DNA walker for HBV DNA detection and construction method thereof
By designing enzyme-free DNA walkers, using gold nanoparticles and specific DNA strand structures, simple and low-cost HBV DNA detection is achieved, solving the problems of medium and high costs and laboratory dependence in the existing technology, and is suitable for HBV DNA screening in low- and middle-income areas.
Patent Information
- Application Number
- CN202510294441.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-13
- Publication Date
- 2025-05-30
AI Technical Summary
The existing HBV DNA detection technology has high costs, requires professional laboratories and trained staff, long testing time, and difficulty in promoting it in low- and middle-income areas.
An enzyme-free DNA walker was designed, which was composed of gold nanoparticles and three specific DNA strands (S1, S2 and LOCK strands). The relaxed loop of HBV DNA is complementary to the LOCK strand, activates the DNAzyme domain, cuts the S2 strand and generates a fluorescent signal, and realizes the detection of HBV DNA.
It realizes simple, low-cost, and no laboratory conditions for HBV DNA detection. It has fast detection speed, high specificity and small sample size, and is suitable for universal screening in low- and middle-income areas.
Smart Images
Figure CN120060569A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of detection, and particularly relates to a DNA walker for HBV DNA detection and a construction method thereof. Background Art
[0002] HBV DNA is an important marker for hepatitis B infection. When infected with HBV, the concentration of HBV DNA in the blood increases, which can range from a few copies / mL to more than 10 9 copies / mL. In addition, even if the hepatitis B surface antigen is positive, it is still necessary to further quantify HBV DNA to determine the eligibility for treatment. Therefore, the concentration of HBV DNA in the blood is an important basis for judging the activity of HBV virus replication and selecting treatment methods.
[0003] Fluorescent quantitative polymerase chain reaction (qPCR) is currently the gold standard for nucleic acid detection in clinical practice. It exponentially amplifies the target through repeated heating cycles, with high sensitivity and specificity. However, qPCR has many deficiencies. It is expensive (about $20 - $130 per test), requires well-equipped laboratory conditions and trained staff, and also requires a long detection time. As an improved strategy for qPCR, many enzyme-mediated isothermal nucleic acid amplification methods have been developed, such as RPA, LAMP, RCA, etc. However, these methods are still in the research stage, there are no kits using these methods, and they still require expensive enzymes, cumbersome operation steps, strict storage conditions, and appropriate primer design, etc., and have not been able to get rid of many deficiencies of qPCR, which is not conducive to popularization under conditions outside the laboratory.
[0004] The drawbacks of qPCR technology and isothermal nucleic acid amplification technology are not a problem in highly developed regions with good medical conditions, but it is very difficult to carry out in medium and low developed regions. However, 95% of HBV-infected people live in low-income and middle-income countries. The lack of HBV screening means results in many of them not knowing their hepatitis B infection status. At the same time, only 12% - 25% of the infected people are eligible for anti-HBV treatment. They are precisely the group that most needs diagnosis and treatment due to insufficient conditions. The World Health Organization emphasizes that the urgent need for simple, low-cost point-of-care testing strategies to evaluate HBV replication has not been met. Developing simple, enzyme-free HBV DNA detection strategies with high specificity and sensitivity is crucial for HBV DNA screening in low- and middle-income regions.
[0005] Some scientific research efforts have attempted to use biosensors to optimize these problems, including simplifying the operation process, reducing detection time, and lowering costs. A biosensor is a compact sensing device made of a biorecognition element, which is fixed on the sensor surface. The sensor converts the physical or chemical changes generated by the interaction between the recognition element and the target on its surface into a measurable or observable reporting signal proportional to the target concentration. Since the entire detection process occurs immediately in the same module without the need for additional steps such as adding reagents or washing, biosensors can obtain answers quickly. Therefore, they have been widely used in scientific research for developing rapid detection methods.
[0006] DNA walker is one of these biosensors and is favored in scientific research due to its excellent signal amplification performance and structural flexibility. A DNA walker consists of three elements: a walking foot, a driving force, and a substrate. First, specific DNA needs to be fixed on the substrate as the track for walking. The walking foot is also specific DNA, which is usually in an inactive state initially. When it is activated, it binds to the track to form a DNA walker. Subsequently, the DNA walker walks under the drive of an external force and is accompanied by the generation of signal molecules. In the design, the number of active walking feet is related to the concentration of the analyte. Within a certain range, the higher the analyte concentration, the more walking feet are activated, the more total steps are taken, and the more signals are generated.
[0007] Rational fabrication of a DNA walking nanomachine on graphene oxide surface for fluorescent bioassay,Biosens Bioelectron,2022,211,114349, discloses the construction of a simple and cost-effective DNA walker on graphene oxide as a two-dimensional planar working platform. This DNA walker is initiated by HBV DNA and driven to walk by exonuclease III. During the walking process, it releases fluorescent signals, which can amplify "one" HBV DNA signal into "multiple" fluorescent signals to achieve the detection of HBV DNA. However, this literature has the following defects: 1. The connection between graphene oxide and the DNA strand is a physical adsorption, and the interaction force of this connection is weak and the stability is insufficient. 2. This DNA walker can be cleaved by exonuclease EXOIII, indicating that it does not have the function of resisting protease cleavage and may be hydrolyzed by other proteases with similar functions, resulting in failure. 3. The detection performance is insufficient. 4. Proteases are used, increasing the storage and preparation costs. 5. This scheme only designs a DNA walker for the HBV DNA fragment and cannot be applied to the full-length sequence of the hepatitis B virus genomic DNA.
[0008] Therefore, the development of a simple, enzyme-free HBV DNA detection system with high specificity and sensitivity is crucial for HBV DNA screening in low- and middle-income regions. Summary of the Invention
[0009] The technical problem to be solved by the present invention is to provide a simple, enzyme-free HBV DNA detection system with high specificity and sensitivity.
[0010] The technical solution of the present invention is: a DNA walker, which includes gold nanoparticles and three DNA strands, namely S1, S2, and LOCK strand. One end of the S1 strand is modified with a thiol group, and the other end has a DNAzyme domain; one end of the S2 strand is modified with a thiol group, and the other end is modified with a fluorescent group, and there is a ribonucleotide in the middle that can be cleaved by the DNAzyme domain; the LOCK strand has an S1 region complementary to S1 and an HBV region complementary to the single-stranded region of the HBV DNA relaxed loop. The length of the S1 region is less than that of the HBV region and partially overlaps. After the LOCK strand is complementary to S1, it can block the activity of the DNAzyme domain; the sequences on both sides of the DNAzyme domain in the S1 strand are complementary to the sequences on both sides of the ribonucleotide in the S2 strand; the S1 strand and the S2 strand are respectively connected to the gold nanoparticles through thiol groups.
[0011] Further, the sequence of the S1 strand is: SH-C6-T(42)-GTTATATGGATGATGTGGTATCTCTTCTCCGAGCCGGTCGAAATAGT; the sequence of the S2 strand is: SH-C6-T(14)-CACTAT rA GGAAGAGAA-FAM; the sequence of the LOCK strand is: AAGAGATACCACATCATCCATATAACTGAAAGCCAA. Where SH is a thiol group, C6 is a spacer with 6 methylene groups, T(42) is 42 T nucleotides, T(14) is 14 T nucleotides, and rA is adenosine ribonucleotide.
[0012] A kit for HBV detection, which contains one or more of the above three DNA strands or gold nanoparticles.
[0013] Further, the kit also contains a HEPES buffer containing Mn 2+ .
[0014] Further, the composition of the HEPES buffer is: 10 mM HEPES, 100 mM NaCl, 6 mM Mn 2+ , pH 8.0.
[0015] The construction method of the above DNA walker includes the following steps:
[0016] (1) Anneal 4 μL of 20 μM S1 strand with 8 μL of 20 μM LOCK strand at 95 °C to construct S1-LOCK;
[0017] (2) Mix the S1-LOCK obtained in step (1) with 20 μL of 20 μM S2 strand, then add 24 μL of 20 mM tris(2-carboxyethyl)phosphine (TCEP), and treat the disulfide bond at room temperature for 1 hour;
[0018] (3) Add the solution treated in step (2) to 1 mL of 1 OD gold nanoparticle solution, then slowly add 0.1 M PB buffer to a final concentration of 0.01 M while gently shaking, and then shake on a shaker for 8 h; the composition of the 0.1 M PB buffer is: 0.1 M NaH 2 PO 4 -Na 2 HPO 4 , 0.05% (v / v) Tween-20, pH 7.0;
[0019] (4) After shaking for 8 hours, add no more than 20 μL of 5 M sodium chloride mother liquor every half hour. After adding, continue to shake. A total of 125 μL needs to be added to a final concentration of 0.5 M, and then continue to shake for more than 16 hours;
[0020] (5) Centrifuge the solution treated in step (4) at 13000 rpm at 4 °C for 30 min, discard the supernatant, wash the precipitate 3 times with PBS, and finally resuspend it with HEPES buffer, and store it in the dark at 4 °C; the composition of the HEPES buffer is: 10 mM HEPES, 100 mM NaCl, 6 mM Mn 2+ , pH 8.0.
[0021] The three DNA strands (S1, S2, LOCK) designed in the present invention target the single-stranded region of HBV DNA, which makes it suitable for directly detecting the target in plasma. In addition, this set of DNA sequences has been optimized to obtain good specificity and efficient amplification performance.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] 1. Inexpensive, with a cost of about 10 yuan per sample.
[0024] 2. Simple operation, only need to mix this product with plasma and wait for a period of time to read the result.
[0025] 3. Without the need for laboratory conditions, this DNA molecular machine can operate at room temperature. When interpreting the results, precise measurements are made using a fluorescence instrument. There are already many portable fluorescence spectrometers available on the market.
[0026] 4. Fast detection speed, and the results can be read out in 30 minutes.
[0027] 5. Small sample volume required. 100 μL of blood can be obtained by finger prick blood sampling without the need for venipuncture.
[0028] 6. Can be used for general screening and can be completed in the hospital outpatient department. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 is a schematic diagram of the working principle of the DNA walker of the present invention;
[0030] Figure 2 is the fluorescence intensity of different DNA fragments;
[0031] Figure 3 is the FAM fluorescence spectrogram generated by different concentrations of tDNA;
[0032] Figure 4 is the calibration curve between the tDNA concentration and the fluorescence intensity. DETAILED DESCRIPTION OF THE INVENTION
[0033] The experimental methods in the following examples are all conventional methods unless otherwise specified. The test materials used in the following examples are all obtained from commercial channels unless otherwise specified.
[0034] The DNA walker of the present invention is composed of gold nanoparticles and three DNA strands (S1, S2, and LOCK strand respectively). Figure 1 In A, it is the construction scheme of the DNA walker. One end of the S1 strand is modified with a thiol group, and the other end has a DNAzyme (deoxyribozyme) domain; one end of the S2 strand is modified with a thiol group, and the other end is modified with a FAM fluorescent group, and there is a ribonucleotide in the middle that can be cleaved by the DNAzyme domain; the LOCK strand has an S1 region complementary to S1 and an HBV region complementary to the single-stranded region of the HBV DNA relaxed loop. The length of the S1 region is less than that of the HBV region and partially overlaps. After the LOCK strand is complementary to S1, it can block the activity of the DNAzyme domain; the sequences on both sides of the DNAzyme domain in the S1 strand are complementary to the sequences on both sides of the ribonucleotide in the S2 strand; the S1 strand and the S2 strand are respectively connected to the gold nanoparticles through thiol groups. Due to the fluorescence resonance energy transfer effect (FRET), when the FAM at the end of S2 is close to (less than 10 nm) the surface of the gold nanoparticles, the fluorescence emitted by FAM is absorbed by the gold nanoparticles, making the initial fluorescence signal in the "off" state.
[0035] The working mode is as follows Figure 1 As shown in B of Figure 1 , when HBV DNA is added, the single-stranded part of its relaxed loop displaces LOCK from S1-LOCK by complementary pairing with the LOCK strand, while restoring the DNAzyme activity on S1. The restored DNAzyme spontaneously pairs with S2, and then, with the assistance of divalent manganese ions, cleaves the DNA-RNA backbone on S2, causing S2 to break in the middle. The FAM at the end of S2 returns to fluorescence as it moves away from the gold nanoparticles. Meanwhile, the pairing between the broken S2 and S1 becomes unstable, causing S1 to detach and move to the next S2, repeating this cycle and generating many fluorescence signals. The higher the concentration of HBV DNA in the analyte, the more walking feet are produced, and the higher the fluorescence intensity generated per unit time. The generated FAM fluorescence signal can be read using a portable fluorescence measurement instrument.
[0036] Example 1 Construction of DNA Walker
[0037] DNA sequences (in the direction of 5’→3’) for constructing the DNA walker:
[0038] S1: SH-C6-T(42)-GTTATATGGATGATGTGGTATCTCTTCTCCGAGCCGGTCGAAATAG T
[0039] S2: SH-C6-T(14)-CACTAT rA GGAAGAGAA-FAM
[0040] LOCK: AAGAGATACCACATCATCCATATAACTGAAAGCCAA
[0041] Buffer (1*HEPES buffer): 10 mM HEPES, 100 mM NaCl, 6 mM Mn 2+ , pH 8.0.
[0042] Experimental conditions: room temperature (25 °C), 30 minutes.
[0043] Method for constructing the DNA walker:
[0044] 1. Anneal 1.4 μL (20 μM) of S1 with 8 μL (20 μM) of the LOCK strand at 95 °C to construct S1-LOCK.
[0045] 2. Mix the above S1-LOCK with 20 μL (20 μM) of S2, and then add 24 μL (20 mM) of TCEP and treat the disulfide bond at room temperature for 1 hour.
[0046] 3. Add the above-prepared solution to 1 mL (1 OD) of gold nanoparticle solution, and then slowly add 0.1 M PB buffer to a final concentration of 0.01 M while gently shaking. Then shake on a shaker for 8 h. The composition of the 0.1 M PB buffer is: 0.1 M NaH 2 PO 4 -Na 2 HPO 4 , 0.05% (v / v) Tween-20, pH 7.0.
[0047] 4. After shaking for 8 h, add no more than 20 μL of 5 M sodium chloride stock solution every half hour. After adding, continue to shake. A total of 125 μL needs to be added to a final concentration of 0.5 M, and then continue to shake for more than 16 h.
[0048] 5. Centrifuge at 13000 rpm at 4 °C for 30 min, discard the supernatant, wash the precipitate 3 times with PBS, and finally resuspend it with 1 mL of HEPES buffer and store it in the dark at 4 °C.
[0049] Example 2 Specificity Test
[0050] To study the specificity of the DNA walker of the present invention, a sequence on the single-stranded region of the HBV DNA relaxed circle was selected as the test sequence (tDNA), and three single-base mismatched target DNAs (mtDNAs) were designed based on tDNA. At the same time, nucleic acid fragments of other hepatitis pathogens (hepatitis A virus HAV, hepatitis C virus HCV) were selected for comparison.
[0051] HBV (tDNA): TTGGCTTTCAGTTATATGGATGATGTGGTA
[0052] mtDNA1: TTGGCTTTCAGTTATATGGATGAT C TGGTA
[0053] mtDNA2: TTGGC A TTCAGTTATATGGATGATGTGGTA
[0054] mtDNA3: TTGGCTTTCAGTTATAT C GATGATGTGGTA
[0055] HCV: GGCGACGCGGGATCGGACGTT
[0056] HAV: GCTAGAGATTTTCCACACACTGACT
[0057] The DNA walker established in Example 1 was used to detect these 6 sequences respectively, and the method was as follows:
[0058] A mixed solution containing 2 nM DNA was prepared in 100 μL HEPES buffer (Blank contained no DNA), added to 100 μL DNA walker, incubated at room temperature for 30 min, and then tested on the machine. The instrument settings were: excitation at a wavelength of 495 nm, and the fluorescence intensity at 522 nm (peak value) was taken as the quantitative basis to draw a bar chart. All experiments were repeated 3 times.
[0059] The results were as Figure 2 shown. Nucleic acids of other pathogens could not cause signal leakage of the DNA walker, and the target with single-base mismatch only produced a slight fluorescence signal, indicating that the DNA walker of the present invention has excellent specificity.
[0060] Example 3 Sensitivity Test
[0061] The DNA walker established in Example 1 was used to detect HBV (tDNA) designed in Example 2 at different concentrations, and the method was as follows:
[0062] A mixed solution containing tDNA at different concentrations was prepared in 100 μL HEPES buffer, added to 100 μL DNA walker, incubated at room temperature for 30 min, and then tested on the machine. The instrument settings were: excitation at a wavelength of 495 nm, collecting the fluorescence intensity from 505 nm to 650 nm, and drawing an absorption spectrum with the wavelength as the abscissa and the fluorescence intensity as the ordinate. All experiments were repeated 3 times.
[0063] The results were as Figure 3 shown. As the concentration of the added tDNA increased, the DNA walker could effectively capture and activate more walking feet, increasing the FAM fluorescence signal generated.
[0064] Quantification was performed using the absorption spectrum at 522 nm, and the quantification results were as Figure 4 shown. Initially, the intensity of the FAM fluorescence signal increased linearly with the increase of the tDNA concentration within a certain range, and then gradually approached saturation. Finally, we determined that there was a good linear relationship between the fluorescence intensity and the tDNA concentration in the range of 5 pM to 250 pM. The linear regression equation obtained after linear fitting was FI = 51.48*C tDNA (pM) + 2339.37 (R 2 = 0.999) (FI represents the fluorescence intensity, C tDNARepresents the concentration of tDNA, in pM). According to the 3σ / k rule, the calculated limit of detection is 5.3 pM (approximately 20,000 IU / mL), which is close to the viral load recommended by the World Health Organization for initiating nucleoside analogue treatment for HBV [Reference: WHO. Guidelines on hepatitis B and C testing. Geneva: WHO; 2017.].
Claims
1. A DNA walker, characterized in that: The walker includes gold nanoparticles and three DNA chains, which are S1, S2 and LOCK chains. One end of the S1 chain is modified with a thiol group, and the other end has a DNAzyme domain; one end of the S2 chain is modified with a thiol group, and the other end is modified with a FAM fluorescent group, and the middle has a ribonucleotide that can be cut by the DNAzyme domain; the LOCK chain has an S1 region complementary to S1 and an HBV region complementary to the single-stranded region of the HBV DNA relaxation loop, the length of the S1 region is shorter than the HBV region and some regions overlap, and the LOCK chain can block the activity of the DNAzyme domain after complementing with S1; the sequences on both sides of the DNAzyme domain in the S1 chain are complementary to the sequences on both sides of the ribonucleotide in the S2 chain; the S1 chain and the S2 chain are respectively connected to the gold nanoparticles through the thiol groups.
2. The DNA walker according to claim 2, characterized in that: The S1 chain sequence is: SH-C6-T(42)-GTTATATGGATGATGTGGTATCTCTTCTCCGAGCCGGTCGAAATAGT; the S2 chain sequence is: SH-C6-T(14)-CACTAT rAGGAAGAGAA-FAM; the LOCK chain sequence is: AAGAGATACCACATCATC CATATAACTGAAAGCCAA, wherein SH is a thiol group, C6 is a spacer with 6 methylene groups, T(42) is 42 T nucleotides, T(14) is 14 T nucleotides, and rA is an adenine ribonucleotide.
3. A kit for HBV detection, characterized in that: The kit comprises one or more of the three DNA chains or gold nanoparticles described in claim 1 or 2.
4. The kit according to claim 3, characterized in that The kit also contains Mn 2+ HEPES buffer.
5. The kit according to claim 4, characterized in that The HEPES buffer composition is: 10 mM HEPES, 100 mM NaCl, 6 mM Mn 2+ , pH 8.
0.
6. The method for constructing a DNA walker according to claim 1 or 2, characterized in that: The steps include: (1) Anneal 4 μL of 20 μM S1 chain and 8 μL of 20 μM LOCK chain at 95°C to construct S1-LOCK; (2) The S1-LOCK obtained in step (1) was mixed with 20 μL of 20 μM S2 chain, and then 24 μL of 20 mM tris(2-carboxyethyl)phosphine was added to treat the disulfide bonds at room temperature for 1 hour; (3) Add 1 mL of 1 OD of gold nanoparticle solution to the solution treated in step (2), then slowly add 0.1 M PB buffer to a final concentration of 0.01 M while gently shaking, and then shake on a shaker for 8 h. The composition of the 0.1 M PB buffer is: 0.1 M NaH2PO4-Na2HPO4, 0.05% (v / v) Tween-20, pH 7.0; (4) After shaking for 8 hours, add no more than 20 μL of 5 M sodium chloride stock solution every half hour, continue shaking after adding, and add a total of 125 μL to a final concentration of 0.5 M, and then continue shaking for more than 16 hours; (5) The solution treated in step (4) was centrifuged at 13000 rpm and 4°C for 30 min, the supernatant was discarded, the precipitate was washed three times with PBS, and finally resuspended with HEPES buffer and stored at 4°C in the dark; the HEPES buffer composition was: 10 mM HEPES, 100 mM NaCl, 6 mM Mn 2+ , pH 8.0.