Construction method of microbial single-cell sequencing library, obtained sequencing library and application of sequencing library

By performing single-cell capture and lysis in the microchamber and constructing a microbial single-cell whole-genome sequencing library with linear amplification method, the problem of inefficient microbial community analysis in the prior art was solved, and the sequencing effect with high purity and high coverage was achieved.

CN120060981AInactive Publication Date: 2025-05-30SHANGHAI TECH UNIV
View PDF 9 Cites 0 Cited by

Patent Information

Application Number
CN202510234983.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2025-05-30
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

The prior art is inefficient in analyzing complex microbial communities, especially due to cell cultureability and resource limitations, making it difficult to achieve high coverage microbial single-cell genome sequencing.

Method used

By achieving single-cell capture, lysis, whole-genome amplification, fragmentation and DNA indexing in the microchamber, combined with linear amplification method, a microbial single-cell whole-genome sequencing library was constructed.

Benefits of technology

Achieving high purity and high coverage of microbial single-cell genome sequencing overcomes the efficiency and resource limitations of the prior art, providing a simplified and scalable method to characterize complex microbial communities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005292512640000091
    Figure BDA0005292512640000091
  • Figure BDA0005292512640000092
    Figure BDA0005292512640000092
  • Figure BDA0005292512640000101
    Figure BDA0005292512640000101
Patent Text Reader

Abstract

The invention provides a construction method of a microbial single-cell sequencing library, the obtained sequencing library and application of the sequencing library. According to the invention, microbial single cell capture, lysis, whole genome amplification, fragmentation and DNA indexing are realized in the microcavity; and then dissolving the microcavity, and placing the DNA in a water phase system for purification and enrichment amplification. According to the invention, the formula of the lysate is optimized, so that microorganisms are fully lysed, and the lysate has no lysis preference; hydrogel microspheres containing bar codes are introduced into DNA indexing, so that the pairing efficiency of hydrogel liquid drops and the bar code microspheres can be remarkably improved; and moreover, the effect of realizing microorganism single cell indexing through a linear amplification mode is obviously superior to that of index amplification. The library is constructed by the method provided by the invention, then sequencing is carried out, and the result shows that the purity of the single cells greater than 95% is 95% or above, and the coverage degree of the microbial single cell genome can reach 80% or above.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microbial single-cell sequencing, and particularly to a method for constructing a microbial single-cell sequencing library, the obtained sequencing library and its applications. Background Art

[0002] Microorganisms are the most abundant and diverse life forms on Earth. Current research shows that there are up to one trillion species of microorganisms, which are widely distributed in natural environments and the human body. However, most microorganisms in ecosystems have not been fully studied and constitute a large part of the "microbial dark matter". Even in the human body, despite the progress of the Human Microbiome Project, the understanding of microbial communities is still limited. To understand these complex biological communities, it is necessary to clarify the biological identity and function of each microbial strain or even individual cells.

[0003] The key determinants of the identity and function of each microbial cell are its genomic information. In existing research, microbial genomic information is usually obtained through the cultivation and sequencing of isolated strains or metagenomic sequencing. However, these methods are inefficient when applied to analyze complex communities: the former is limited by cell culturing ability and resources, while the latter lacks strain-level or genomic resolution. With the latest progress in high-throughput biotechnology, it is now possible to sequence the genomes of individual microbial cells, usually by using microfluidics to isolate cells and then amplifying and indexing each genome separately. However, current methods can only recover a small fraction of individual genomes and are not widely applicable due to the extensive use of continuous microfluidic analysis. There is a need for high-coverage and easy-to-implement methods to characterize complex microbial communities in different environments. Summary of the Invention

[0004] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide a method for constructing a microbial single-cell genomic sequencing library to solve the problems in the prior art.

[0005] To achieve the above object and other related objects, the present invention is obtained through the following technical solutions.

[0006] In the first aspect of the present invention, a method for constructing a microbial single-cell whole-genome sequencing library is provided, including the following steps:

[0007] 1) Provide a microchamber containing a microbial single cell, lyse the single cell, and amplify the whole genome of the microbial single cell;

[0008] 2) Fragment the whole genome in step 1) to obtain a microchamber containing the fragmented genome;

[0009] 3) Add barcode microspheres into the microchambers obtained in step 2) to barcode-label the fragmented genomes, and obtain microchambers containing barcoded whole genomes;

[0010] 4) Dissolve the microchambers obtained in step 3), and then perform enrichment amplification of the whole genome to obtain a single-cell genome sequencing library.

[0011] In some embodiments, the microchambers can be gel microspheres, gel droplets; among them, gel droplets are micro-droplets containing gel materials (such as hydrogels) generated by droplet microfluidics technology. The micro-droplets are completely enclosed microchambers, and become gel microspheres after demulsification. The gel microspheres are permeable microchambers.

[0012] In some embodiments, the method for lysing single cells includes one or more of enzymatic lysis, alkaline lysis, and heat shock method.

[0013] In some embodiments, the enzymes in the enzymatic lysis method can be selected from one or more of Labiase lyase, lysostaphin, lysozyme, mutanolysin, zymolyase, proteinase K, etc.

[0014] In some embodiments, the reagents for lysing single cells include lysis buffer A and lysis buffer B;

[0015] In some embodiments, the step of lysing single cells includes: mixing lysis buffer A and the microchambers for the first lysis, washing, and then adding lysis buffer B for the second lysis;

[0016] In some embodiments, the conditions for the first lysis are 30-43°C, 1300-1800 rpm, and / or 8-16 h;

[0017] In some embodiments, the conditions for the second lysis are 50-65°C, 1300-1800 rpm, and / or 0.5-2 h.

[0018] In some embodiments, the single-cell whole genome amplification in step 1) and the enrichment amplification method in step 4) include but are not limited to exponential amplification or linear amplification, such as PCR, RCA, MALBAC, MDA, LIANTI.

[0019] In some embodiments, the genome fragmentation can be performed by enzymatic fragmentation or non-enzymatic fragmentation.

[0020] In some embodiments, the barcode microspheres include at least one of polyacrylamide microspheres, polystyrene microspheres, polyethylene glycol diacrylate, poly(lactic-co-glycolic acid), agarose microspheres, and magnetic microspheres.

[0021] In some embodiments, when barcoding the fragmented genome in step 3), it includes barcoding the fragmented genome by DNA ligase or single primer amplification;

[0022] In some embodiments, the single primer amplification is linear amplification; the conventional PCR method in the art generally uses exponential amplification. However, due to the special structure of the permeable microchamber, exponential amplification is not applicable in the permeable microchamber because after whole genome amplification, the space in the microchamber is already filled with nucleic acid molecules. At this time, there is no need to increase the yield through exponential amplification. Instead, since the upstream and downstream primers coexist in the restricted space, exponential amplification is more likely to generate primer dimers, resulting in non-specific amplification sequences. Therefore, the present invention innovatively uses linear amplification to achieve microbial single cell indexing, where linear amplification only requires one primer at one end and avoids non-specific amplification.

[0023] In some embodiments, before barcoding the fragmented genome, it further includes the step of detaching the barcodes on the barcode sequence microspheres.

[0024] In some embodiments, the step of detaching the barcodes on the barcode sequence microspheres includes chemical bond cleavage, enzymatic degradation, or ultraviolet light cleavage.

[0025] In some embodiments, the chemical bond includes a disulfide bond.

[0026] In some embodiments, the reagent for chemical bond cleavage includes one or more of DTT, dichloromethane, ethyl acetate, acetone, PBS, and degradation enzymes.

[0027] In some embodiments, before enrichment amplification, it further includes the purification of the barcoded whole genome.

[0028] In the second aspect of the present invention, the present application also provides a microbial single cell whole genome sequencing library, which is constructed by using the construction method described above.

[0029] In the third aspect of the present invention, the present application also provides the application of the sequencing library construction method or the single cell whole genome sequencing library described above in microbial single cell sequencing.

[0030] In the fourth aspect of the present invention, the present application also provides a method for microbial single cell whole genome sequencing, and the method includes:

[0031] a) Constructing a sequencing library according to the sequencing library construction method described above;

[0032] b) Sequencing the sequencing library provided in step a).

[0033] In some embodiments, the sequencing method may be next-generation sequencing or third-generation sequencing.

[0034] In a fifth aspect of the present invention, the present application also provides a product for constructing a microbial single-cell sequencing library, the product comprising the aforementioned barcode microspheres, reagents for lysing single cells, reactants for amplifying the whole genome of microbial single cells, fragmentation reagents, reagents for barcoding the whole genome, and reagents for enriching and amplifying.

[0035] In some embodiments, the product may be one of a kit, a chip, or a detection system.

[0036] In a sixth aspect of the present invention, there is provided the use of the method for constructing a single-cell sequencing library as described above, or the sequencing library as described above, or the method for single-cell whole-genome sequencing as described above, or the product as described above in the preparation of a detection kit, a detection device, or a detection system for microbial research

[0037] Advantageous effects:

[0038] The present invention provides a method for constructing a microbial single-cell genome sequencing library, which realizes single-cell capture, lysis, whole-genome amplification, fragmentation, and DNA indexing in a microchamber; then the microchamber is dissolved, and then genomic purification and enrichment amplification are performed. The present invention optimizes the lysis buffer formulation to enable sufficient lysis of microorganisms without lysis preference; in DNA indexing, hydrogel microspheres containing barcodes are introduced, which can significantly improve the pairing efficiency of hydrogel microspheres and barcode microspheres; and it is creatively found that the effect of single-cell indexing by linear amplification is significantly better than that of exponential amplification.

[0039] Secondly, in the method for constructing a sequencing library of the present invention, microchamber preparation, whole-gene amplification, barcode microsphere preparation, and DNA indexing need to occur in gel droplets, and the remaining steps can be completed by placing the gel microspheres in a solution system; the gel droplets used for whole-gene amplification can also be formed by pipetting, vortexing, etc. This method can significantly reduce the operation difficulty and time on the one hand, and also reduce the microfluidics steps and avoid cross-contamination in the open environment.

[0040] Currently, the whole-genome sequencing technologies for microbial single cells mainly include Sic-seq and Microbe-seq, among which Sic-seq reaches 1% and Microbe-seq reaches 5% - 10%. By constructing a library by the method of the present invention and then performing sequencing, the results show that the purity of more than 95% of single cells is above 95%, and the single-cell genome coverage can reach more than 80%.

[0041] The sequencing library construction method provided by the present invention overcomes the limitations of droplet single-cell genomics, provides a simplified and scalable method for studying microbial communities, and improves genome coverage at the same time. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 It is a schematic diagram of the whole-genome library construction and sequencing process of single microbial cells of the present invention.

[0043] Figure 2 It is a microscope image of microdroplets and hydrogel microchambers in Example 1 of the present invention.

[0044] Figure 3 It is the staining results after embedding (a), lysing (b) and whole-genome amplification (c) of single microbial cells in Example 1.

[0045] Figure 4 It is the verification result of the sequence integrity of hydrogel barcode microspheres, where a is the fluorescence (probe) microscope result and b is the fluorescence intensity statistics.

[0046] Figure 5 It is the microfluidic chip used for single-cell indexing in Example 1 of the present invention, where a is the result of the microfluidic chip, ①-④ are microscopic images of the droplet generation process, and b is the image and statistical histogram of co-embedded droplets.

[0047] Figure 6 It is a microscope image of the co-embedding of hydrogel barcode microspheres and hydrogel microchambers.

[0048] Figure 7 It is the fragment distribution of the single-cell genome sequencing library in Example 1 of the present invention.

[0049] Figure 8 It is the analysis of the single-cell sequencing results in Example 1 of the present invention, where a is the read length distribution, b is the sequence number distribution of different cells, and c is the purity distribution of single cells.

[0050] Figure 9 It is the statistical analysis of the single-cell genome coverage in Example 1 of the present invention.

[0051] Figure 10 It is a schematic diagram of achieving whole-genome amplification by pipetting to form droplets encapsulating hydrogel microspheres.

[0052] Figure 11 It is a comparison of the single-cell purity obtained by performing whole-genome amplification on encapsulated hydrogel microchambers and permeable hydrogel microchambers in an aqueous solution.

[0053] Figure 12 It is a comparison of the single-cell purity and indexing efficiency between exponential amplification and linear amplification.

[0054] Figure 13 The sequencing results by the ligation method: read length distribution (a), sequence number distribution of different cells (b), and single-cell purity distribution (c). Specific implementation manners

[0055] To simplify the library preparation process, improve the purity of microbial single cells and genome coverage, and save time and labor costs, as Figure 1 shown, the present invention provides a method for constructing a whole-genome sequencing library of microbial single cells, comprising the following steps:

[0056] 1) Provide a microchamber containing a microbial single cell, lyse the single cell, and perform whole-genome amplification of the single cell to obtain a microchamber containing the whole genome of the single cell;

[0057] 2) Fragment the whole genome in step 1) to obtain a microchamber containing the fragmented genome;

[0058] 3) Introduce barcode microspheres into the microchamber obtained in step 2) to barcode-label the fragmented genome and obtain a microchamber containing the barcoded-labeled whole genome;

[0059] 4) Dissolve the microchamber obtained in step 3), and then perform enrichment amplification of the whole genome to obtain a whole-genome sequencing library of single cells.

[0060] In some implementation manners, the microorganism can be selected from any one of bacteria, viruses, fungi, actinomycetes, rickettsiae, mycoplasmas, chlamydiae, or spirochetes.

[0061] In some implementation manners, the bacteria can be selected from cultured bacteria or uncultured bacteria; preferably, the cultured bacteria include, but are not limited to, Escherichia coli, Bacillus subtilis, Staphylococcus aureus, and / or Pseudomonas aeruginosa.

[0062] In some implementation manners, the microchamber can be a gel microsphere, a gel droplet (also referred to as a microdroplet); the gel droplet is a microdroplet containing a gel material (such as a hydrogel) generated by droplet microfluidics, blowing method, vortex method, membrane emulsification method, electro-driven method, inkjet printing method, etc.; after demulsification of the microdroplet, it becomes a gel microsphere.

[0063] In the present invention, the relevant reactions carried out in the microchambers in the method for constructing the library can all be completed by a microfluidic chip, or a microfluidic chip can be partially used; when a microfluidic chip is partially used, the preparation of microchambers, the preparation of barcode microspheres, and DNA indexing need to be completed in the microfluidic chip, and the reactions involved therein occur in gel droplets. In addition, whole genome amplification also needs to occur in gel droplets, but the gel droplets used therein can be generated either by a microfluidic chip or by means such as pipetting and vortexing, as long as it is ensured that whole genome amplification occurs in the gel droplets; other steps involving microchambers (such as lysis and fragmentation) can be completed by placing the gel microspheres in the reaction system. In this way, on the one hand, the operation difficulty and time can be significantly reduced, the microfluidic steps are also reduced, and cross-contamination in the open environment is avoided.

[0064] Exemplarily, the present invention provides a method for constructing a microbial single-cell genome sequencing library, comprising the following steps:

[0065] S1) Using a microfluidic chip to capture a microbial single cell, providing a microdroplet containing the microbial single cell, demulsifying to form gel microspheres, lysing the single cell in the gel microspheres, and then using the pipetting method or the vortex method to form the gel microspheres into microdroplets, and performing whole genome amplification of the single cell in the microdroplets to obtain microdroplets containing the whole genome of the single cell;

[0066] S2) Demulsifying the microdroplets obtained containing the whole genome of the single cell to obtain gel microspheres containing the whole genome of the single cell, and then fragmenting the whole genome in the gel microspheres to obtain gel microspheres containing the fragmented genome;

[0067] S3) Using a microfluidic chip to introduce barcode microspheres into the gel microspheres obtained in step S2), and performing barcode labeling on the fragmented genome to obtain microdroplets containing the barcode-labeled whole genome;

[0068] S4) Dissolving the microdroplets obtained in step S3) to make the barcode-labeled whole genome located in the aqueous solution, and then performing enrichment amplification of the whole genome to obtain a single-cell whole genome sequencing library

[0069] In some embodiments, the demulsification method mainly includes chemical methods and physical methods; wherein the chemical methods include using demulsifiers, acidification or alkalization to demulsify the microdroplets, and the demulsifiers include but are not limited to Drop-Surf demulsifier, PFO demulsifier, Drop-Break demulsifier; the physical methods include but are not limited to centrifugation, oscillation, etc.

[0070] In some embodiments, the gel contains a gel polymer.

[0071] In some embodiments, the gel polymer includes at least one or more of Sephadex gel, polyethylene glycol diacrylate gel, polyacrylamide gel, agarose gel, methacrylated gelatin gel, four-arm polyethylene glycol (4-arm-PEG), eight-arm polyethylene glycol (8-arm-PEG), polyethylene glycol-maleimide (peg-maleimide), and thiol-polyethylene glycol (thiol-peg-thiol); preferably two of them.

[0072] The present invention can use high-throughput microdroplet technology to capture a single cell in a droplet containing a gel, and under suitable conditions (including but not limited to UV irradiation, temperature change, pH environment change, etc.), the gel droplet containing the single cell will solidify into a gel microsphere containing the single cell.

[0073] In some embodiments, the lysis operation of a single cell includes but is not limited to the following methods or combinations of the following methods:

[0074] (A1) Enzymatic lysis method, that is, using a specific enzyme to perform a corresponding chemical reaction to lyse the cell and release intracellular DNA;

[0075] (B1) Alkaline lysis method, that is, under specific alkaline conditions (such as pH > 7 and pH ≤ 14), combined with a suitable temperature, to rupture the cell and release intracellular DNA;

[0076] (C1) Heat shock method, that is, repeatedly freezing and thawing the cell to cause cell swelling, resulting in the fragmentation of the cell structure and the release of intracellular DNA.

[0077] For reactions similar to PCR, the lysis step can be omitted, and the denaturation temperature of the PCR reaction can cause the cell to lyse and release intracellular DNA.

[0078] In some embodiments, the lysis is in-situ lysis, for example, directly lysing in a microchamber.

[0079] In some embodiments, the enzyme in the enzymatic lysis method can be selected from one or more of Labiase lyase, lysostaphin, lysozyme, mutanolysin, zymolyase, proteinase K, etc.

[0080] In some embodiments, the reagents for lysing a single cell include lysis solution A and lysis solution B.

[0081] In some embodiments, the lysis solution A includes: lysostaphin, mutanolysin, lysozyme, and zymolyase.

[0082] In some embodiments, the working concentration of lysostaphin is 30 - 50 U / mL; it can also be 30 - 40 U / mL, 40 - 50 U / mL, 30 U / mL, 35 U / mL, 40 U / mL, 45 U / mL or 50 U / mL.

[0083] In some embodiments, the working concentration of mutanolysin is 80 - 120 U / mL; it can also be 80 - 90 U / mL, 90 - 100 U / mL, 100 - 110 U / mL or 110 - 120 U / mL, 80 U / mL, 85 U / mL, 90 U / mL, 95 U / mL, 100 U / mL, 105 U / mL, 110 U / mL, 115 U / mL or 120 U / mL.

[0084] In some embodiments, the working concentration of lysozyme is 0.5 - 4 U / μL, it can also be 0.5 - 1.8 U / μL, 1.8 - 3 U / μL, 3 - 4 U / μL, 0.5 U / μL, 1 U / μL, 1.5 U / μL, 1.8 U / μL, 2 U / μL, 2.5 U / μL, 3 U / μL, 3.5 U / μL or 4 U / μL;

[0085] In some embodiments, the working concentration of zymolyase is 0.005 - 0.02 U / μL, it can also be 0.005 - 0.01 U / μL, 0.01 - 0.02 U / μL, 0.005 U / μL, 0.008 U / μL, 0.01 U / μL, 0.015 U / μL or 0.02 U / μL.

[0086] In some embodiments, the lysis solution A further comprises one or more of NaCl, EDTA, Tris-HCl, Triton X-100.

[0087] In some embodiments, the working concentration of NaCl in the lysis solution A is 30 - 70 mM, it can also be 30 - 40 mM, 40 - 50 mM, 50 - 60 mM or 60 - 70 mM, 30 mM, 40 mM, 45 mM, 50 mM, 55 mM, 60 mM or 70 mM.

[0088] In some embodiments, the working concentration of EDTA in the lysis solution A is 3 - 8 mM, it can also be 3 - 5 mM, 5 - 8 mM, 3 mM, 4 mM, 5 mM, 6 mM, 7 mM or 8 mM.

[0089] In some embodiments, the working concentration of Tris-HCl in the lysis solution A is 5-15 mM; it can also be 5-8 mM, 8-11 mM, 11-15 mM, and can also be 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 mM; preferably, the pH value of the Tris-HCl is 7.5-8.5.

[0090] In some embodiments, the working concentration of Triton X-100 in the lysis solution A is 0.1-1 v / v%; it can also be 0.1-0.3 v / v%, 0.3-0.6 v / v% or 0.6-1 v / v%; it can also be 0.4 v / v%, 0.5 v / v%, 0.6 v / v% or 0.7 v / v%.

[0091] In some embodiments, the volume ratio of the lysis solution A to the microchamber is 1:0.8-1.2; it can also be 1:0.8-1 or 1:1-1.2, and preferably 1:1.

[0092] In some embodiments, the lysis solution B contains proteinase K.

[0093] In some embodiments, the lysis solution B further includes one or more of NaCl, EDTA, Tris-HCl, and SDS.

[0094] In some embodiments, the working concentration of the proteinase K is 0.1-0.5 mg / mL; it can also be 0.1-0.3 mg / mL, 0.3-0.5 mg / mL, and can also be 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL or 0.5 mg / mL.

[0095] In some embodiments, the working concentration of NaCl in the lysis solution B is 80-120 mM, it can also be 80-100 mM, it can also be 100-120 mM, and can also be 80 mM, 90 mM, 100 mM, 110 mM or 120 mM.

[0096] In some embodiments, the working concentration of EDTA in the lysis solution B is 5-15 mM, it can also be 5-10 mM, it can also be 10-15 mM, and can also be 5 mM, 8 mM, 10 mM, 12 mM or 15 mM.

[0097] In some embodiments, the working concentration of Tris-HCl in the lysis buffer B is 5-15 mM; it can also be 5-8 mM, 8-11 mM, or 11-15 mM, and can also be 5 mM, 6 mM, 7 mM, 8 mM, 9 mM, 10 mM, 11 mM, 12 mM, 13 mM, 14 mM, or 15 mM. Preferably, the pH value of the Tris-HCl is 7.5-8.5.

[0098] In some embodiments, the working concentration of SDS in the lysis buffer B is 0.01-2 w / v%; it can also be 0.01-0.5 w / v%, 0.5-1 w / v%, or 1-2 w / v%, and can also be 0.01 w / v%, 0.5 w / v%, 1 w / v%, 1.5 w / v%, or 2 w / v%.

[0099] In some embodiments, the working concentration of proteinase K is 0.1-0.5 mg / mL, it can also be 0.1-0.3 mg / mL, can also be 0.3-0.5 mg / mL, and can also be 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL, or 0.5 mg / mL.

[0100] In some embodiments, the volume ratio of the lysis buffer B to the microchamber is 1:0.8-1.2; it can also be 1:0.8-1, 1:1-1.2, and preferably 1:1.

[0101] In some embodiments, the lysis step includes: mixing the lysis buffer A and the microchamber for the first lysis, washing the microchamber after the first lysis, and then adding the lysis buffer B for the second lysis.

[0102] In some embodiments, the temperature of the first lysis is 30-43 °C, it can also be 30-35 °C, 35-40 °C, 40-43 °C, and can also be 33 °C, 37 °C, 40 °C.

[0103] In some embodiments, the rotation speed of the first lysis is 1300-1800 rpm, it can also be 1300-1400 rpm, 1400-1500 rpm, 1500-1600 rpm, 1600-1800 rpm, and can also be 1400 rpm, 1500 rpm, 1600 rpm.

[0104] In some embodiments, the time of the first lysis is 8-16 h, it can also be 8-10 h, 10-13 h, 13-16 h, and can also be 8 h, 10 h, 12 h, 14 h.

[0105] In some embodiments, the temperature of the second-step lysis is 50-65°C, and it can also be 50-55°C, 55-60°C, 53°C, 55°C, 58°C, 60°C.

[0106] In some embodiments, the rotation speed of the second-step lysis is 1300-1800 rpm, and it can also be 1300-1400 rpm, 1400-1500 rpm, 1500-1600 rpm, 1600-1800 rpm, and it can also be 1400 rpm, 1500 rpm, 1600 rpm.

[0107] In some embodiments, the time of the second-step lysis is 0.5-2 h, and it can also be 0.5-1 h, 1-1.5 h, 1.5-2 h, and it can also be 0.5 h, 1 h, 1.5 h.

[0108] In some embodiments, the microchamber includes an inner layer and an outer layer. The inner layer contains a hydrogel of a first polymer, and the outer layer contains a hydrogel of a second polymer. This structure of the microchamber makes the microchamber a permeable microchamber, that is, macromolecules are retained inside the microchamber, and small molecules can enter and exit, enabling single-cell lysis of microorganisms and DNA release, amplification, fragmentation, etc. inside the microchamber, as well as DNA indexing including but not limited to PCR or enzyme ligation methods. The reagents used for lysis, PCR, or DNA indexing, etc. in this application are all reagents that can enter the microchamber.

[0109] In some embodiments, the first polymer and the second polymer are respectively selected from dextran, high molecular weight polyethylene glycol diacrylate, polyacrylamide gel, agarose gel, methacrylated gelatin gel, 4-arm-PEG, 8-arm-PEG, peg-maleimide, thiol-peg-thiol; and the first polymer and the second polymer are different.

[0110] In some preferred embodiments, the first polymer is Dextran and the second polymer is PEGDA.

[0111] In some specific embodiments, the raw materials for preparing the microchamber include dextran and high molecular weight polyethylene glycol diacrylate.

[0112] In some embodiments, the weight-average molecular weight of the dextran is 10k-2000k, and it can also be 10k-100k, 100k-500k, 500k-1000k, 1000k-1500k, 1500-2000k.

[0113] In some preferred embodiments, the weight-average molecular weight of the high molecular weight polyethylene glycol diacrylate is 1K to 20K, and can also be 1K to 5K, 5K to 10K, 10K to 15K, 15 to 20K; among which the high molecular weight polyethylene glycol diacrylate is usually a solid or waxy semi-solid.

[0114] In some embodiments, the solvent of the dextran and polyethylene glycol diacrylate is a mixture of a DPBS solution of low molecular weight polyethylene glycol diacrylate and an aqueous solution of lithium phenyl(2,4,6-trimethylbenzoyl)phosphate.

[0115] In some embodiments, the weight-average molecular weight of the low molecular weight polyethylene glycol diacrylate is 200 to 900, such as 200, 250, 400, 575, 600, 700, 800 or 900. The low molecular weight polyethylene glycol diacrylate is usually a liquid or viscous liquid.

[0116] In some embodiments, in the solvent, the volume ratio of the DPBS solution of low molecular weight polyethylene glycol diacrylate to the aqueous solution of lithium phenyl(2,4,6-trimethylbenzoyl)phosphate can be 60 to 80:8 to 12; can also be 65 to 75:9 to 11; can also be 73:10.

[0117] In some embodiments, the volume ratio of the polyethylene glycol diacrylate (MW 575) to 1xDPBS can be 2 to 4:60 to 80 (v / v); can also be 3:70 (v / v).

[0118] In some embodiments, the concentration of lithium phenyl-2,4,6-trimethylbenzoylphosphinate in the aqueous solution can be 0.02 to 0.06 g / mL; can also be 0.03 to 0.05 g / mL; can also be 0.02 g / mL, 0.03 g / mL, 0.04 g / mL, 0.05 g / mL, 0.06 g / mL.

[0119] In some embodiments, the concentration of the dextran in the raw materials for preparing the microchamber is 40 to 75 mg / mL; can also be 55 to 70 mg / mL, can also be 40 mg / mL, 45 mg / mL, 50 mg / mL, 55 mg / mL, 60 mg / mL, 66.3 mg / mL, 70 mg / mL, 75 mg / mL.

[0120] In some embodiments, the concentration of the high molecular weight polyethylene glycol diacrylate in the raw materials for preparing the microchambers is 20-50 mg / mL; it can also be 25-45 mg / mL, and can also be 20 mg / mL, 25 mg / mL, 30 mg / mL, 36.1 mg / mL, 40 mg / mL, 45 mg / mL, 50 mg / mL mg / mL.

[0121] In some embodiments, the single-cell whole genome and the enrichment and amplification method in step 4) include but are not limited to exponential amplification or linear amplification. For example, the following amplification methods can be used:

[0122] (A2) PCR (Polymerase chain reaction), for whole genome amplification of single cells using polymerase chain reaction;

[0123] (B2) RCA (rolling circle amplification), rolling circle amplification using a small circular DNA single strand as a template;

[0124] (C2) MALBAC (Multiple Annealing and Looping-Based Amplification Cycles), for multiple annealing circular cycle amplification of single-cell genomes;

[0125] (D2) MDA (Multiple displacement amplification), using random primers and polymerase (including but not limited to phi29 DNA polymerase) to bind to the DNA template and perform whole genome amplification;

[0126] (E2) LIANTI (Linear amplification via transposon insertion), for linear amplification of single-cell genomes by inserting transposons.

[0127] In single-cell whole genome amplification, either exponential amplification or linear amplification can be used, mainly to achieve whole genome amplification; at the same time, during the whole genome DNA reaction, some additional inducers (the types of inducers include but are not limited to pyrophosphatase, etc.) are added to improve the reaction efficiency. When performing in-situ whole genome amplification of single cells, the reactants of the pre-amplification system need to be added to the permeable microchambers, and then whole genome amplification is carried out.

[0128] The term "fragment" in this application refers to any nucleic acid sequence that is shorter than the sequence from which it is derived. Fragments can be of any size, ranging from several megabases and / or kilobases to several nucleotides in length.

[0129] As used herein, the term "fragmentation" refers to any process or method of separating a compound or composition into smaller units. For example, the separation may include, but is not limited to, enzymatic cleavage (i.e., for example, transposase-mediated fragmentation, restriction enzymes acting on nucleic acids or proteases acting on proteins), alkaline hydrolysis, acid hydrolysis, or heat-induced thermal instability.

[0130] In some embodiments, the genomic fragmentation can be performed using enzymatic fragmentation or non-enzymatic fragmentation.

[0131] In some embodiments, the non-enzymatic fragmentation includes, but is not limited to, methods such as sonication fragmentation, high-pressure shearing, alkaline hydrolysis or acid hydrolysis fragmentation, g-tube disruption, etc.

[0132] In some embodiments, preferably, the enzymatic fragmentation is carried out using dsDNA Fragmentase, T7 Endonuclease I, DNase I, or transposase.

[0133] In some embodiments, the whole genome of a single cell can be fragmented to the whole genome level by cleavage with the Tn5 transposase complex; the Tn5 transposase complex consists of a Tn5 transposase protein and a specific DNA sequence (such as the Mosaic End, ME sequence), which bind together to form an active transposon complex. This complex has a special three-dimensional structure and activity, enabling it to break the target DNA sequence and add a DNA sequence to both ends of the fragmented genomic DNA, which can serve as a primer binding site for ligating barcode sequences to the genomic DNA.

[0134] In some embodiments, the barcode microspheres include barcode sequences; when preparing the barcode microspheres, it is necessary to first design 96*96*96 kinds of oligonucleotide chains of 6-9 nt as the barcode tag library, and synthesize three groups of 96 kinds of oligonucleotide sequences in three groups of 96-well plates. During the first round of nucleic acid labeling, the permeable microchambers containing the amplified products of the disrupted microbial single-cell genomes are randomly and evenly distributed into the 96-well plates, and the 96-well plates contain the reagents required for the PCR reaction. Using the PCR reaction, the first-round barcode sequence addition to the microbial single-cell genome is achieved. After the reaction ends, the permeable microchambers are taken out from the 96-well plates and mixed, and the excess oligonucleotide chains that have not been ligated or added to the genome through PCR, as well as the enzymes or metal ions introduced during the reaction process, are removed by washing. After the first round of nucleic acid labeling, the washed permeable microchambers are randomly and evenly distributed into the 96-well plates again for PCR reaction to achieve the second-round barcode sequence addition. After the reaction ends, the permeable microchambers can be taken out from the 96-well plates and mixed, and then the third-round nucleic acid labeling is carried out. After repeating the above steps of random and even distribution, PCR reaction, mixing, and washing, the microbial whole-genome DNA in the permeable microchambers all carry a single barcode tag formed by three rounds of free combination.

[0135] The barcode sequence formed by three rounds of free combination includes: Barcode1 - fixed structure - Barcode2 - fixed structure - Barcode3; the barcode sequence includes alternately arranged fixed structures and variable structures (Barcode1, Barcode2, Barcode3). For example, the fixed structures of the barcode sequence are selected from ACAG, GTCA, TGCC, CCGCT, GTCT, and GTCT, etc. The fixed structures are used to anchor the variable structures of the barcode sequence in subsequent analysis and extract the variable structures of the barcode sequence for single-cell analysis; the variable structure sequence of the barcode sequence is NNNNNNN, and the number of Ns in the sequence depends on the number of single cells to be analyzed to ensure that one barcode sequence corresponds to exactly 1 single cell. If the number of single cells is large, the number of Ns increases. For example, it can be NNNNNN, NNNNNNN, NNNNNNNN, NNNNNNNNN... etc.; where N is A, G, C, or T.

[0136] In some embodiments, the barcode sequence further includes a 5' adapter and a 3' adapter, and the 5' adapter and the 3' adapter contain primer binding sites; for subsequent PCR amplification or sequencing.

[0137] In some embodiments, the sequence of the barcode is TTTCTACACGACGCTCTTCCGATCTNNNNNNNACAGNNNNNNNGTCANNNNNNNGTCTCGTGGGCTC GG.

[0138] In some embodiments, the barcode microspheres include at least one of polyacrylamide microspheres, polystyrene microspheres, polyethylene glycol diacrylate, poly(lactic-co-glycolic acid), agarose microspheres, and magnetic microspheres.

[0139] In some embodiments, when barcoding the fragmented genome in step 3), the fragmented genome is barcoded by ligase or single-primer amplification. For example, a DNA ligase can be used to ligate an oligonucleotide with a barcode to a genomic fragment; or a barcode sequence can be introduced into the genomic fragment by single-primer amplification to barcode the fragmented genome and complete the indexing of the genome.

[0140] In the prior art, introducing a barcode sequence into a genomic fragment by a conventional PCR amplification method (such as exponential amplification) is also included to barcode the fragmented genome. However, due to the special structure of the permeable microchamber, the inventor found that exponential amplification is not applicable in the permeable microchamber because after whole-genome amplification, the space in the microchamber is already filled with nucleic acid molecules, and at this time, there is no need to increase the yield by exponential amplification. Instead, since the upstream and downstream primers coexist in a restricted space, exponential amplification is more likely to generate primer dimers, thus generating non-specific amplification sequences. Therefore, the present invention innovatively adopts a single-primer amplification-linear amplification method to achieve single-cell indexing, which only requires one primer at one end and avoids non-specific amplification.

[0141] When introducing a barcode sequence into a fragment by linear amplification, the barcode microspheres and the permeable microchamber containing the fragmented product of single-cell genomic DNA are co-encapsulated in a droplet, and then the droplet is placed in a PCR instrument for amplification.

[0142] In some embodiments, the linear amplification solution includes DNA polymerase, buffer, ET-SSB, dNTP, or other PCR or ligation reaction reagents.

[0143] In some embodiments, the DNA polymerase includes but is not limited to any one or a combination of two or more of Bst 2.0 warmstart DNA polymerase, Platinum DNA polymerase, vent DNA polymerase, T7 DNA polymerase, T4 DNA polymerase, DNA polymerase I, Sulfolobus DNA polymerase IV, phi29 DNA polymerase, Bst DNA polymerase, Equiphi29 DNA polymerase, DeepVent DNA Polymerase, and Phusion High-Fidelity DNA Polymerase.

[0144] In some embodiments, when the fragmented genome is barcoded, the step of removing the barcode on the barcode sequence microsphere is also included, including but not limited to the step of removing the barcode on the barcode sequence microsphere by chemical bond (such as disulfide bond) cleavage, enzyme degradation and ultraviolet light cutting. For example, DTT (dithiothreitol) can be added to the linear amplification solution to make the disulfide bond breaking reagent to make the index barcode fall off into the microdroplet to barcode the fragmented genome; it can also be dichloromethane, ethyl acetate, acetone, PBS, specific degradation enzymes, light of a specific wavelength, etc. The corresponding method can be selected according to the microsphere material of the barcode microsphere, and the main purpose is to dissolve the barcode microsphere and release the barcode sequence therein.

[0145] In some embodiments, the PCR solution for linear amplification includes: 100-140 μL Phusion High-Fidelity Reaction Buffer, 10-20 μL Phusion High-Fidelity DNA Polymerase, 10-20 μL Deep Vent DNA Polymerase, 10-15 μL ET-SSB, 60-70 μL 10×PCRstabilizer, 60-70 μL 8-12 mM dNTP, and water is added to 340-360 μL.

[0146] In some embodiments, the PCR solution for linear amplification further includes 60-70 μL of 80-120 mM DTT.

[0147] In some embodiments, the primer for linear amplification is a primer sequence, which can be located on the barcode microsphere or added together with the PCR reaction system, without special limitation; illustratively, the primer sequence in the present invention is located on the barcode microsphere.

[0148] In some embodiments, the conditions for the linear amplification reaction are: initial denaturation, cycling stage (denaturation, annealing, extension), and final extension.

[0149] In some preferred embodiments, the conditions for the linear amplification are as follows: 70 - 74 °C for 4 - 6 min; 96 - 99 °C for 2 - 4 min; 96 - 99 °C for 8 - 12 s, 58 - 62 °C for 28 - 32 s, 70 - 74 °C for 4 - 6 min for 14 - 16 cycles; hold at 3 - 6 °C.

[0150] In some embodiments, when barcoding fragmented genomes with DNA ligase, specifically, the genomic sequences of single cells and barcode sequences are ligated by DNA ligase.

[0151] In some embodiments, the DNA ligase is T7 DNA ligase, T4 DNA ligase, E. coli DNA ligase, etc.

[0152] In some embodiments, when using the ligase method to barcode fragmented genomes, this method usually also requires prior fragmentation of DNA (such as enzymatic digestion or mechanical shearing). When using the Tn5 transposase complex for fragmentation, phosphorylated modified primers can be used during the preparation of the Tn5 transposase complex; when preparing barcode microspheres, the primers used are phosphorylated during the last round of barcode sequence synthesis; further increasing the stability and ligation efficiency of the primers.

[0153] In some embodiments, in step 3), the barcode microspheres and the microchambers containing the fragmented genomic products are co - encapsulated in droplets for ligation reaction, thereby enabling indexing of the genomic DNA in the permeable microchambers.

[0154] In some embodiments, the methods for dissolving the microchambers obtained in step 4) include but are not limited to chemical dissolution methods, physical methods, electric field or magnetic field assistance, etc.; specifically, the chemical dissolution method is to introduce chemical reagents into the microfluidic chip to cause chemical reactions in the components of the microdroplets, thereby achieving dissolution. For example, using strong alkaline solutions such as sodium hydroxide can dissolve certain organic - phase microdroplets. In addition, by adjusting the polarity or acidity - alkalinity of the solvent, the dissolution of microdroplets can also be accelerated.

[0155] In some embodiments, before enrichment amplification in step 4), purification of the barcoded whole genome is also included, and the purification methods include but are not limited to methods such as using commercial purification kits; it can be column purification reagents, magnetic bead purification reagents, gel electrophoresis reagents, etc.

[0156] In some embodiments, the enrichment amplification includes, but is not limited to, exponential amplification or linear amplification; preferably exponential amplification, which can generate a large amount of target nucleic acid in a short time; the linear amplification product is further enriched by enrichment amplification. At this time, during enrichment amplification, the DNA is in an aqueous solution, no longer in a restricted space, and at the same time, in order to obtain a higher yield of nucleic acid to meet the sequencing requirements, a relatively large amount of DNA template is required for sequencing. For example, generally 400 ng of DNA is required for a single sequencing, and it can be adjusted according to the DNA template amount required by the sequencing platform.

[0157] In some embodiments, the reaction system for exponential amplification includes: DNA template, forward primer, reverse primer, DNA polymerase, dNTP mixture, buffer, and other PCR amplification reagents.

[0158] In some embodiments, after enrichment amplification, it further includes the step of ligating the DNA fragment with an adapter sequence. The adapter sequence includes, but is not limited to, the common Read 1 and Read 2 adapter sequences of the Nextera sequencing platform, the common P5 and P7 adapter sequences of the Illumina sequencing platform, self-designed adapter sequences, etc., for the Nextera sequencing platform. After the adapter sequence is added, size selection and library purification of the sequencing library can also be performed. The selection methods include, but are not limited to: purification columns, magnetic beads, gel electrophoresis, etc. After library construction and sequencing, metagenomics analysis that can identify individual genomes can be performed.

[0159] In some embodiments, the sequencing adapter can be a second-generation sequencing adapter or a third-generation sequencing adapter.

[0160] This application also provides a method for single-cell genome sequencing, and the method includes:

[0161] a) Constructing a sequencing library according to the above-mentioned sequencing library construction method;

[0162] b) Sequencing the sequencing library provided in step a).

[0163] In some embodiments, the sequencing method can be second-generation sequencing or third-generation sequencing.

[0164] This application also provides a product for constructing a single-cell sequencing library, and the product includes barcode microspheres suitable for the above-mentioned sequencing library, single-cell whole-genome amplification reagents, indexing reagents, and enrichment amplification reactants.

[0165] In some embodiments, the indexing reagent includes a linear amplification reagent or a DNA ligase.

[0166] In some embodiments, the product further includes lysis buffer, fragmentation-related reagents, raw materials for microchamber preparation, etc.

[0167] In some embodiments, the product can be one of a kit, a chip, or a detection system; the chip is preferably a microfluidic chip.

[0168] In some embodiments, the single cell is a single microbial cell.

[0169] In some embodiments, the microorganism is a single strain or a mixed strain; the mixed strain includes a mixture of two or more strains.

[0170] The following specific embodiments illustrate the embodiments of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification.

[0171] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are for the purpose of describing specific embodiments, rather than limiting the protection scope of the present invention. The test methods without specific conditions noted in the following examples are generally carried out under conventional conditions or according to the conditions recommended by each manufacturer.

[0172] When the embodiments give a numerical range, it should be understood that unless otherwise specified in the present invention, any value between the two endpoints of each numerical range and either endpoint can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices, and materials similar to or equivalent to those described in the embodiments of the present invention can also be used to implement the present invention.

[0173] The unit w / v involved in the present invention refers to the ratio of mass to volume, where the mass unit is g and the volume unit is mL, expressed as grams per milliliter (g / mL); for example, 1 w / v% means 1 g of substance is contained in 100 mL of solution.

[0174] In the present invention, unless otherwise specified, the nucleic acid sequences involved are all described in the direction from the 5' end to the 3' end by default.

[0175] Examples 1 to 3

[0176] This example performs whole-genome amplification, indexing, and library construction of single microbial cells on an artificial mixed strain sample (equal proportion mixture of Escherichia coli and Bacillus subtilis); specifically includes the following steps:

[0177] Prepare the required solution according to the following recipe:

[0178] Add 700 μl of DPBS, 0.055 g of Dextran, 0.03 g of PEGDA(8K), 30 μl of PEGDA(575), and 100 μl of 4 w / v% LAP (lithium phenyl(2,4,6-trimethylbenzoyl)phosphate) into a centrifuge tube. Dissolve and mix, then centrifuge (centrifuge at 16000 g at room temperature for 30 min). Then phase separation occurs. Pipette the upper PEGDA-rich layer and the lower Dextran-rich layer into two new 1.5-ml centrifuge tubes respectively.

[0179] Place Escherichia coli and Bacillus subtilis in LB (Luria-Bertani) culture medium and incubate at a constant temperature of 37 °C for 12 h. Then transfer 10 μl of the bacterial solution to fresh LB culture medium respectively and incubate at a constant temperature of 37 °C for 16 h. Then collect 1 ml of Escherichia coli bacterial solution and Bacillus subtilis bacterial solution into 1.5-ml centrifuge tubes respectively. Centrifuge at 5000 rpm for 2 min to remove the supernatant. Then add DPBS buffer to wash and centrifuge again to remove the supernatant. Resuspend the bacterial solution with DPBS buffer. Transfer 200 μl of the bacterial suspension to a 96-well plate respectively. Measure the absorbance at 600 nm with a microplate reader. Calculate the number of Escherichia coli and Bacillus subtilis respectively according to the relationship between the bacterial concentration and the absorbance (OD600 = 0.93, corresponding bacterial amount is 9.3×10 8 CFU / ml). Take the same number of bacteria and mix them with 200 μl of Dextran-rich to make the final concentration 2000 bacteria / μL.

[0180] Use a microfluidic droplet generation chip to input the Dextran-rich containing Escherichia coli and Bacillus subtilis and the PEGDA-rich not containing the mixed bacterial solution of Escherichia coli and Bacillus subtilis into the corresponding channels on the chip. Utilize the high-throughput microdroplet technology to generate microdroplets (completely enclosed microchambers) encapsulating single microbial cells. Among them, the microdroplets include an outer PEGDA-rich layer and an inner Dextran-rich layer. The inner layer contains the mixed bacterial solution of Escherichia coli and Bacillus subtilis. Collect the microdroplets into a sterile centrifuge tube and irradiate them with ultraviolet light at a wavelength of 365 - 370 nm for 2 min. Use PFO to demulsify the droplets. After the microdroplets are demulsified, hydrogel microspheres (permeable microchambers, also called hydrogel microchambers) are formed. The microscope images of the microdroplets and the hydrogel microchambers are shown in Figure 2; After washing three times with DPBS buffer containing 0.1 v / v% tween-20, collect the permeable microchambers containing single microbial cells. Take out 9.5 μL from them and mix it with 0.5 μL SYBR Green solution, observe under a fluorescence microscope, and take fluorescence photos under the excitation light with a wavelength of 488 nm( Figure 3 a).

[0181] The single microbial cells in the permeable hydrogel microchambers were lysed step by step by enzymatic lysis method. Prepare lysis reagents A and B according to Table 1 and Table 2 respectively. First, transfer 500 μL of the hydrogel microchambers embedding single microbial cells to a new 1.5 mL centrifuge tube, and add 500 μL of lysis reagent A. Carry out overnight lysis reaction at 37 °C and 1500 rpm in a thermostatic mixer to complete the first lysis reaction; Subsequently, wash the hydrogel microchambers after the first lysis with DPBS buffer containing 0.1% (v / v) Tween, and then add 500 μL of lysis reagent B. React at 55 °C and 1500 rpm in a thermostatic mixer for 1 hour to achieve the lysis of single microbial cells in the hydrogel microchambers. Then wash the hydrogel microchambers repeatedly with Tris-EDTA (pH 8.0) buffer containing 0.1% (v / v) Tween and store at 4 °C for subsequent amplification reaction. Then take out 9.5 μL of the hydrogel microchambers from them and mix it with 0.5 μL SYBR Green solution, observe under a fluorescence microscope, and take fluorescence photos under the excitation light with a wavelength of 488 nm( Figure 3 b).

[0182] Table 1 Lysis solution A for single microbial cells in hydrogel microchambers

[0183]

[0184] Table 2 Lysis solution B for single microbial cells in hydrogel microchambers

[0185]

[0186] Genome-wide amplification was carried out in the hydrogel microchambers:

[0187] Genome-wide amplification after droplet encapsulation of hydrogel microchambers: In order to prevent cross-contamination among different hydrogel microchambers during the amplification process, the method of pipetting and blowing was adopted, such as Figure 10As shown, after mixing the hydrogel microchambers embedding single microbial cell genomes after lysis with the whole genome amplification reagents, pipetting is carried out using a pipette gun to form monodisperse droplets (monodisperse droplets can also be formed by vortexing, etc.). The single microbial genome inside the hydrogel microchamber undergoes whole genome amplification in an isolated environment, greatly improving the purity of sequencing and simplifying the operation steps. The specific operation method is as follows:

[0188] First, prepare the reagents for whole genome amplification of single microbial cells in the hydrogel microchamber according to Table 3. Add 300 μL of whole genome amplification reagents to 300 μL of hydrogel microchambers, pipette and mix well, and let it stand for 1 minute to allow the whole genome amplification reagents to freely diffuse from the outside to the inside of the hydrogel microchamber. Subsequently, centrifuge for 1 minute using a tabletop centrifuge. After removing the excess upper liquid, add 600 μL of droplet generation oil, pipette for 2 minutes using a 200 μL pipette. After observing the formation of monodisperse droplets, transfer the droplets to a 30 °C thermostat and react for 2 hours. Subsequently, place it at 65 °C for 10 minutes to terminate the amplification reaction. Then, take out 9.5 μL of the reaction product and mix it with 0.5 μL of SYBR Green solution, and observe it under a fluorescence microscope and take fluorescence photos under the excitation light with a wavelength of 488 nm ( Figure 3 c).

[0189] Table 3 Reaction system for whole genome amplification of single microbial cells in hydrogel microchambers

[0190]

[0191]

[0192] Fragmentation: Demulsify the droplets using PFO, wash three times with DPBS buffer containing 0.1 v / v% tween-20, and collect the permeable hydrogel microchambers containing the whole genome of single microbial cells. Then, prepare the reaction system for fragmenting the whole genome amplification products according to Table 4. The reagents for fragmentation are from Novoprotein's DNA LibraryPrep Kit V2 for Illumina kit. Add 100 μL of hydrogel microchambers containing the whole genome amplification products of single microbial cells to the reagents for fragmentation. Tn transposase inserts into the DNA strand, randomly breaks (Novoprotein TD501) the whole genome amplification products, and inserts the carried adapter sequences into the nucleic acid sequences of the substrates, providing primer binding sites. Subsequently, place the centrifuge tube on a thermostatic mixer and react at 55 °C and 1500 rpm for 30 minutes. After the reaction, the hydrogel microchambers after fragmenting the whole genome amplification products are washed three times with the cleaning reagents and stored at 4 °C for subsequent single cell indexing operations.

[0193] Table 4 Fragmentation reaction system of microbial single-cell whole-genome amplification products in hydrogel microchambers

[0194] System components Volume (μL) 5×TTBL 40 TTE V50 20 Nuclease-Free Water 40 Total 100

[0195] Preparation of barcode microspheres:

[0196] Prepare the polyacrylamide hydrogel precursor solution: Add 30 μl of H 2 O, 100 μl of TBEST buffer, 150 μl of 40 w / v% acrylamide, 490 μl of 0.8 w / v% N,N'-bis(acryloyl)cystamine, 30 μl of 10 w / v% ammonium persulfate, and 200 μl of 250 μM acrylamide group Acrydite monomer-modified primer (acrydite-TTTCTACACGACGCTCTTCCGATCT (SEQ ID NO.1)) to a 1.5 ml centrifuge tube.

[0197] Using a microfluidic chip, add the hydrogel precursor solution to the corresponding channels, collect the droplets, and let them stand at room temperature for 6 h. After gelation, demulsify to obtain hydrogel microspheres.

[0198] Subsequently, use the method of average random assignment-mixing (split-pool) to hybridize a single oligonucleotide sequence to the hydrogel microspheres. Then, through three rounds of split-pool, in each round of ligation reaction, an oligonucleotide sequence is added to the hydrogel microspheres. After three reactions, the single sequence formed inside the hydrogel microspheres is the barcode sequence; the barcode sequence is:

[0199] TTTCTACACGACGCTCTTCCGATCTNNNNNNNACAGNNNNNNNGTCANNNNNNNGTCTCGTGGGCTCGG (SEQ ID NO.2), where NNNNNNN is the unique barcode sequence; the three segments of NNNNNNN are borcade1, borcade2, and borcade3 respectively. The sequence of borcade1 refers to BC1_A01-BC1_H12 in the following table, the sequence of borcade2 refers to BC2_A01-BC2_H12 in the following table, and the sequence of borcade3 refers to BC3_A01-BC3_H12 in the following table.

[0200] Table 5 Oligonucleotide sequences for the ligation reaction of hydrogel barcode microspheres

[0201]

[0202]

[0203] Among them, the steps of split-pool

[0204] Specifically as follows: First, perform the ligation of the first-round oligonucleotide sequences on the hydrogel barcode microspheres: Transfer the collected hydrogel microspheres evenly into 4 15-mL centrifuge tubes, with the volume of microspheres in each tube being approximately 5 mL. Wash the hydrogel microspheres with HBW. Each time when washing, centrifuge at 1,000×g for 3 minutes using a centrifuge, carefully remove the supernatant. Repeat this washing step three times. Combine the washed hydrogel microspheres into a 15-mL centrifuge tube. Subsequently, rinse the residual hydrogel microspheres on the wall of the previous 15-mL centrifuge tube with HBW, transfer the hydrogel microspheres on the wall to the 15-mL centrifuge tube, and centrifuge at 1,000×g for 1 minute to remove the supernatant, obtaining approximately 12 mL of hydrogel microspheres for subsequent experiments. Then, add 2.9 mL of 10×Isothermal Amplification Buffer into the centrifuge tube and vortex thoroughly to mix evenly. Then centrifuge at 1,000×g for 1 minute and remove the supernatant. Due to the influence of high ionic concentration, the hydrogel microspheres will lose water inside, and finally approximately 9.4 mL of hydrogel microspheres are left. Subsequently, prepare the hydrogel microsphere premix according to Table 6 and transfer it to a 25-mL sample loading slot.

[0205] Table 6 Hydrogel microsphere premix

[0206] System components Volume (mL) Nuclease-Free Water 2.3 Hydrogel microspheres 9.4 10 mM dNTP 1 Total 12.5

[0207] Table 7 Hybridization program for the preparation process of hydrogel barcode microspheres

[0208]

[0209]

[0210] Subsequently, use a multi-channel pipette to transfer the hydrogel microsphere premix in the sample addition groove to a round-bottom 96-well plate, with a sample addition volume of 35 μL per well; then, take out the 96-well plate containing the first ligation primer (the first ligation primer is CTGTNNNNNNNAGAT (SEQ ID NO. 3)), place it in a PCR instrument, and react at 70 °C (hot lid at 105 °C) for 40 s. The purpose of this step is to denature the primer dimers. Subsequently, transfer the primer 96-well plate to 4 °C and hold for 20 s; then, use a multi-channel pipette to add samples in the order of the numbers on the well plate, transfer 30 μL of the hydrogel microsphere premix to a new 96-well PCR plate, and at the same time add 13.5 μL of the oligonucleotide (10 μM) from the primer 96-well plate to each well (the oligonucleotide in the first ligation is barocde1, and barocde2 and barocde3 in the subsequent two repeated experiments respectively). After thorough mixing, place the 96-well PCR plate in the PCR instrument, set the program according to Table 7, and perform the hybridization reaction.

[0211] While the hybridization reaction is in progress, prepare the premix required for isothermal amplification according to Table 8. During the preparation process, invert the centrifuge tube 15 times to mix evenly. After preparation, transfer the premix to a 25 mL sample addition groove and place it on ice. Use a multi-channel pipettor to add the isothermal amplification premix to a new round-bottom 96-well plate, with 20 μL of premix added to each well; take out the 96-well PCR plate after the hybridization reaction, use a multi-channel pipette to transfer 15 μL of the isothermal amplification premix to the 96-well PCR plate, pipette and mix well, then place the PCR plate on the PCR instrument and react at 60 °C for 1 hour to complete the primer extension after hybridization. After the hybridization extension reaction is completed, add 40 μL of HBW (10 mM Tris-HCl, ph8.0, 400 μM EDTA, 0.1% Tween-20 (v / v)) buffer to each well of the 96-well PCR plate to resuspend the hydrogel microspheres, and transfer all the liquid in the well to a 15 mL centrifuge tube. Transfer the centrifuge tube to a centrifuge and centrifuge at a speed of 300 × g for 15 minutes to collect the lower-layer hydrogel microspheres. Wash the hydrogel microspheres with HBW buffer. When washing, add HBW buffer to the 15 mL centrifuge tube, rotate and incubate at room temperature for 15 minutes, transfer to the centrifuge, and centrifuge at a speed of 300 × g for 3 minutes. After taking out the supernatant, repeat this step 3 times; the washed hydrogel microspheres can be stored briefly at 4 °C.

[0212] Table 8 Isothermal amplification premix in the preparation process of hydrogel barcode microspheres

[0213] System components Volume (mL) Nuclease-Free Water 6.85 10×isothermal amplification buffer 0.8 Bst 2.0 DNA polymerase (8,000 U / ml) 0.35 Total 8

[0214] After completion, all the hydrogel microspheres are mixed, washed, and the excess reagents are removed. Subsequently, the double-stranded nucleic acids on the barcode microspheres need to be denatured. Specifically: 5 mL of denaturation buffer (150 mM NaOH, 0.5% (w / w) Brij-35) is added to the hydrogel microspheres, and the reaction is carried out at room temperature for 10 minutes. Then, it is centrifuged at a speed of 300×g for 3 minutes to remove the supernatant. Subsequently, the hydrogel microspheres are washed again with the denaturation buffer. After adding the denaturation buffer to resuspend the hydrogel microspheres, they are incubated at room temperature for 1 minute, centrifuged at a speed of 300×g for 3 minutes, and the supernatant is discarded. This washing step is repeated three times. Subsequently, the hydrogel microspheres are washed twice more with the neutralization buffer. Finally, the hydrogel microspheres are washed with TET buffer, centrifuged at a speed of 1,000×g for 3 minutes to remove the supernatant, and this step is repeated 3 times to remove the excess oligonucleotide sequences, leaving only the oligonucleotides linked to the hydrogel microspheres. Thus, after the first round of ligation is completed, repeating it twice can complete the preparation of the barcode microspheres. The primer for the second ligation is TGACNNNNNNNCTGT (SEQ ID NO.4), and the primer for the third ligation is CCGAGCCCACGAGACNNNNNNNTGAC (SEQ ID NO.5).

[0215] When all the barcode sequences on the hydrogel microspheres are synthesized, the excess non-complete oligonucleotide chains need to be removed by enzymatic digestion. The specific operation is as follows: The prepared barcode microspheres are transferred to a 15 mL centrifuge tube, and the enzymatic digestion washing premix prepared according to Table 9 is added, and the reaction is carried out at 37 °C for 2 hours. After the reaction is completed, it is centrifuged at 300×g for 3 minutes using a centrifuge to remove the supernatant, and the barcode microspheres are collected.

[0216] Table 9 Enzymatic digestion washing premix

[0217]

[0218]

[0219] Next, the barcode microspheres are resuspended with the hybridization buffer and vortexed thoroughly. Subsequently, it is centrifuged at a speed of 1,000×g for 3 minutes, and the supernatant is carefully removed. This washing step is repeated three times. Then, the barcode microspheres are transferred to a 50 mL centrifuge tube, and the hybridization buffer is added to a volume of 22.5 mL. At the same time, 500 μL of the enzymatic digestion protection sequence (CCGAGCCCACGAGAC) with a concentration of 1 mM is added to the centrifuge tube, and it is thoroughly mixed and placed on a rotary mixer to react in the dark at room temperature for 30 minutes. The purpose of this step is to form double-strands between the complete barcode sequences inside the hydrogel microspheres and the added protection sequence to avoid being excised by the subsequent endonuclease ExoI.

[0220] Subsequently, the hydrogel barcode microspheres after sufficient hybridization were used to prepare an endonuclease reaction system according to Table 10. After preparation, the system was placed on a rotary mixer at room temperature and reacted for two hours in the dark. After the reaction ended, 17 mL of STOP-25 (10 mM Tris-HCl (pH 8.0), 25 mM EDTA, 0.1% (v / v) Tween-20, 0.1 M KCl) buffer was added to terminate the digestion reaction. Subsequently, a denaturing buffer was used to remove the added protective sequences on the microspheres. Finally, the filtered barcode microspheres were resuspended in Tris-EDTA buffer and stored at 4°C in the dark.

[0221] Table 10 Endonuclease reaction system

[0222] System components Volume (mL) Hydrogel barcode microspheres 11.5 10×ExoI buffer 3.3 Nuclease-Free Water 18 ExoI (20 U / μL) 0.44 Total 33

[0223] After the synthesis of the hydrogel barcode microspheres, a fluorescence probe was used to verify the integrity of the barcode sequences on the microspheres. The designed probe sequences are shown in Table 11.

[0224] Table 11 Probe sequences for quality control of hydrogel barcode microspheres

[0225] Name Sequence (5’-3’) Specific probe L1 (probe-a) FAM-GGAAGAGCGTCGTGTAG (SEQ ID NO.6) Specific probe L2 (probe-b) FAM-AGATCGGAAGAGCG (SEQ ID NO.7) Specific probe L3 (probe-c) FAM-CCGAGCCCACGAGAC (SEQ ID NO.8) Non-specific probe (probe-n) FAM-TCTGACGCTCAAATCAGTGG (SEQ ID NO.9)

[0226] Specific operation: First, 1.4 mL of QC buffer was mixed with 40 μL of hydrogel barcode microspheres, and then centrifuged at 1,000×g for 1 minute. The supernatant was carefully removed. Subsequently, 120 μL of QC buffer was added to resuspend the hydrogel microspheres. 36 μL of the solution containing hydrogel microspheres was transferred to 4 new 1.5 mL centrifuge tubes respectively. 4 μL of 4 kinds of probe solutions with a concentration of 100 μM were added to the centrifuge tubes, vortexed and mixed evenly, and reacted at room temperature in the dark for 20 minutes. After the reaction ended, it was washed 3 times with QC buffer. Each time during washing, it was centrifuged at 1,000×g for 1 minute and the supernatant was carefully removed. After the last step of washing, the hydrogel microspheres were resuspended with 20 μL. Subsequently, 10 μL of the hydrogel microsphere suspension was transferred to Countess TM Cell Counting Chamber Slides, and the fluorescence intensity distribution of the hydrogel microspheres was observed using a confocal microscope ( Figure 4 a), and the fluorescence intensity of the image was collected using image J ( Figure 4 b). Through the fluorescence difference after fluorescence probe hybridization ( Figure 4 ), it was proved that the fragmentation reaction in the hydrogel microchamber proceeded normally.

[0227] Single-cell indexing: At Figure 5The red part structure of the a-chip wraps polyacrylamide microspheres carrying barcodes and water in droplets, and the black part structure of the chip wraps permeable hydrogel microchambers containing fragmented products of single-cell genomic DNA and a PCR solution (containing DTT) in droplets. The two droplets meet and pair in a 1:1 ratio, and the pairing efficiency can reach 77%( Figure 5 b) After applying an electric field for fusion, finally, the barcode microspheres and the permeable hydrogel microchambers are co-wrapped in a single droplet( Figure 6 ) Figure 5 In ①-④, high-speed cameras were used to capture images of the hydrogel embedding and droplet fusion processes, and then the droplets were placed in a PCR instrument for amplification.

[0228] Table 12 PCR solution for linear amplification

[0229] System components Volume (μL) Phusion High-Fidelity Reaction Buffer (M0530L, NEB) 120 Phusion High-Fidelity DNA Polymerase (M0530L, NEB) 16 Deep Vent DNA Polymerase (M0258L, NEB) 16 ET-SSB (M2401S, NEB) 12 100 mM DTT 64 10×PCR stabilizer 64 10 mM dNTP 64 Nuclease-Free Water 16 Total 348

[0230] Table 13 PCR program for in-droplet linear amplification

[0231]

[0232] Since the droplets contain PCR reaction reagents and DTT reagents that can dissolve the barcode microspheres, after the barcode microspheres are dissolved, the barcodes fall off the microspheres and enter the permeable hydrogel microchambers. Since there are only primers containing barcodes in the droplets, through linear amplification, the genomes in the permeable hydrogel microchambers are labeled with barcodes. Since the barcodes on each barcode microsphere are different, the origin of the genomes can be determined by the barcode sequences, thus realizing the indexing of single cells.

[0233] After the reaction is completed, the droplets are demulsified and the permeable hydrogel microchambers are collected, and washed 3-5 times with DPBS buffer containing 0.1 v / v% tween-20 to remove excess oligonucleotide chains and enzymes or metal ions introduced during the reaction process.

[0234] Finally, the permeable hydrogel microchambers are combined into a 1.5 ml centrifuge tube, dissolved with twice the volume of 1M NaOH, and then neutralized to neutral pH with 1M acetic acid to dissolve the hydrogel microchambers. At this time, the DNA is in the aqueous solution. Add 0.5X VAHTS clean beads to purify the linear amplification products, and then enrich by exponential amplification (i.e., add upstream and downstream primers).

[0235] Prepare the reaction system for the second round of amplification according to Table 14, 2 ndThe primer sequence of PCR primer R is: CTACACGACGCTCTTCCGATCT (SEQ ID NO.10), and the primer F sequence: TGGTCGGCAGCGTC (SEQ ID NO.11), and the PCR program is set according to Table 15.

[0236] Table 14 PCR premix for the second round of amplification

[0237]

[0238] Table 15 PCR program for exponential amplification

[0239]

[0240] Use Bioanalyzer to perform quality control on the library fragment distribution before loading.

[0241] Taking Example 1 as a representative, among which Figure 7 shows the fragment length distribution of the prepared DNA library.

[0242] Use Nanopore ligation kit (SQK-LSK114), add the adapters required for third-generation sequencing to the indexed genomic DNA according to the experimental procedures provided by the supplier. After the reaction is completed, use the Nanopore MinIon platform for third-generation sequencing; the results are shown in Figure 8 and Figure 9 .

[0243] Among which Figure 8 shows that the purity of more than 95% of single cells is above 95%, Figure 9 shows that the single-cell genome coverage can reach more than 80%. At present, the whole-genome sequencing technologies for microbial single cells mainly include Sic-seq and Microbe-seq, among which Sic-seq reaches 1% and Microbe-seq reaches 5%-10%.

[0244] Example 4

[0245] The methods of single-cell embedding, lysis, and whole-genome amplification in this example are the same as those in Example 1. The main difference is that in this example, the barcode sequence is connected to the whole genome by the enzyme ligation method to achieve indexing.

[0246] Among which, the Tn5 transposase complex used for fragmentation needs to be prepared by oneself, that is, buy commercial Tn5 single enzyme, then synthesize phosphorylated primers and embed them with Tn5 enzyme; after preparing the Tn5 enzyme containing phosphorylated adapters, use the same method as in Example 1 to fragment the whole-genome amplification product.

[0247] The specific process for preparing the Tn5 transposome complex is as follows:

[0248] 1. Preparation of Adapter Mix:

[0249] Primer sequences: The underlined sequences of Primer B' and Primer C' are reverse complementary to Primer A;

[0250] Primer A: 5'-Phos- CTGTCTCTTATACACATCT -NH2-3' (SEQ ID NO.12);

[0251] Primer B': 5'-TCGTCGGCAGCGTC AGATGTGTATAAGAGACAG -3' (SEQ ID NO.13);

[0252] Primer C': 5'-phos-GTCGTCGTGGGCTCGG AGATGTGTATAAGAGACAG -3' (SEQ IDNO.14);

[0253] Preparation of Adapter Mix:

[0254] Reaction 1:

[0255] Adapter 1: 10 μl of Primer A (10 μM), 10 μl of Primer B' (10 μM);

[0256] Reaction 2:

[0257] Adapter 2: 10 μl of Primer A (10 μM), 10 μl of Primer C' (10 μM);

[0258] Mix equal volumes of Reaction 1 and Reaction 2 and perform the following program: Name it Adapter Mix:

[0259] Table 16

[0260] Hot lid on, 105℃ 75℃ 15 min 60℃ 10 min 50℃ 10 min 40℃ 10 min 25℃ 35 min

[0261] 2. Embedding of Adapter Mix:

[0262] Configure the reaction system according to the system in Table 17, then react at 30 °C for 1 h, and name the reaction product TTE Mix;

[0263] Table 17

[0264] Component 2 μg preparation system TruePrep Tagment Enzyme (500 ng / μl) 4 μl Adapter Mix 7 μl Coupling Buffer 39 μl Total 50 μl

[0265] DNA fragmentation: Configure the fragmentation reaction system according to the system in Table 18, and then carry out the reaction at 55°C for 30 min to fragment the whole-genome DNA;

[0266] Table 18 Fragmentation reaction system

[0267] System components Volume (μL) 5×Tagment buffer L 10 TTE Mix 10 <![CDATA[dd H 2 O]]> 30 Total 50 gel 25 μl

[0268] When preparing the barcode microspheres, only phosphorylate the primer used in the last round of synthesis, and the other operation methods are the same as those in Example 1.

[0269] The ligation-based indexing reaction system is as follows:

[0270] Table 19 Ligation-based indexing reaction system

[0271] System components Volume (μL) StickTogether DNA ligase reaction buffer 164 T7 DNA ligase 16 100mM DTT 64 10×PCR stabilizer 64 10mM dNTP 64 Total 372

[0272] Reaction program: 25°C, 16 h

[0273] After ligation, perform enrichment amplification (exponential amplification), and the reaction system and reaction program are as follows. The primer sequences are the same as those in Example 1;

[0274] Table 20 PCR premix for the second-round amplification

[0275] System components Volume (μL) 5×TAB 10 10μM Primer F 5 <![CDATA[10μM 2 nd PCR primer R]]> 5 TAE 1 Nuclease free water 4 Hydrogel microchamber 25 Total 50

[0276] Table 21 PCR reaction program for exponential amplification

[0277]

[0278]

[0279] After amplification is completed, dissolve the hydrogel microchambers and purify the amplified products, and then perform sequencing on the machine (the specific method is the same as that in the example)

[0280] See the results of ligation-based indexing Figure 13 , and the results show that the obtained single cells have a high purity.

[0281] Comparative Example 1

[0282] Lysis method 1: Use the purchased prepGEM Bacteria kit from MicroGem. Prepare the lysis reaction system according to Table 22. After mixing with the hydrogel microchamber, place it in a shaker mixer and incubate at 37°C for 30 minutes, 75°C for 10 minutes, and 95°C for 5 minutes in sequence at an oscillation frequency of 1500 rpm. After the reaction solution is cooled to room temperature, centrifuge at 5000 rpm for 1 minute to remove the supernatant. Subsequently, wash it five times with Tris-EDTA solution containing 0.1% Tween-20 (v / v) to remove impurities such as lysis reagents and cell debris.

[0283] Table 22 Microbial single-cell lysate in hydrogel microchamber

[0284] System components Volume (μL) Nuclease-Free Water 280 10×Green Buffer (MicroGEM, PBA0100) 100 300U / ul Lysozyme 10 prepGEM (MicroGEM, PBA0100) 10 10×Enhancer (MicroGEM, PBA0100) 100 Total 500 Hydrogel microchamber (containing single microbial cells) 500

[0285] Lysis method 2: Prepare the first-step reaction system according to Table 23. Place the solution in a thermostatic mixer and react overnight at 37°C and 1500 rpm. Subsequently, centrifuge at 5000 rpm for 1 minute to remove the supernatant. Wash it twice with DPBS solution containing 0.1% Tween-20 (v / v). Next, perform the second-step lysis according to the reaction system in Table 24 and react at 55°C and 1500 rpm in a thermostatic mixer for 30 minutes. After the reaction solution is cooled to room temperature, centrifuge at 5000 rpm for 1 minute to remove the supernatant. Subsequently, wash it twice with an aqueous solution containing 2% Tween-20 (v / v) to quench SDS in the solution. Next, wash it once with absolute ethanol to inactivate proteinase K and avoid affecting downstream amplification reactions. Finally, wash it five times with Tris-EDTA solution containing 0.1% Tween-20 (v / v) and store it in this solution, temporarily store it in a 4°C refrigerator for subsequent whole-genome amplification.

[0286] Table 23 Microbial single-cell lysate A in hydrogel microchamber

[0287] System components Volume (μL) Nuclease-Free Water 365 1M NaCl 10 50mM EDTA 50 1M DTT 10 500U / mL Lysostaphin 20 2500U / mL Mutanolysin 40 300U / μL Lysozyme Solution 3 2U / μL Zymolyase 2 Total 500 Hydrogel microchamber (containing single microbial cells) 500

[0288] Table 24 Microbial single-cell lysate B in hydrogel microchamber

[0289] System components Volume (μL) Nuclease-Free Water 40 1M NaCl 90 50mM EDTA 180 100mM Tris-HCl (pH 8.0) 90 5w / v% SDS 90 20mg / mL proteinase K 10 Total 500 Hydrogel microchamber (after the first step of lysis) 500

[0290] The results are as follows:

[0291] Table 25

[0292] Lysis method Escherichia coli: Bacillus subtilis Control - Lysis method 1 12:1 Control - Lysis method 2 10:1 Example 1 1:1-2:1

[0293] The results show that: compared with the lysis scheme in Example 1, Lysis Methods 1 and 2 in this comparative example will lead to insufficient lysis and have lysis preference, which in turn causes a large difference in the proportions of Escherichia coli and Bacillus subtilis obtained by sequencing, and is not conducive to the detection of mixed bacteria.

[0294] Comparative Example 2

[0295] The difference between this comparative example and Example 1 is only that the linear amplification in the DNA indexing part is modified to exponential amplification. Another amplification primer (Primer F: TGGTCGGCAGCGTC (SEQ ID NO.15)) is added to the linear amplification reaction system in Example 1, and indexing is achieved by the exponential amplification method, with other conditions remaining unchanged.

[0296] Table 26 Exponential Amplification Reaction System

[0297] System components Volume (μL) Phusion High-Fidelity Reaction Buffer 120 Phusion High-Fidelity DNA Polymerase 16 Deep Vent DNA Polymerase 16 Primer F (100μM) 4 100mM DTT 64 10×PCR stabilizer 64 10mM dNTP 64 Nuclease-Free Water 24 Total 372

[0298] The results show that, compared with linear amplification, the exponential amplification method affects the purity of single cells and has a low indexing efficiency ( Figure 12 ).

[0299] Comparative Example 3

[0300] In this comparative example, the lysed hydrogel microspheres (also called hydrogel microchambers) do not form microdroplets, and the multiple displacement amplification (MDA) method is used to directly perform whole genome amplification (WGA) of single cell genomes in an aqueous solution system for the permeable hydrogel microspheres.

[0301] First, prepare the solution for realizing the whole genome amplification of microbial single cells in the hydrogel microreactor according to Table 27, pipette and mix well, place it in a constant temperature shaking mixer, react for 2 h at 1500 rpm and 30 °C, and then incubate in a metal bath at 65 °C for 10 min to inactivate phi29 DNA polymerase and thus terminate the amplification reaction.

[0302] Table 27 Reaction System for Whole Genome Amplification of Microbial Single Cells in Hydrogel Microchambers

[0303] System components Volume (μL) 10×Phi29 Reaction buffer 60 10U / μL Phi29polymerase 30 dNTP mix (10mM each) 60 Random primer (500μM) (thermo, SO181) 30 Pyrophosphatase (0.02U / μL) 60 Nuclease-Free Water 60 Hydrogel microreactor containing microbial lysates 300 Total 600

[0304] The results are shown in Figure 11 , and the results show that, compared with the whole genome amplification in an aqueous solution in Comparative Example 3, the purity of single cells obtained by whole genome amplification using encapsulated hydrogel droplets in Example 1 is significantly higher.

[0305] In summary, the present invention uses the inventive method to achieve microbial single-cell whole-genome amplification, indexing, and library construction for an artificial mixed bacterial sample (equal proportion mixture of Escherichia coli and Bacillus subtilis). The results show that this method can lyse Gram-negative and Gram-positive bacteria without preference, and the purity of more than 95% of single cells is greater than 95%, and a single-cell genome coverage rate as high as 80% is achieved.

[0306] The above embodiments are only illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Any person familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. A method for constructing a microbial single-cell whole genome sequencing library, comprising the following steps: 1) providing a microchamber containing a microbial single cell, lysing the single cell, and amplifying the whole genome of the microbial single cell; 2) fragmenting the whole genome in step 1) to obtain a microchamber containing the fragmented genome; 3) introducing barcoded microspheres into the microchamber obtained in step 2) to barcode the fragmented genome to obtain a microchamber containing the barcoded whole genome; 4) Dissolving the microchamber obtained in step 3) and performing whole-genome enrichment amplification to obtain a single-cell whole-genome sequencing library.

2. The construction method according to claim 1, characterized in that: The lysis method includes one or more of enzyme lysis, alkaline lysis, and heat shock method; Preferably, the enzyme in the enzymatic lysis method can be selected from one or more of Labiase lyase, lysostaphin, lysozyme, mutanolysin, yeast lyase, and proteinase K; Preferably, the reagent for lysing single cells includes lysing solution A and lysing solution B; Preferably, the lysis solution A comprises the following components at working concentrations: 30-50 U / mL lysostaphin, 80-120 U / mL mutanolysin, 0.5-4 U / μL lysozyme, 0.005-0.02 U / μL yeast lyase, 30-70 mM NaCl, 3-8 mM EDTA, 5-15 mM Tris-HCl, 0.1-1 v / v% Triton X-100; Preferably, the lysate B comprises the following components at working concentrations: 0.1-0.5 mg / mL proteinase K, 80-120 mM NaCl, 5-15 mM EDTA, 5-15 mM Tris-HCl, 0.01-2 w / v% SDS; Preferably, the step of lysing the single cell comprises: mixing lysing solution A and the microchamber, performing a first step of lysis, washing, and then adding lysing solution B to perform a second step of lysis; Preferably, the conditions for the first step of cracking are 30-43°C, 1300-1800rpm and / or 8-16h; Preferably, the conditions for the second step of cracking are 50-65° C., 1300-1800 rpm and / or 0.5-2 h.

3. The construction method according to claim 1, characterized in that: The microchamber includes gel microspheres or gel droplets; Preferably, the microchamber comprises an inner layer and an outer layer, the inner layer comprises a hydrogel of a first polymer, and the outer layer comprises a hydrogel of a second polymer; Preferably, the first polymer and the second polymer are respectively selected from dextran, high molecular weight polyethylene glycol diacrylate, polyacrylamide, agarose, methacryloyl gelatin, four-arm polyethylene glycol, eight-arm polyethylene glycol, polyethylene glycol-maleimide, and thiol polyethylene glycol thiol.

4. The construction method according to claim 1, characterized in that: The barcode microspheres include at least one of polyacrylamide microspheres, polystyrene microspheres, polyethylene glycol diacrylate, polylactic acid-glycolic acid copolymer, agarose microspheres, and magnetic microspheres; Preferably, when the microchamber for amplifying the whole genome of a single microbial cell is a gel droplet, the gel droplet comprises a gel droplet formed by a microfluidic chip, a pipetting method or a vortex method; preferably, the pipetting method or the vortex method; Preferably, the whole genome and enrichment amplification of the microbial single cell is exponential amplification or linear amplification.

5. The construction method according to claim 1, characterized in that: In step 3), barcoding the fragmented genome includes barcoding the fragmented genome by DNA ligase or single primer amplification; Preferably, the single primer amplification is linear amplification; Preferably, before barcode labeling the fragmented genome, the method further includes a step of removing the barcode on the barcode sequence microsphere; Preferably, the step of removing the barcode from the barcode sequence microsphere comprises chemical bond cleavage, enzyme degradation or ultraviolet light cleavage; Preferably, the chemical bond comprises a disulfide bond; Preferably, the chemical bond cleavage reagent includes one or more of DTT, dichloromethane, ethyl acetate, acetone, PBS, and a degradation enzyme.

6. A microbial single-cell whole genome sequencing library, characterized in that: The method is constructed by any one of claims 1 to 5.

7. The method for constructing a single-cell whole genome sequencing library according to any one of claims 1 to 5 or the use of the sequencing library according to claim 6 in single-cell sequencing of microorganisms.

8. A method for whole genome sequencing of a microbial single cell, the method comprising: a) constructing a sequencing library according to the sequencing library construction method according to any one of claims 1 to 5; b) sequencing the sequencing library provided in step a); Preferably, the sequencing includes second-generation sequencing or third-generation sequencing.

9. A product for constructing a microbial single-cell whole genome sequencing library, the product comprising the barcoded microspheres, reagents for lysing single cells, reagents for amplifying the whole genome of a microbial single cell, reagents for fragmentation, reagents for barcoding the whole genome, and reagents for enrichment and amplification in the construction method according to any one of claims 1 to 5; preferably, the product is a kit, a chip or a detection system.

10. Use of the method for constructing a microbial single-cell sequencing library according to any one of claims 1 to 5, or the sequencing library according to claim 6, or the method for whole-genome sequencing of a microbial single cell according to claim 8, or the product according to claim 9 in preparing a detection kit, detection device or detection system for microbial research.

Citation Information

Patent Citations

  • DE202500A

  • Microbial single-cell whole genome amplification and sequencing library construction method

    CN114774519A

  • Single bacterium genome sequencing method based on digital microfluidic technology

    CN115197840A

  • Single cell analysis of transposase accessible chromatin

    CN116064732A

  • Construction method of single cell whole genome sequencing library

    CN116622807A