Abstract

The invention provides an RPA (recombinase polymerase amplification) composition for detecting white spot syndrome virus of prawns and application of the RPA composition. The RPA composition comprises a primer pair and a probe WSSV-P, wherein the primer pair consists of primers WSSV-F and WSSV-R; nucleotide sequences of the primer WSSV-F and the primer WSSV-R are shown as SEQ ID NO.1 and SEQ ID NO.2, an oligonucleotide sequence of the probe WSSV-P is shown as SEQ ID NO.3, the probe sequence comprises a fluorophore FAM and a quenching group BHQ1, the fluorophore FAM and the quenching group BHQ1 are separated by tetrahydrofuran, and the 3'end is modified by C3Spacer. The invention also provides a kit comprising the RPA composition and application of the kit. Meanwhile, the invention further provides a method for detecting the prawn white spot syndrome virus or assisting in detecting the prawn white spot syndrome virus in a non-disease diagnosis purpose. The method has the advantages of simplicity, convenience and rapidness in operation, low requirement on equipment, high specificity and high sensitivity.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an RPA composition, an RPA kit and an application for detecting white spot syndrome virus of prawns. Background Art

[0002] White spot syndrome (WSD) of prawns is a serious viral disease caused by white spot virus (WSSV), which mainly affects crustaceans such as prawns, especially Penaeus vannamei and Penaeus chinensis. This disease is highly contagious, and the symptoms include white spots on the body surface of prawns, slow swimming, loss of appetite, etc., and can cause a large number of deaths in severe cases. Since no effective prevention and treatment drugs have been found yet, establishing an effective method for detecting WSSV, so as to make a diagnosis in time at the early stage of the epidemic and take isolation measures is the key to controlling the spread of the virus.

[0003] The main transmission routes of WSSV are water transmission and through infected feed, equipment, etc. This disease causes serious economic losses to the prawn farming industry. Therefore, early detection and prevention and control measures are crucial. In recent years, researchers have developed a variety of WSSV detection technologies, including pathological observation and immunohistochemical detection, PCR, RT-qPCR, ELISA, etc. Among them, pathological observation and immunohistochemical detection are intuitive, but the technology is complex and the sensitivity is insufficient; ELISA is suitable for large-scale screening, but the sensitivity is low; PCR and RT-qPCR have high sensitivity, but the equipment requirements are high. Therefore, it is necessary to develop a more sensitive, simple, rapid and low equipment requirement detection method to meet the challenges of detecting white spot syndrome virus of prawns.

[0004] Recombinase polymerase amplification (RPA) technology is a new nucleic acid amplification detection technology, which has the advantages of simple operation, rapidity, low equipment requirements, can be carried out at room temperature, high sensitivity, and is suitable for on-site detection.

[0005] Accordingly, an RPA detection method for detecting white spot syndrome virus of prawns can be designed to provide a strong basis for rapid diagnosis and epidemic control. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide an RPA composition, an RPA kit and an application for detecting white spot syndrome virus of prawns. Using this method to detect white spot syndrome virus (white spot virus, WSSV) of prawns has the advantages of simple operation, rapidity, low equipment requirements, strong specificity and high sensitivity, and provides a strong basis for rapid diagnosis and epidemic control.

[0007] The present invention adopts the following technical solutions to solve the above technical problems:

[0008] An RPA composition for detecting white spot syndrome virus of penaeid shrimp, comprising a pair of primers consisting of primer WSSV-F and primer WSSV-R, and a probe WSSV-P; the nucleotide sequence of primer WSSV-F is shown as SEQ ID NO.1, and the nucleotide sequence of primer WSSV-R is shown as SEQ ID NO.2; the oligonucleotide sequence of probe WSSV-P is shown as SEQ ID NO.3, and the probe sequence has a fluorescent group FAM and a quenching group BHQ1, the two groups are separated by tetrahydrofuran, and the 3' end is modified by C3 Spacer, as follows:

[0009] TTGGAACAACTTATCGCCGATCTTGGAAAGG[FAM-dT][THF]A[BHQ1-dT]CGTGAACGAACTGG-C3 Spacer-3’.

[0010] As one of the preferred embodiments of the present invention, the sequences of primer WSSV-F, WSSV-R and probe WSSV-P are all based on the sequence information of white spot virus (WSSV) in Gen Bank, the conserved regions are determined, and then obtained by combining software design.

[0011] An application of the above RPA composition in the preparation of a product for detecting or assisting in detecting whether a virus to be detected is white spot syndrome virus of penaeid shrimp.

[0012] An RPA kit for detecting white spot syndrome virus of penaeid shrimp, comprising the above RPA composition.

[0013] As one of the preferred embodiments of the present invention, it further comprises a positive control, a negative control and reaction reagents for RPA amplification reaction.

[0014] As one of the preferred embodiments of the present invention, the positive control is a white spot virus plasmid.

[0015] As one of the preferred embodiments of the present invention, the negative control is deionized water.

[0016] As one of the preferred embodiments of the present invention, the reaction reagents for RPA amplification reaction are Twist Amp exokit reagents, including Dnase / RNase-free water, buffer, magnesium acetate, etc.

[0017] An application of the above RPA kit in detecting white spot syndrome virus of penaeid shrimp.

[0018] A method for detecting or assisting in the detection of white spot syndrome virus in shrimp for non-diagnostic purposes, using the above-mentioned RPA kit to detect a sample to be tested, the steps are as follows:

[0019] (1) Extract DNA from the sample to be tested;

[0020] (2) Use the extracted DNA as an amplification template and perform an RPA amplification reaction using the RPA kit.

[0021] As one of the preferred embodiments of the present invention, in step (1), a magnetic bead method virus gene rapid extraction kit is used to extract DNA (10 min), dissolve it with ultrapure water, and store it at 4°C for later use.

[0022] As one of the preferred embodiments of the present invention, in step (2), the RPA reaction system is composed of: 2 μl of 10 μmol / L primer WSSV-F, 2 μl of 10 μmol / L primer WSSV-R, 0.6 μl of 10 μmol / L probe WSSV-P, 2 μl of DNA template, 15.9 μl of Dnase / RNase-free water, and 25 μl of buffer to form a premix, which is added to a 0.2 ml Twist Amp exo reaction tube, and then 2.5 μl of magnesium acetate solution is added to the lid of the reaction tube.

[0023] As one of the preferred embodiments of the present invention, in step (2), the RPA amplification reaction conditions are: at an amplification temperature of 35-42°C, amplify for 15-20 min; more preferably, at an amplification temperature of 39°C, amplify for 20 min.

[0024] The advantages of the present invention compared with the prior art are as follows:

[0025] (1) Based on the sequence information of white spot virus (WSSV) in GenBank, the present invention determines the conserved region and designs specific RPA primers and probes in combination with software; using the RPA primers and probes designed by the present invention to detect WSSV in the sample has the advantages of low equipment requirements, strong specificity, and high sensitivity;

[0026] (2) The operation of the present invention is simple, and it only takes 35 minutes from sampling to result presentation, which is convenient for the detection of white spot syndrome virus in shrimp and provides a strong basis for rapid diagnosis and epidemic control. Description of the Drawings

[0027] Figure 1 It is the flow chart of the detection of white spot syndrome virus in shrimp in Example 3;

[0028] Figure 2It is the screening result of the RPA amplification primer pairs for white spot syndrome virus of shrimp in Experimental Example 1 (in the figure, label "1": amplification result of primer pair 1; label "2": amplification result of primer pair 2; label "3": amplification result of primer pair 3; label "4": deionized water negative control result);

[0029] Figure 3 It is the gene position map of primer pair 1 (WSSV-F, WSSV-F) and probe WSSV-P for white spot syndrome virus of shrimp in Experimental Example 1;

[0030] Figure 4 It is the RPA amplification result with different primer concentrations in Experimental Example 2 (in the figure, labels "1 to 4": amplification results with primer addition amounts of 0.5 μl, 1 μl, 1.5 μl, and 2 μl respectively);

[0031] Figure 5 It is the PRA specific detection result for white spot syndrome virus of shrimp in Experimental Example 3 (in the figure, label "1": WSSV RPA reaction result; labels "2 to 5": RPA reaction results of IHHNV, AHPND, EHP, and IMNV samples respectively);

[0032] Figure 6 It is the RPA amplification result using white spot syndrome virus plasmid with different dilution gradients as templates in Experimental Example 4 (in the figure, labels "1 to 7": corresponding to white spot syndrome virus plasmid results with concentrations of 10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 copies / μl; label "8": deionized water negative control result);

[0033] Figure 7 It is the PCR amplification result using white spot syndrome virus plasmid with different dilution gradients as templates in Experimental Example 4 (in the figure, lane "M": DNA Marker; lane "1": deionized water negative control result; lanes "2 to 6": white spot syndrome virus plasmid results with concentrations of 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 copies / μl respectively);

[0034] Figure 8 It is the RPA amplification result of 9 samples in Experimental Example 5 (in the figure, the marks "1-6": samples infected with white spot syndrome virus of shrimp; the mark "7": result of deionized water negative control; the marks "8-10": samples not infected with white spot syndrome virus of shrimp). Specific implementation manners

[0035] The embodiments of the present invention will be described in detail below. These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation manners and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments. At the same time, the reagents, bacterial agents, equipment and experimental methods used in the following embodiments, unless otherwise specified, are all conventional commercially available reagents, bacterial agents, equipment or methods in the art, and will not be elaborated further.

[0036] Embodiment 1

[0037] An RPA composition for detecting white spot syndrome virus of shrimp in this embodiment includes a primer pair composed of primer WSSV-F and primer WSSV-R and a probe WSSV-P. Among them, the nucleotide sequences of primer WSSV-F and WSSV-R are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. The oligonucleotide sequence of probe WSSV-P is shown in SEQ ID NO.3, and the probe sequence has a fluorescent group FAM and a quenching group BHQ1, and the two groups are separated by tetrahydrofuran, and the 3' end is modified by C3 Spacer, as follows:

[0038] TTGGAACAACTTATCGCCGATCTTGGAAAGG[FAM-dT][THF]A[BHQ1-dT]CGTGAACGAACTGG-C3 Spacer-3'.

[0039] Embodiment 2

[0040] An RPA kit for detecting white spot syndrome virus of shrimp in this embodiment includes the RPA composition of Embodiment 1, a positive control product (white spot virus plasmid), a negative control product (deionized water), and a Twist Ampexo kit reagent for RPA amplification reaction.

[0041] Embodiment 3

[0042] A method for detecting or assisting in detecting white spot syndrome virus of shrimp for non-disease diagnosis purposes in this embodiment:

[0043] (1) Prepare a sample infected with white spot syndrome virus (WSSV) of shrimp, and extract hemolymph as a sample to be detected.

[0044] (2) Use a magnetic bead method virus gene rapid extraction kit to extract the WSSV DNA of the sample to be tested according to the operation instructions of the kit. After dissolving it with ultrapure water, store it at 4°C for later use.

[0045] (3) Use the extracted DNA as the amplification template, and perform an RPA amplification reaction using the RPA kit of Example 2.

[0046] The RPA reaction system is composed of: 2 μl of 10 μmol / L primer WSSV-F, 2 μl of 10 μmol / L primer WSSV-R, 0.6 μl of 10 μmol / L probe WSSV-P, 2 μl of DNA template, 15.9 μl of DNase / RNase-free water, and 25 μl of buffer to form a premix. Add it to a 0.2 ml Twist Amp exo reaction tube, and then add 2.5 μl of magnesium acetate solution to the lid of the reaction tube.

[0047] The RPA amplification reaction conditions are: Amplify at 39°C for 20 min.

[0048] The overall process of the detection method for white spot syndrome virus in shrimp in this example is as Figure 1 shown. The whole process takes about 35 minutes, which is time-saving and labor-saving compared with the current WSSV detection methods.

[0049] Experimental Example 1

[0050] This experimental example is used to verify the best selectivity of the RPA primer pairs of the present invention:

[0051] I. Experimental method

[0052] Based on the RPA technology, according to the sequence information of the white spot virus (WSSV) publicly available on Gene bank, highly homologous genomic sequences are selected after alignment, and specific RPA primer pairs and probes are designed.

[0053] A total of 3 groups of different primer pairs (primer pairs 1, 2, 3) and one probe are designed: Each primer pair includes an upstream primer and a downstream primer, and the sequences are shown in Table 1; the probe is WSSV-P, and its oligonucleotide sequence is as shown in SEQ ID NO.3. And there is a fluorescent group FAM and a quenching group BHQ1 in the probe sequence, and the two groups are separated by tetrahydrofuran, and the 3' end is modified by C3Spacer, as follows:

[0054] TTGGAACAACTTATCGCCGATCTTGGAAAGG[FAM-dT][THF]A[BHQ1-dT]CGTGAACGAACTGG-C3 Spacer-3’.

[0055] Table 1 Primer Sequences of White Spot Syndrome Virus of Prawn in RPA

[0056]

[0057] Based on the above different primer pairs, the RPA amplification reaction test of white spot syndrome virus of prawn was carried out, and the amplification method referred to Example 3.

[0058] II. Experimental Results

[0059] The results are as Figure 2 shown. It can be seen from Figure 2 that: the amplification effect of primer pair 1 is the best, and the positions of each primer (primer WSSV-F, WSSV-R) of primer pair 1 and the gene where the probe WSSV-P is located are as Figure 3 shown.

[0060] Experimental Example 2

[0061] This experimental example is used to verify the optimal concentration of the primer in the RPA reaction system for white spot syndrome virus of prawn of the present invention:

[0062] I. Experimental Method

[0063] Referring to Example 3, the sample loading amount of the RPA reaction system remained unchanged. Using the white spot syndrome virus plasmid (WSSV plasmid) of prawn as the template, the primer concentrations were set to 0.5 μl, 1 μl, 1.5 μl, and 2 μl respectively to establish the RPA system for RPA detection. After the reaction tubes were loaded with samples, they were placed in a thermostatic instrument for reaction.

[0064] II. Experimental Results

[0065] The results are as Figure 4 shown. It can be seen from Figure 4 that: using the white spot syndrome virus plasmid of prawn as the template and detecting according to the established RPA system, the amplification efficiency was the highest when the primer concentration was 2 μl. Therefore, the optimal concentration of the primer in the RPA system was determined to be 2 μl.

[0066] Experimental Example 3

[0067] This experimental example is used to verify the specificity of the method of the present invention:

[0068] I. Experimental Method

[0069] Prepare different pathogen samples, namely white spot syndrome virus of prawn (WSSV), infectious hypodermal and hematopoietic necrosis virus (IHHNV), acute hepatopancreatic vibrio (AHPND), Enterocytozoon hepatopenaei (EHP), and infectious myonecrosis virus of prawn (IMNV) (purchased).

[0070] According to the method of Embodiment 3 of the present invention, the DNA of the above samples was used as the amplification template respectively for RPA detection.

[0071] II. Experimental Results

[0072] The results are as Figure 5 shown. It can be Figure 5 seen that for the positive samples of white spot syndrome virus of prawn, the fluorescence signal was significantly enhanced after reacting for a period of time, and no fluorescence signal was detected for other viruses. Therefore, the method of the present invention has strong specificity.

[0073] Experimental Example 4

[0074] This experimental example was used to verify the sensitivity of the method of the present invention:

[0075] I. Experimental Method

[0076] In order to verify the sensitivity of the RPA method established by the present invention, in this experimental example, PCR amplification was carried out using the plasmid of white spot syndrome virus of prawn at different dilution gradients as the template. The PCR amplification reaction system was: 12.5 μl of 2×AceTaq Master Mix, 1 μl each of the upstream and downstream primers (10 μmol / L), 2 μl of DNA template, and finally ddH 2 2O was added to make up to 25 μl. The reaction procedure was pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 30 s, cycling 40 times, and extension at 72°C for 5 min. The PCR amplification products were subjected to 1.5% agarose gel electrophoresis. And RPA reaction was carried out to determine the lowest detection concentration of this method and compare it with the PCR method.

[0077] II. Experimental Results

[0078] The results are as Figure 6 、 Figure 7 shown. The initial concentration of the cloned plasmid nucleic acid of the specific gene fragment of white spot syndrome virus of prawn was 10 7 copies / μl, and it was diluted 10-fold with sterile water. Each sample obtained 7 dilution degrees (10 7 copies / μl, 10 6 copies / μl, 10 5 copies / μl, 10 4 copies / μl, 10 3 copies / μl, 10 2 copies / μl, 10 1 copies / μl). Figure 6 、 Figure 7 The results showed that the lower limit of detection of the cloned plasmid template of the pathogen-specific gene fragment by RPA was 10 1copies / μl( Figure 6 ) while the lower limit of detection by PCR is 10 2 copies / μl( Figure 7 ). Therefore, the method of the present invention has better sensitivity.

[0079] Experimental Example 5

[0080] This experimental example is used to verify the specific application effect of the method of the present invention:

[0081] I. Samples

[0082] 9 samples, including 6 samples infected with white spot syndrome virus of penaeid shrimp and 3 uninfected samples, are all stored and supplied by the laboratory of our company (the materials of white spot syndrome virus of penaeid shrimp are obtained by purchase).

[0083] II. Experimental method

[0084] The above 9 samples are respectively detected and verified according to the method of Example 3 of the present invention (either a dedicated supporting instrument or an ordinary fluorescence PCR instrument can be used). Reaction parameter setting: 39°C for 20 min.

[0085] III. Result analysis

[0086] The results are as Figure 8 shown (in the figure, 1 - 6 are samples infected with white spot syndrome virus of penaeid shrimp, 7 is a negative control of deionized water, and 8 - 10 are uninfected samples of white spot syndrome virus of penaeid shrimp).

[0087] From Figure 8 the results, it can be seen that the detection results are consistent with the known results.

[0088] In summary, when using the method of the present invention to detect white spot syndrome virus of penaeid shrimp, the operation is simple, fast, the equipment requirements are low, the specificity is strong, and the sensitivity is high.

[0089] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. An RPA composition for detecting white spot syndrome virus in shrimp, characterized in that: The method comprises a primer pair consisting of primer WSSV-F and primer WSSV-R and a probe WSSV-P; the nucleotide sequence of the primer WSSV-F is shown in SEQ ID NO.1, and the nucleotide sequence of the primer WSSV-R is shown in SEQ ID NO.2; the oligonucleotide sequence of the probe WSSV-P is shown in SEQ ID NO.3, and the probe sequence has a fluorescent group FAM and a quenching group BHQ1, the two groups are separated by tetrahydrofuran, and the 3' end is modified by C3 Spacer, as shown below: TTGGAACAACTTATCGCCGATCTTGGAAAGG[FAM-dT][THF]A[BHQ1-dT]CGTGAACGAACTGG-C3Spacer-3'.

2. The RPA composition for detecting white spot syndrome virus of shrimp according to claim 1, characterized in that: The sequences of the primers WSSV-F, WSSV-R and the probe WSSV-P are based on the sequence information of white spot virus in Gen Bank, and the conservative regions are determined and then obtained in combination with software design.

3. Use of the RPA composition as described in any one of claims 1 to 2 in the preparation of a product for detecting or assisting in detecting whether the virus to be tested is white spot syndrome virus of shrimp.

4. A RPA kit for detecting white spot syndrome virus in shrimp, characterized in that: Comprising the RPA composition as described in claim 1.

5. The RPA kit for detecting white spot syndrome virus of shrimp according to claim 4, characterized in that: Also included are positive controls, negative controls, and reaction reagents for RPA amplification reactions.

6. The RPA kit for detecting white spot syndrome virus of shrimp according to claim 5, characterized in that: The positive control substance is white spot virus plasmid, and the negative control substance is deionized water.

7. Use of the RPA kit according to any one of claims 4 to 6 in detecting white spot syndrome virus in shrimp.

8. A method for detecting or assisting in detecting white spot syndrome virus in shrimp for non-disease diagnosis purposes, characterized in that: The RPA kit according to any one of claims 4 to 6 is used to detect the sample to be tested, and the steps are as follows: (1) Extracting DNA from the sample to be tested; (2) Using the extracted DNA as an amplification template, and using the RPA kit to perform an RPA amplification reaction.

9. The method for detecting or assisting in detecting white spot syndrome virus in shrimp for non-disease diagnosis purposes according to claim 8, characterized in that: In the step (2), the RPA reaction system is: a premix consisting of 2 μl of 10 μmol / L primer WSSV-F, 2 μl of 10 μmol / L primer WSSV-R, 0.6 μl of 10 μmol / L probe WSSV-P, 2 μl of DNA template, 15.9 μl of DNase-RNase-free water and 25 μl of buffer, which is added to a 0.2 ml Twist Amp exo reaction tube, and then 2.5 μl of magnesium acetate solution is added to the lid of the reaction tube.

10. The method for detecting or assisting in detecting white spot syndrome virus in shrimp for non-disease diagnosis purposes according to claim 8, characterized in that: In the step (2), the RPA amplification reaction conditions are: amplification at a temperature of 35 to 42° C. for 15 to 20 minutes.

Images