Method for identifying interacting protein in rice endosperm based on Turbo ID proximity marker technology

Abstract

The invention discloses a method for identifying interacting proteins in rice endosperm based on a Turbo ID proximity marker technology, and belongs to the technical field of biology. The method comprises the following steps: firstly, forming a fusion protein from a target protein and Turbo ID biotin ligase, and constructing a transgenic rice plant capable of stably expressing the fusion protein; developed seeds 7-9 days after flowering of the transgenic plant are mixed with a biotin solution with the concentration of 100-400 [mu] M, vacuumizing treatment is conducted for 10-30 min, and then standing is conducted for 8-36 h; and performing protein extraction and enrichment on the rice endosperm sample subjected to biotin treatment, and identifying biotin-labeled interaction protein in the rice endosperm by mass spectrometry. The invention provides a method for performing near space marking on a target protein in rice endosperm based on a Turbo ID system. The method can be used for analyzing possible protein-protein interaction of the target protein.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly relates to a method for identifying interacting proteins in rice endosperm based on the TurboID proximity labeling technique. Background Art

[0002] As one of the main food crops, the yield and quality of rice are directly related to the living standards of the people. The endosperm is the most important component of rice. In-depth study of the metabolism and molecular regulation mechanism of storage substances in the endosperm is crucial for improving rice yield and quality. Previous studies have used methods such as GPC separation, chemical cross-linking, affinity purification, and immunoprecipitation to study the components or interacting proteins of starch synthesis-related enzyme protein complexes in the endosperm, and it is difficult to identify transient or weak interacting proteins; while the biotin proximity labeling technique developed in recent years can better solve the problem of mining interacting proteins in protoplasts.

[0003] The proximity labeling method (Proximity labeling, PL) refers to a method of connecting a catalytic enzyme to a target protein to form a fusion protein, and adding an exogenous substrate to activate the catalytic enzyme to label adjacent proteins. The basic principle is to fuse express a certain enzyme (such as peroxidase or biotinylated enzyme) with the target protein. When the target protein interacts with the target protein, the enzyme triggers a chemical reaction to connect an active labeling molecule (such as biotin or a fluorescent molecule) to the protein nearby. In recent years, the PL method has realized the detection of weak interactions, transient interactions, and hydrophobic protein-protein interactions in vivo. Currently, commonly used PL catalytic enzymes include ascorbate peroxidase (APEX), BioID, BioID2, TurboID, and miniTurboID, etc. Although APEX has high catalytic activity, its work requires toxic substrates hydrogen peroxide and biotin phenol. In contrast, BioID and BioID2 use biotin as a substrate and have no toxic effect on cells, but their catalytic activity is low and they require a long time of treatment. TurboID and miniTurboID combine the advantages of APEX and BioID, have high catalytic efficiency, have no toxic effect on cells, and the optimal working temperature is reduced from 37°C to a suitable 25°C, which is suitable for the plant growth environment.

[0004] In the animal system, PL is widely used in constructing protein-protein interaction networks, studying organelle proteomes and cell communication, analyzing protein topology and surface groups, studying protein-nucleic acid interactions and subcellular transcriptomes, etc. In the plant system, the PL technique has been used to identify interacting proteins of toxic proteins and new component proteins of nuclear pore complexes in tobacco and Arabidopsis leaf tissues. Especially using the TurboID technique, the key factor regulating tobacco resistance to TMV virus has been successfully identified (Zhang Y, et al. TurboID-based proximity labeling reveals that UBR7 is a regulator ofN NLR immune receptor-mediated immunity. Nat Commun, 2019, 10:3252) and the substrate transport map of Arabidopsis nuclear transport receptors (Xu F, et al . Exportin-4 coordinates nuclear shuttling ofTOPLESS family transcription corepressors to regulate plant immunity. PlantCell, 2021,33:697-713).

[0005] In the plant system, in the past, transiently or stably transformed transgenic plant lines of leaves or protoplasts were treated by soaking with a low concentration of biotin, and then streptavidin magnetic beads were used to purify biotin-labeled interacting proteins. However, due to the presence of the seed coat and pericarp in developing rice endosperm, it is difficult for low-concentration biotin to enter the endosperm interior in a short time, resulting in low biotinylation degree. There is currently no application of biotin labeling in rice endosperm tissue.

[0006] Therefore, how to use the TurboID proximity labeling technology to identify the interacting proteome in rice endosperm is a technical problem that needs to be solved by those skilled in the art. Summary of the Invention

[0007] The purpose of the present invention is to provide a feasible method for mining and researching interacting proteins in rice endosperm by exploring the identification of the interacting proteome of expressed proteins in endosperm using the TurboID proximity labeling technology.

[0008] To achieve the above object, the present invention adopts the following technical solutions: The present invention provides a method for identifying interacting proteins in rice endosperm based on the TurboID proximity labeling technology, comprising the following steps: (1) Clone the coding gene of the fusion protein formed by the target protein and the TurboID biotin ligase into a plant expression vector to construct a recombinant plasmid; then use the Agrobacterium-mediated genetic transformation method to transfer the gene into a rice receptor to obtain a transgenic plant with successful expression of the fusion protein; (2) Mix the developing seeds of the transgenic plant 7-9 days after flowering with a biotin solution at a concentration of 100-400 μM, perform a vacuum treatment for 10-30 min, and then place it for 8-36 h; (3) Take the biotin-treated rice endosperm samples for protein extraction, enrichment, and mass spectrometry identification of the biotin-labeled interacting proteins in the rice endosperm.

[0009] In the present invention, the TurboID proximity labeling technology is used to label the proteins interacting with the target protein in the rice endosperm with biotin, and then the proteins labeled with biotin are isolated and extracted from the rice endosperm, which are the candidate proteins interacting with the target protein.

[0010] In step (1), based on the TurboID proximity labeling technology, the target protein to be studied forms a fusion protein with the TurboID biotin ligase, and the fusion protein expression cassette is integrated into the rice genome by genetic engineering technology to obtain a transgenic rice plant in which the fusion protein is successfully expressed.

[0011] Specifically, first, the fusion protein coding gene is cloned into a plant expression vector to construct a recombinant expression plasmid, and then the target fragment is introduced into the rice receptor by Agrobacterium-mediated genetic transformation to obtain the T 0 generation, and then the T 0 generation transgenic endosperm samples are subjected to positive seedling identification, and the stable genetic T 1 generation is obtained through T 2 generation screening.

[0012] Preferably, the plant expression vector is the pCAMBIA1390 vector, and the fusion protein coding gene is cloned behind the Ubiquitin promoter of the pCAMBIA1390 vector.

[0013] Preferably, the N-terminus and C-terminus of the TurboID biotin ligase are fused with 3×HA tag and 6×His tag. In the present invention, the 3×HA tag and 6×His tag are fused and expressed before and after the TurboID biotin ligase sequence respectively, which is used for subsequent detection of the target protein expression level, purification, and localization.

[0014] Preferably, the target protein and the TurboID biotin ligase are connected by a flexible Linker. The amino acid sequence of the flexible Linker can be, but is not limited to, GGGSSGGG. Adding a flexible Linker between the two protein sequences ensures the biological activity of turboID and avoids the possible steric hindrance effect of fusion expression.

[0015] Preferably, the target protein is fused to the N-terminus of the TurboID biotin ligase.

[0016] Preferably, the nucleotide sequence of the Linker-3×HA-TurboID-6×His coding gene in the fusion protein is as shown in SEQ ID NO.3.

[0017] In step (2), the seeds of the transgenic lines are mixed with a biotin solution to form a reaction system. After vacuum treatment, the mixture is allowed to stand still so that the biotin solution enters the seeds, catalyzing the TurboID biotin ligase reaction and linking biotin to the proteins that interact with the target protein.

[0018] Specifically, 7 - 9 days after flowering is a period with rapid starch synthesis and high water content inside the seeds, and the efficiency of biotin treatment and protein binding is high. Therefore, the endosperm tissue at this stage is selected in the present invention to establish an efficient biotin labeling system based on TurboID.

[0019] The present invention selects a biotin solution with a concentration of 100 - 400 μM to be mixed with rice endosperm tissue. The biotin solution is prepared by dissolving biotin in dimethyl sulfoxide to form a stock solution with a concentration of 100 mM, and then diluting it with pure water. Research shows that this reaction condition has no effect on the activity of endosperm tissue and can achieve the biotin labeling reaction based on TurboID.

[0020] Preferably, the concentration of the biotin solution is 200 - 400 μM. A higher - efficiency labeling reaction can be achieved under this concentration condition.

[0021] The present invention uses a vacuum condition to submerge the seeds in the biotin solution. Research shows that controlling the vacuum treatment time for 10 - 30 min and then standing still for 8 - 36 h can allow biotin to enter the seeds better and catalyze the TurboID biotin ligase reaction.

[0022] Preferably, the vacuum treatment time is 15 min; then it is placed at 20 - 25°C for 12 - 24 h.

[0023] The present invention has explored the optimal incubation conditions to achieve a high - efficiency labeling reaction and avoid the non - specific problems caused by too long labeling time. The obtained samples can be used for subsequent studies on transient interaction protein identification and sub - organelle protein identification, etc.

[0024] In step (3), the samples treated with biotin are quickly frozen with liquid nitrogen and then ground into a fine powder. Protein extraction buffer is added for protein extraction. After centrifugation and filtration, an endosperm protein solution containing biotin - labeled proteins is obtained, and the free biotin in the endosperm protein solution is removed by purification; then the biotin - labeled endosperm proteins are enriched to obtain a concentrated sample; the concentrated sample is subjected to proteomic analysis, and the endosperm proteins in this sample are the candidate proteins that interact with the target protein.

[0025] Preferably, streptavidin magnetic beads are used to enrich the biotin - labeled endosperm proteins in the protein extraction buffer.

[0026] As a specific embodiment of the present invention, the present invention provides a method for identifying the interacting proteins of starch branching enzyme I (BEI) in rice endosperm based on the TurboID proximity labeling technology, that is, the target protein is starch branching enzyme I (BEI), and the nucleotide sequence of its encoding gene is shown in SEQ ID NO.6. The method includes: forming a fusion protein of starch branching enzyme I (BEI) and TurboID biotin ligase, constructing a transgenic line stably expressing the fusion protein by genetic transformation technology, collecting the endosperm tissue of the transgenic line, treating the endosperm tissue according to the above biotin treatment method, and then extracting, enriching, and identifying the biotin-labeled interacting proteins by mass spectrometry.

[0027] The present invention has established a BEI-TurboID biotin enzyme system, used the TurboID system to conduct a proximity spatial labeling omics study on BEI in the endosperm, analyzed the possible protein-protein interactions, and laid a foundation for the subsequent research on the biological functions of BEI.

[0028] The beneficial effects of the present invention are as follows: The present invention first applies the efficient biotin labeling system based on TurboID to the study of interacting proteins in rice endosperm, provides a method for proximity spatial labeling of target proteins in rice endosperm based on the TurboID system, and can be used to analyze the possible protein-protein interactions by using this method, and discover various proteins interacting with the target protein in the endosperm, including proteins with transient and weak interactions in vivo that are not easily discovered by conventional methods. Specifically, the present invention uses the proximity labeling catalytic enzyme TurboID to improve the ability to detect transient and weak interacting proteins; the present invention has explored the optimal biotin treatment conditions, achieved a high-efficiency labeling reaction, and does not require the addition of cytotoxic substances. Compared with the traditional co-IP method, the detection rate and sensitivity of the method provided by the present invention are significantly improved, indicating that this method has certain advantages. Brief Description of the Drawings

[0029] Figure 1 It is the plasmid map of pCAMBIA1390-Linker-3×HA-TurboID-6×His.

[0030] Figure 2 It is the plasmid map of pCAMBIA1390-BEI-Linker-3×HA-TurboID-6×His.

[0031] Figure 3 It is the effect diagram of the optimal concentration of biotin treatment Figure 4 It is the effect diagram of the optimal time of biotin treatment.

[0032] Figure 5 It is the enrichment effect diagram of streptavidin.

[0033] Figure 6 It is the volcano plot of BEI-TurboID affinity-purified proteome.

[0034] Figure 7 It is the heat map of BEI candidate interacting proteins. Specific implementation manners

[0035] The present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and are not used to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, any modification or replacement made to the methods, steps or conditions of the present invention shall fall within the scope of the present invention.

[0036] Unless otherwise specified, the test methods used in the following embodiments are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, are reagents and materials that can be obtained from commercial channels.

[0037] Example 1: Identification of proteins interacting with starch branching enzyme I (BEI) based on proximity labeling technology 1. Construction of the plant binary expression vector pCAMBIA1390-3×HA-TurboID-6×His Insert the linker-3×HA-TurboID sequence behind the Ubiquitin promoter of the pCAMBIA1390 vector; the steps for constructing the expression vector are as follows: Step 1: Amplification of the Linker-3×HA-TurboID-6×His sequence, design specific primers, and the specific primer sequences are TurboID F (5’→3’): GAGTCCACCATGGTAGATCACTAGTGGTGGTGGTTCATCAGGTGG (SEQ ID NO.1); TurboID R (5’→3’): GTGGTGGCTAGCGTTAACCTGCAGCTTTTCGGCAGACC (SEQ ID NO.2).

[0038] Using the pXPO4-XPO4-3×HA-TurboID vector as a template (Xu et al. 2021), obtain the specific sequence fragment of Linker-3×HA-TurboID by PCR method (using 2×KODone Mix high-fidelity enzyme (Toyobo)), and after electrophoresis verification, recover the specific sequence fragment by gel extraction.

[0039] Step 2: Vector digestion: Digest the pCAMBIA1390 vector with the restriction endonuclease SpeI (NEB). After electrophoresis verification, recover the linearized vector by gel extraction.

[0040] Step 3: Homologous recombination: The Linker-3×HA-TurboID fragment and the SpeI-digested linearized pCAMBIA1390 vector fragment are subjected to homologous recombination with 2×CE clone mix (Vazyme) to complete the ligation. The recombinant product is transformed into DH5α Escherichia coli competent cells and cultured on an LB plate containing kanamycin for 12 - 16 hours.

[0041] Step 4: Pick monoclonal colonies and culture overnight. Extract the plasmid and send it for sequencing identification. After correct identification, it is the pCAMBIA1390-Linker-3×HA-TurboID-6×His plant binary expression vector. The plasmid map is as Figure 1 shown, and the Linker-3×HA-TurboID-6×His sequence is as shown in SEQ ID NO.3.

[0042] 2. Construction of the pCAMBIA1390-BEI-Linker-3×HA-TurboID-6×His plant binary expression vector Digest the correctly sequenced pCAMBIA1390-Linker-3×HA-TurboID-6×His plasmid with SpeI, and recover it by electrophoresis gel extraction. Design primers and PCR amplify the full-length BEI sequence, and recover the PCR product of the full-length BEI sequence by gel extraction. Use the method of homologous recombination to insert BEI into the pCAMBIA1390-Linker-3×HA-TurboID-6×His plasmid to construct the pCAMBIA1390-BEI-Linker-3×HA-TurboID-6×His plant binary expression vector. The specific steps are as follows: Step 1: Amplification of the BEI sequence. Design specific primers for BEI. The specific primer sequences are: BEI F (5’→3’): GAGTCCACCATGGTAGATCACTAGTATGCTGTGTCTCACCTCCTC (SEQ ID NO.4), BEI R (5’→3’): CACCTGATGAACCACCACCTTTGCAGTCTTCGTCAGAAGACC (SEQ ID NO.5).

[0043] Using rice endosperm cDNA as a template, obtain the specific BEI sequence by PCR method (using 2×KOD one Mix high-fidelity enzyme (Toyobo)). After electrophoresis verification, recover the BEI CDS sequence by gel extraction.

[0044] Step 2: Vector digestion: Digest the obtained pCAMBIA1390-Linker-3×HA-TurboID-6×His vector with the restriction enzyme SpeI (NEB). After electrophoresis verification, recover the linearized vector by gel extraction.

[0045] Step 3: Homologous recombination: The BEI fragment and the linearized pCAMBIA1390-Linker-3×HA-TurboID vector fragment after SpeI digestion are subjected to homologous recombination with 2×CE clone mix (Vazyme) to complete the ligation. The recombinant product is transformed into DH5α Escherichia coli competent cells and cultured on an LB plate containing kanamycin for 12 - 16 hours.

[0046] Step 4: Pick monoclonal colonies and culture overnight. Extract the plasmid and send it for sequencing and identification. After correct identification, it is the pCAMBIA1390-BEI-Linker-3×HA-TurboID-6×His plant binary expression vector. The plasmid map is as Figure 2 shown, and the BEI CDS sequence is shown in SEQ ID NO.6.

[0047] 3. Genetic transformation Use the Agrobacterium-mediated transformation method to transfer the pCAMBIA1390-BEI-3×HA-TurboID plasmid into Nipponbare rice, and entrust Wuhan Boyuan Biotechnology Co., Ltd. to perform the transgenic operation. Identify positive seedlings from the T0 generation transgenic endosperm samples, and obtain stable T2 generation transgenic lines through T1 generation screening.

[0048] 4. Biotin treatment (I) Determine the optimal concentration of biotin treatment. The specific steps are as follows: Step 1: Take the seeds of the transgenic lines stably expressing the pCAMBIA1390-BEI-3×HA-TurboID recombinant plasmid 7 - 9 days after flowering and mix them with 50, 100, 200, and 400 μM biotin solutions to form a reaction system. After vacuum treatment for 15 minutes, place it at 25 °C for 36 hours. Wash 5 times with ddH 2 O, blot dry the excess liquid, and detect the biotin treatment effect of the samples.

[0049] The biotin solution is prepared by first dissolving biotin in DMSO to prepare a 100 mM stock solution, and then diluting it to the corresponding concentration with ddH 2 O when in use.

[0050] Step 2: Protein extraction. 100 mg of the biotin-treated endosperm samples were snap-frozen in liquid nitrogen and then ground into a fine powder in a mortar. 300 μL of protein extraction buffer (components include 10 mM HEPES-KOH, 100 mM NaCl, 1×cocktail, 4 μM MG132, 1 mM PMSF) was added for protein extraction, and the mixture was rotated at 4 °C for 30 - 60 min. Among them, the solvent of the protein extraction buffer solution is water, and the pH is 7.5.

[0051] Step 3: The above protein solution was placed in a centrifuge, the rotation speed was set to 12000 rpm, and centrifuged at 4 °C for 15 min, and the supernatant was collected. The above operation was repeated twice. 5×SDS loading buffer (components are 300 mM Tris-HCl, pH6.8, 10% SDS, 50% glycerol, 0.05% bromophenol blue, 500 mM DTT or 5% β-mercaptoethanol) was added to the supernatant, and boiled for 10 min to obtain denatured protein.

[0052] Step 4: Western blot was used to detect the affinity labeling effect, and the specific steps are as follows: (1) SDS-PAGE and membrane transfer: The protein samples obtained above were separated on a 10% SDS-PAGE gel, and the proteins were transferred from the PAGE gel to a PVDF membrane using a wet transfer apparatus. Three gels were made with the same samples, and different antibodies were incubated subsequently.

[0053] (2) Blocking: The above PVDF membrane was incubated with 5% BSA (solvent is 1×TBST) at room temperature for 1 hour.

[0054] (3) Primary antibody incubation: The three PVDF membranes corresponded to Streptavidin-HRP (abcam#ab7403; 1:7500), anti-HA (abcam#ab1424, 1:6000) and anti-BEI (1:3000) antibodies respectively, and incubated at room temperature for 2 hours; (4) Membrane washing: The membrane was washed 3 times with 1×TBST, 5 min each time. At this time, the membrane incubated with Streptavidin-HRP can directly go to step (7).

[0055] (5) Secondary antibody incubation: anti-HA and anti-BEI were incubated with goat anti-mouse-HRP (1:6000) and goat anti-rabbit-HRP (1:6000) at room temperature for 1 hour respectively.

[0056] (6) Membrane washing: The membrane was washed 3 times with 1×TBST, 5 min each time.

[0057] (7)Development: Add ECL chemiluminescence solution to the PVDF membrane, and then image it with a Tanon 5200 series fully automatic chemiluminescence image analysis system to obtain Figure 3 the bands corresponding to Streptavidin-HRP and anti-HA in

[0058] The results of biotin labeling effect are as shown in Figure 3 . It can be seen from the results of the anti-HA part in Figure 3 that the recombinant plasmid pCAMBIA1390-BEI-3×HA-TurboID recombinant protein can be well expressed in rice endosperm. It can be seen from the results of the Streptavidin-HRP part in Figure 3 that within the labeling time of 36 hours, with the increase of biotin concentration, the labeling effect increased significantly, while no significant difference was found in the comparison between 200 and 400 μM. Therefore, the optimal treatment concentration of biotin required for labeling can be determined to be 200 μM.

[0059] (2) Determine the optimal time for biotin treatment. The specific steps are as follows: Step 1: Mix the seeds of transgenic lines stably expressing the recombinant plasmid pCAMBIA1390-BEI-3×HA-TurboID at 7-9 days after flowering with 200 μM biotin solution to form a reaction system. After vacuum treatment for 15 minutes, place it at 25 °C for 0-36 hours, and sample at 0, 8, 12, 24, and 36 hours respectively. After washing 5 times with ddH 2 ₂O, dry the excess liquid, and take 100 mg of endosperm samples to detect the biotin treatment effect. The remaining samples are quickly frozen with liquid nitrogen and stored at -80 °C.

[0060] Steps 2-4 are the same as steps 2-4 in (1).

[0061] The results of biotin labeling effect are as shown in Figure 4 . It can be seen from the results of the anti-HA part in Figure 4 that the recombinant plasmid pCAMBIA1390-BEI-3×HA-TurboID recombinant protein can be well expressed in rice endosperm; it can be seen from the results of the anti-BEI part that the BEI-3×HA-TurboID-6×His recombinant protein (corresponding to the protein indicated by the upper arrow) and the endogenous BEI expressed protein (corresponding to the protein indicated by the lower arrow) can be detected at each reaction time gradient. It can be seen from Figure 4From the partial results of Streptavidin-HRP, it can be seen that within the labeling time of 0-8 hours, the protein biotinylation level mediated by TurboID is relatively low, but a small amount of proteins are successfully biotinylated. Continuing to extend the labeling time to 12-24 hours, the labeling effect shows a significant increase, while no significant difference is found in the comparison of 24-36 hours. Therefore, it can be determined that the optimal treatment time of biotin for labeling is 24 hours, at which time the bands are clearly visible. This indicates that over time, the BEI-3×HA-TurboID recombinant protein can gradually biotinylate the proteins that interact with it and their neighboring proteins, thereby enriching the endosperm proteins that specifically interact with BEI. Therefore, it is feasible to apply the proximity labeling technology of TurboID to the mining of interacting proteomes of rice starch, and the biotin treatment time is set at 24 hours.

[0062] 5. Protein extraction, purification, enrichment with streptavidin magnetic beads, and mass spectrometry identification Protein extraction: Take 1.5 g of the sample treated with biotin for 24 hours, quickly freeze it with liquid nitrogen, and then grind it into a fine powder in a mortar. Use 4.5 mL of protein extraction buffer (10 mM HEPES-KOH, 100 mM NaCl, 1×cocktail, 4 μM MG132, 1 mM PMSF, pH 7.5) for protein extraction, and rotate and extract at 4 °C for 30-60 minutes.

[0063] Place the above protein solution in a centrifuge, set the rotation speed to 12000 rpm, and centrifuge at 4 °C for 15 minutes. Collect the supernatant, which is the protein solution containing biotin-labeled proteins. Repeat the centrifugation twice.

[0064] After the centrifugation step, filter the protein solution containing biotin-labeled proteins through a 0.22 μm filter membrane to obtain the biotin-labeled endosperm proteins.

[0065] Removing free biotin with a desalting column: Use a HiTrapTM desalting column to remove free biotin in the endosperm protein solution in the Yonglian microprotein purification system. The mobile phase solution components of the desalting column are 10 mM HEPES-KOH and 100 mM NaCl, pH 7.5. The volume after desalting changes from 4.5 mL to 20 mL.

[0066] Streptavidin magnetic bead enrichment: Take 100 μL of the protein sample from the above-mentioned endosperm protein solution with free biotin removed as Input to detect protein expression. To the remaining endosperm protein solution, add 50 μL of streptavidin magnetic beads (Invitrogen™ #65605D), and incubate overnight with rotation at 4 °C. Before adding the endosperm protein solution, wash the streptavidin magnetic beads 3 times with 1 mL of protein extraction buffer (10 mM HEPES-KOH, pH 7.5, 100 mM NaCl), 5 min each time.

[0067] Elution of biotinylated proteins: Use a magnetic stand to collect the streptavidin magnetic beads, and wash them 5 times with 1 mL of protein extraction buffer (10 mM HEPES-KOH, pH 7.5, 100 mM NaCl), 5 min each time. Boil in 70 μL of 2× SDT buffer (components: 100 mM Tris-HCl, pH 7.6, 1 mM DTT, 4% SDS) in boiling water for 10 min, and collect the supernatant; among them, after affinity purification with Streptavidin magnetic beads, the concentrated highly biotinylated protein solution, the total volume of the system is significantly concentrated from the original 20 mL containing a large amount of non-specific proteins to 70 μL containing a high concentration of specific biotinylated proteins. Take 12 μL of the affinity-purified protein sample and add 3 μL of 5× SDS loading buffer, and boil in boiling water for 10 min to obtain the affinity-purified (affinity purification, AP) protein sample.

[0068] Use Western blot technology to detect the labeling and concentration effects: After separating the obtained Input and AP protein samples on an SDS-PAGE gel, transfer them to a PVDF membrane; block with 5% BSA (solvent: 1× TBST) for 1 hour, and incubate with the primary antibodies Streptavidin-HRP (abcam#ab7403; 1:7500) and anti-HA (abcam#ab1424, 1:6000) for 2 hours respectively; wash the membrane 3 times with 1× TBST, 5 min each time. Incubate anti-HA with the secondary antibody goat anti-mouse-HRP (1:6000) for 1 hour, wash the membrane 3 times with 1× TBST, 5 min each time. After adding the chromogenic solution, image with the Tanon 5200 fully automatic chemiluminescence image analysis system.

[0069] The results are as Figure 5 shown, from Figure 5Comparing the Western blot results of the AP and Input groups, it can be found that whether in the state of Streptavidin-HRP treatment or anti-HA treatment, the concentration effects of Vector and BEI in the AP group are more prominent than those in the Input group. This indicates that the biotinylated proteins are successfully concentrated after AP, AP is successful, and the interaction system is well constructed. Therefore, it is feasible to apply the proximity labeling technology of TurboID to the mining of interacting proteomes of rice starch synthesis-related enzymes.

[0070] Separate the remaining affinity-purified protein samples (about 58 μL) on an SDS-PAGE gel. After separation, in-gel digestion and label-free quantification mass spectrometry (Label free quantification (LFQ)-MS) are performed. Using the empty transgenic endosperm sample as a control, analyze the changes in protein abundance, and it is found that the abundances of 119 proteins in BEI are significantly higher than those in the control group (adjust pvalue < 0.05, Ratiobiotin / mock > 3, PSM > 2) ( Figure 6 ). Among them, the interacting protein BEIIb in BEI has a relatively high abundance. The protein abundances of other starch synthesis-related enzyme genes, such as AGPL1, AGPL2, SSI, SSIIa, AGPS1, ISA2, BT1, Pho1, and DPE1, are also relatively high in the BEI interacting proteome ( Figure 6 ). In addition, some transcription regulatory factors and non-enzymatic reaction proteins also have relatively high abundances in the BEI proteome ( Figure 7 ), indicating that this method provides many candidate proteins for discovering BEI interacting proteins.

[0071] In summary, in the present invention, the proximity labeling technology of TurboID is successfully applied to the mining of the interacting proteome of rice starch branching enzyme BEI, thus greatly expanding the application field of the TurboID high-efficiency biotin labeling technology. Compared with traditional technologies, this method has obvious advantages and can effectively identify and characterize the interacting proteome in rice endosperm. This innovation provides a basic method and system for the research of functional genes in the rice starch synthesis pathway, especially laying a foundation for the systematic mining and identification of interacting proteins related to rice starch synthesis. The present invention is not limited to the mining of the interacting proteome of rice starch branching enzyme BEI, but also applicable to other proteins.

[0072] The present invention uses the high-efficiency biotin labeling system based on TurboID for the research on the mining of interacting proteins in rice endosperm. The obtained samples can be used for the identification and mining of the interacting proteome in rice endosperm, confirming the feasibility of using the high-efficiency biotin labeling system based on TurboID for the mining of interacting proteins in rice endosperm.

[0073] For relevant researchers in the field, the present invention can be implemented under the same parameters and conditions without changing the core and scope of the present invention. Although specific examples are provided, improvements and enhancements to the present invention are still encouraged.

Claims

1. A method for identifying interacting proteins in rice endosperm based on TurboID proximity marker technology, characterized in that: The following steps are involved: (1) The coding gene of the fusion protein formed by the target protein and TurboID biotin ligase is cloned into a plant expression vector to construct a recombinant plasmid; and then the gene is genetically transformed into a rice recipient by Agrobacterium-mediated genetic transformation to obtain a transgenic plant that successfully expresses the fusion protein; (2) The developing seeds of the transgenic plants 7-9 days after flowering were mixed with a biotin solution with a concentration of 100-400 μM, vacuum treated for 10-30 min, and then left for 8-36 h; (3) Take rice endosperm samples treated with biotin for protein extraction, enrichment, and mass spectrometry identification of biotin-labeled interacting proteins in rice endosperm.

2. The method according to claim 1, characterized in that In step (1), the plant expression vector is a pCAMBIA1390 vector, and the fusion protein encoding gene is cloned behind the Ubiquitin promoter of the pCAMBIA1390 vector.

3. The method according to claim 1, characterized in that In step (1), the N-terminus and C-terminus of the TurboID biotin ligase are fused with a 3×HA tag and a 6×His tag, respectively.

4. The method according to claim 1 or 3, characterized in that In step (1), the target protein and TurboID biotin ligase are connected by a flexible linker.

5. The method according to claim 4, characterized in that The target protein is fused to the N-terminus of TurboID biotin ligase, and the nucleotide sequence of the Linker-3×HA-TurboID-6×His encoding gene in the fusion protein is shown in SEQ ID NO.

3.

6. The method according to claim 1, characterized in that In step (2), the concentration of the biotin solution is 200-400 μM; the biotin solution is prepared by dissolving biotin in dimethyl sulfoxide to prepare a mother solution with a concentration of 100 mM, and then diluting it with pure water.

7. The method according to claim 1, characterized in that In step (2), the vacuum treatment time is 15 min.

8. The method according to claim 1 or 7, characterized in that In step (2), after the vacuum treatment, the mixture is allowed to stand at 20-25°C for 12-24 hours.

9. The method according to claim 1, characterized in that In step (3), streptavidin magnetic beads are used to enrich the endosperm proteins labeled with biotin in the protein extract.

10. The method according to claim 1, characterized in that When the target protein is starch branching enzyme I, starch branching enzyme I is fused to the N-terminus of TurboID biotin ligase; the nucleotide sequence of the gene encoding starch branching enzyme I is shown in SEQ ID NO.6.

Images