OsSPL17 gene for improving strength of rice stalks and application of OsSPL17 gene
By expressing the OsSPL17 gene through a homologous recombination vector, the thickness and bending strength of rice stems were improved, solving the problem of easy lodging of rice stems and achieving a significant increase in rice stem strength, thus enhancing lodging resistance.
Patent Information
- Application Number
- CN202511208279.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-27
- Publication Date
- 2025-12-02
AI Technical Summary
Existing technologies have limited genes for improving rice stem strength, and the genetic regulatory network is unclear, making rice stems prone to lodging and affecting yield and quality.
Using the OsSPL17 gene, a transgenic vector was constructed through homologous recombination. The OsSPL17 gene expression was driven by its own promoter and transformed into rice callus tissue. Rice plants with significantly increased stem thickness, stem wall thickness, and stem bending resistance were screened out.
It significantly improved the thickness of rice stems, stem wall thickness, and bending strength, enhanced the lodging resistance of rice, and provided a direction for the breeding of lodging-resistant rice varieties.
Smart Images

Figure CN121046401A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically an OsSPL17 gene for improving rice stem strength and its application. Background Technology
[0002] Rice is one of my country's most important food crops, with about 60% of the population relying on it as their staple food. Lodging is a common problem in the middle and late stages of rice growth. Lodging not only affects mechanized harvesting in paddy fields but can also lead to grain mold and germination, reducing yield and quality. The stalk provides structural support for rice, and rice varieties with strong stalks tend to have greater resistance to lodging. Therefore, improving the strength of rice stalks and enhancing lodging resistance has become an important goal in rice breeding.
[0003] Rice stem strength is mainly influenced by both its morphological structure and component structure. The morphological structure is primarily determined by stem diameter, stem wall thickness, the number and size of vascular bundles, and the thickness of sclerenchyma cells. The component structure is mainly determined by cellulose, lignin, hemicellulose, and pectin. Generally speaking, stems with larger diameters, thicker stem walls, more vascular bundles, more layers of sclerenchyma cells, and higher cellulose and lignin content exhibit greater strength. Currently, there are relatively few genes that can be used to increase rice stem strength, mainly due to a limited number of genes with breeding value and an unclear genetic regulatory network. OsSPL17 belongs to the rice SPL (Squamosa Promoter-Binding Protein-Like) transcription factor family. This invention utilizes this gene to improve rice stem strength, which has certain practical application value. Currently, there are no reports on OsSPL17 improving rice stem strength. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide an OsSPL17 gene that improves the strength of rice stems. The OsSPL17 gene can increase the thickness of rice stems, the thickness of rice stem walls and the bending resistance of rice stems, and regulate the lodging resistance of rice.
[0005] Another object of the present invention is to provide an application of the OsSPL17 gene in improving rice stem strength.
[0006] Another objective of this invention is to provide an application of the OsSPL17 gene in regulating lodging resistance in rice.
[0007] Another object of the present invention is to provide a method for improving the strength of rice.
[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0009] This invention provides an OsSPL17 gene for improving rice stem strength. The nucleotide sequence of the OsSPL17 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the OsSPL17 gene is shown in SEQ ID NO.2.
[0010] The present invention also provides an application of the OsSPL17 gene in improving rice stem strength.
[0011] Preferably, improving the strength of rice stems includes increasing the thickness of rice stems, the thickness of rice stem walls, and the bending resistance of rice stems.
[0012] The present invention also provides an application of the OsSPL17 gene in regulating lodging resistance in rice.
[0013] The present invention also provides a method for improving the strength of rice stems, comprising the following steps:
[0014] The OsSPL17 gene and its promoter were ligated together to the final vector pCAMBIA1300 using homologous recombination.
[0015] The final vector was transformed into Agrobacterium competent cells and infected rice callus tissue to regenerate transgenic rice plants; rice plants with increased stem thickness, increased stem wall thickness, and increased stem bending resistance were screened out.
[0016] Preferably, the promoter nucleotide sequence of the OsSPL17 gene is shown in SEQ ID NO.3.
[0017] More preferably, the nucleotide sequence of the upstream primer OsSPL17-pro-F used to amplify the OsSPL17 promoter is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer OsSPL17-pro-R is shown in SEQ ID NO.5.
[0018] Preferably, the nucleotide sequence of the upstream primer OsSPL17-gDNA-F used to amplify the OsSPL17 gene is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer OsSPL17-gDNA-R is shown in SEQ ID NO.7.
[0019] Preferably, the Agrobacterium is Agrobacterium tumefaciens EHA105.
[0020] Preferably, the rice recipient material is Nipponbare and / or Wuyunjing 7.
[0021] Compared with the prior art, the present invention has the following advantages:
[0022] This invention discloses an OsSPL17 gene for improving rice stem strength. A transgenic vector was constructed by cloning the promoter and the OsSPL17 gene itself, resulting in transgenic rice with its own promoter driving the OsSPL17 genome. Using Nipponbare and Wuyun Jing 7 as rice recipient materials, an OsSPL17 gene recombinant vector was constructed by driving OsSPL17 gene expression with its own promoter. This vector was then transformed into callus tissue of Nipponbare and Wuyun Jing 7 using Agrobacterium-mediated transformation. After screening and molecular identification, homozygous positive lines were obtained. Analysis of stem morphology and stem bending resistance verified that the OsSPL17 gene can effectively improve the stem strength of different rice varieties, significantly increasing stem thickness, stem wall thickness, and stem bending resistance. This indicates that OsSPL17 plays an important regulatory role in rice stem development and can be used for the breeding of lodging-resistant rice varieties. Attached Figure Description
[0023] Figure 1 The expression level of OsSPL17 in transgenic plants with Nipponbare background is shown in **, where ** indicates a highly significant difference (P≤0.01).
[0024] Figure 2 Photographs of the stem morphology of transgenic plants with Nipponbare background, scale bar is 1mm;
[0025] Figure 3 For comparison of stem thickness, stem wall thickness and stem bending strength of transgenic plants with Nipponbare background, ** indicates extremely significant differences (P≤0.01);
[0026] Figure 4 The expression level of OsSPL17 in the background transgenic plants of Wuyunjing 7 is shown in **, where ** indicates a highly significant difference (P≤0.01).
[0027] Figure 5 Photographs of the stem morphology of the background transgenic plant of Wuyunjing 7, scale bar is 1mm;
[0028] Figure 6 For comparison of stem thickness, stem wall thickness and stem bending strength of Wuyunjing 7 background transgenic plants, ** indicates extremely significant differences (P≤0.01). Detailed Implementation
[0029]
[0030] This invention also provides an application of the OsSPL17 gene in improving rice stem strength. In this invention, improving rice stem strength preferably includes increasing rice stem thickness, rice stem wall thickness, and rice stem bending resistance. In this invention, bending resistance is a well-known indicator of the mechanical strength of rice. Specifically, bending resistance refers to the bending resistance of rice internodes. Preferably, the middle of the internode to be tested is placed horizontally on two support points, 5 cm apart. Force is applied at the middle of the internode until it breaks; the peak value of the force is the internode bending resistance. The force is applied manually, with a smooth downward pull.
[0031] The present invention also provides an application of the OsSPL17 gene in regulating lodging resistance in rice.
[0032] The present invention also provides a method for improving the strength of rice stems, comprising the following steps:
[0033] The OsSPL17 gene and its promoter were ligated together into the final vector using homologous recombination.
[0034] The final vector was transformed into Agrobacterium competent cells and infected rice callus tissue to regenerate transgenic rice plants; rice plants with increased stem thickness, increased stem wall thickness, and increased stem bending resistance were screened out.
[0035] In this invention, upstream and downstream primers are designed based on the promoter nucleotide sequence of the OsSPL17 gene to amplify the promoter fragment of the OsSPL17 gene before the start codon ATG; upstream and downstream primers are designed based on the OsSPL17 gene nucleotide sequence to amplify the gene fragment between the start codon ATG and the stop codon TGA of the OsSPL17 gene.
[0036]
[0037] The nucleotide sequence of the upstream primer OsSPL17-pro-F used to amplify the OsSPL17 promoter is as follows: CGAGCT CGGTACCGAGGATCC CTCGATTAATGGGTTATATGCTAGCA (SEQ ID NO.4), the nucleotide sequence of the downstream primer OsSPL17-pro-R is as follows: TCGCCAT TGCGGCAGGCGGTGGTCG (SEQ ID NO. 5).
[0038] The nucleotide sequence of the upstream primer OsSPL17-gDNA-F used to amplify the OsSPL17 gene is as follows: ACCGCCTGCCGCA The nucleotide sequence of the downstream primer OsSPL17-gDNA-R is ATGGCGACCGGCGGCAGC (SEQ ID NO. 6). CAGGTCGACTCTAGAGGATCC As shown in CTACAGAGACCAGTTCATGGCA (SEQ ID NO.7). In this invention, the upstream and downstream primers used to amplify the OsSPL17 promoter, as well as the upstream and downstream primers used to amplify the OsSPL17 gene, contain homologous arms, which are underlined.
[0039] In this invention, the enzyme-digested pCAMBIA1300 vector is preferably ligated with the amplified and purified OsSPL17 promoter and OsSPL17 gene fragment to construct the vector. In this invention, the total volume of the ligation reaction system is preferably 10 μL, containing 100 ng·μL of each component. -1 pCAMBIA1300(BamHI)1μL, 100ng·μL -1 OsSPL17 promoter fragment 3μL, 100ng·μL -1 2 μL of OsSPL17 genomic fragment, 2 μL of 5×Buffer, 0.5 μL of recombinase, and 1.5 μL of double-distilled water. In this invention, the homologous recombination kit is preferably purchased from Suzhou Nearshore Protein Technology Co., Ltd. plusOnestepPCRCloning Kit (Novoprotein catalog number: NR005). In this invention, the pCAMBIA1300 vector is preferably digested with the restriction endonuclease BamHI. Both the pCAMBIA1300 vector and the restriction endonuclease are commercially available products. It should be noted that this invention uses pCAMBIA1300 as an example for vector construction; other vectors suitable for constructing transgenic structures, such as pCAMBIA1301, can also be used for the final vector selection.
[0040] In this invention, *E. coli* is transformed after ligation. The preferred specific steps are: transferring the ligation reaction product to a centrifuge tube, adding *E. coli* DH5α competent cells, and gently mixing with a pipette; placing the reaction tube on ice for 25-30 min, then placing the tube in a 42°C constant temperature water bath for heat shock treatment for 35-45 s, followed by rapid return to ice for 2-3 min; adding antibiotic-free LB liquid medium to each tube, mixing, and culturing at 37°C and 220 rpm for 35-45 min; after culturing, centrifuging for 10-20 s using a high-speed centrifuge, removing the supernatant, retaining a small amount of residual liquid, and resuspending the cells using a pipette; and evenly spreading the resuspended solution onto a medium containing antibiotic K. + The culture was carried out overnight at 37°C on the surface of LB solid medium; the next day, single colonies were picked based on the growth of single colonies for sequencing analysis.
[0041] In this invention, the successfully constructed final vector targeting OsSPL17 is transformed into Agrobacterium tumefaciens. The preferred steps are as follows: The recombinant plasmid is aspirated with a sterile pipette tip and added to Agrobacterium tumefaciens EHA105 competent cells, then gently mixed. The reaction tube is placed on ice and incubated for 3-5 minutes, followed by rapid freezing in liquid nitrogen for 5-8 minutes. The tube is then transferred to a 37°C water bath for 5-8 minutes. Antibiotic-free LB medium is added to each tube, mixed, and incubated on a shaker at 28°C for 2-3 hours to promote bacterial recovery. After incubation, the cells are centrifuged at high speed for 15-20 seconds to remove the supernatant, retaining a small amount of residual liquid, and resuspended using a pipette. The resuspended cells are evenly spread on LB solid medium containing K+ antibiotics and incubated upside down at 28°C for 24-36 hours until single-clone colonies form. Single-clone colonies are picked and sequenced to confirm their correctness, and the bacterial culture is then preserved.
[0042] In this invention, the callus tissue of rice recipient material obtained above is infected with Agrobacterium to regenerate transgenic rice plants, and transgenic rice plants with significantly improved stem strength are screened. In this invention, the rice recipient material is preferably Nipponbare and / or Wuyun Jing 7. Experimental verification shows that, compared with the wild type, the transgenic rice plants screened in this invention have significantly increased stem thickness, stem wall thickness, and stem bending resistance, indicating that OsSPL17 plays an important regulatory role in rice stem development and can be used for the breeding of lodging-resistant rice varieties.
[0043] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0044] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.
[0045] Example 1: Construction of an expression vector for the rice OsSPL17 gene driven by the OsSPL17 promoter
[0046] In this embodiment, based on the genomic sequence of the rice transcription factor gene OsSPL17 and the principle of homologous recombination, primers were designed to amplify the OsSPL17 gene promoter and the OsSPL17 gene itself. The nucleotide sequence of the OsSPL17 gene is shown in SEQ ID NO.1, the nucleotide sequence of the OsSPL17 gene promoter is shown in SEQ ID NO.3, the nucleotide sequence of the upstream primer OsSPL17-pro-F used to amplify the OsSPL17 gene promoter is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer OsSPL17-pro-R is shown in SEQ ID NO.5.
[0047] SEQ ID NO.4:
[0048] 5'- CGAGCTCGGTACCGAGGATCC CTCGATTAATGGGTTATATGCTAGCA-3';
[0049] SEQ ID NO.5: 5'- TCGCCAT TGCGGCAGGCGGTGGTCG-3'.
[0050] The nucleotide sequence of the upstream primer OsSPL17-gDNA-F used for amplifying the OsSPL17 gene is shown in SEQ ID NO. 6; the nucleotide sequence of the downstream primer OsSPL17-gDNA-R is shown in SEQ ID NO. 7.
[0051] SEQ ID NO.6: 5'- ACCGCCTGCCGCA ATGGCGACCGGCGCGGCAGC-3';
[0052] SEQ ID NO.7:
[0053] 5'- CAGGTCGACTCTAGAGGATCC CTACAGAGACCAGTTCATGGCA-3'.
[0054] The total volume of the PCR reaction system was 20 μL, containing 100 ng / μL of rice genome. -1 2 μL DNA, 10 μmol·L⁻¹ -1 Upstream primer and 10 μmol·L -12 μL each of downstream primers, 10 μL of 2× buffer, and 4 μL of double-distilled water.
[0055] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 2 min, for a total of 35 cycles; and a final extension at 72℃ for 10 min. The reaction products were separated by electrophoresis on an agarose gel.
[0056] The pCAMBIA1300 vector was linearized by BamHI digestion and then purified and recovered. The total volume of the digestion reaction system was 20 μL, containing 8 μL of plasmid, 2 μL of 10×Buffer, and 10 U / μL of enzyme. L-1 0.5 μL of distilled water and 9.5 μL of double-distilled water were mixed and placed in a 37℃ constant temperature water bath for 3-4 h for enzyme digestion. The enzyme digestion products were electrophoresed on an agarose gel and imaged with ultraviolet light. The target band was cut off for further purification and recovery.
[0057] The digested pCAMBIA1300 vector was ligated with the amplified and purified OsSPL17 promoter and genomic fragment to construct the vector. The total volume of the ligation reaction system was 10 μL, containing 100 ng / μL of each component. -1 pCAMBIA1300(BamHI)1μL, 100ng·μL -1 OsSPL17 promoter fragment 3μL, 100ng·μL -1 2 μL of OsSPL17 genome fragment, 2 μL of 5×Buffer, 0.5 μL of recombinase, and 1.5 μL of double-distilled water were mixed and placed in a 50°C water bath for 10 min for ligation.
[0058] After ligation, the cells were transformed into *E. coli*. The specific steps were as follows: 10 μL of the ligation product was transferred to a 1.5 mL centrifuge tube, and 50 μL of *E. coli* DH5α competent cells were added. The mixture was gently mixed using a pipette. The tube was placed on ice for 30 min, then subjected to heat shock at 42°C for 42 s, followed by immediate return to ice for 2 min. 500 μL of antibiotic-free LB broth was added to each tube, and the mixture was incubated at 37°C and 220 rpm for 40 min. After incubation, the cells were centrifuged for 15 s, the supernatant was removed, and a small amount of residual medium was retained. The cells were resuspended using a pipette. The resuspended cells were evenly spread onto a medium containing antibiotic K. + The culture was carried out overnight at 37°C on the surface of LB solid medium; the next day, single colonies were picked based on the growth of single colonies for sequencing analysis.
[0059] Example 2: Genetic transformation and screening of OsSPL17 transgenic rice
[0060] 1. Agrobacterium tumefaciens
[0061] The final vector targeting OsSPL17, successfully constructed in Example 1, was transformed into *Agrobacterium tumefaciens*. The specific steps were as follows: 2 μL of the recombinant plasmid was added to 100 μL of *Agrobacterium tumefaciens* EHA105 competent cells using a sterile pipette tip and gently mixed. The reaction tube was placed on ice and incubated for 5 min, then rapidly transferred to liquid nitrogen for 5 min of quick-freezing. Subsequently, the tube was transferred to a 37°C water bath and incubated for 5 min. 500 μL of antibiotic-free LB medium was added to each tube, mixed, and incubated on a shaker at 28°C for 2-3 hours to promote bacterial recovery. After incubation, the cells were centrifuged at high speed for 15 s to remove the supernatant, retaining a small amount of residual liquid, and resuspended using a pipette. The resuspended cells were evenly spread on LB solid medium containing K+ antibiotics and incubated upside down at 28°C for 24-36 hours until single-clone colonies formed. Single-clone colonies were picked and sequenced to confirm their correctness, and the bacterial culture was then preserved.
[0062] 2. Healing
[0063] After peeling and drying the seeds of Nipponbare and Takeun 7, they were sterilized with ethanol and sodium hypochlorite and then cultured on induction medium for 7 days to induce callus formation. The correctly sequenced strains were transferred to AAM culture medium containing acetylsyringone, and the suspension concentration was adjusted to OD0.05. 600 The concentration of the callus tissue was approximately 0.1. The callus tissue was mixed with the above Agrobacterium suspension and left to stand for 20 minutes, mixing every 5 minutes to allow Agrobacterium to infect the callus tissue. The treated callus tissue was removed and drained of liquid, then transferred to a co-culture medium and cultured in the dark for 3 days. After the culture was completed, the callus tissue was thoroughly washed with sterile water and transferred to a selective culture medium containing different concentrations of carbenicillin and hygromycin for two screenings. The resistant callus tissue obtained by screening was transferred to a differentiation medium to differentiate into seedlings, and then transferred to a rooting medium for seedling strengthening. After a 7-day hardening process, the stronger seedlings were transplanted into a greenhouse for growth, and finally transgenic rice seedlings were obtained.
[0064] 3. Identification of positive plants
[0065] After the transgenic rice plants obtained in step 2 survive, cut off fresh green leaves about 1 cm long (leaving cut ends) and place them flat in a liquid culture medium containing hygromycin and 6-BA. Incubate the leaves at room temperature for 5 days and observe their performance. If the leaves remain bright green, they are positive plants, indicating successful transgenic development. If the leaves show signs of necrosis, they are negative plants, indicating transgenic failure. Obtain positive T0 generation plants from the hygromycin screening and collect their seeds for further culture. After the T0 generation seeds germinate, obtain T1 generation transgenic seedlings and screen them again. Obtain homozygous T2 generation homozygous transgenic lines through hygromycin screening.
[0066] 4. Expression level detection
[0067] The homozygous T2 generation transgenic material obtained in step 3 was subjected to RNA extraction and cDNA synthesis, followed by qPCR quantitative analysis. This analysis confirmed that the expression level of OsSPL17 in both background transgenic materials was significantly higher than that in the control group. Figure 1 , Figure 4 The total reaction volume used for qPCR quantitative analysis was 20 μL, containing 10 μmol·L⁻¹ of each component. -1 Primer F / R 0.8 μL, 100 ng·μL -1 2 μL cDNA, 10 μL 2×Buffer, and 7.2 μL double-distilled water. The qPCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 10 s, 60℃ annealing for 30 s, for a total of 40 cycles; and 72℃ extension for 10 min.
[0068] The nucleotide sequence of the upstream primer OsSPL17-qPCR-F used for the detection of OsSPL17 expression is shown in SEQ ID NO. 8; the nucleotide sequence of the upstream primer OsSPL17-qPCR-F used for the detection of OsSPL17 expression is shown in SEQ ID NO. 9.
[0069] SEQ ID NO.8: 5'-TGCTCTCTCTCTTCTGTCAACT-3';
[0070] SEQ ID NO. 9: 5'-TGTAGTTGCTTGCCATGACC-3'.
[0071] Example 3: Stem phenotypic identification of transgenic rice
[0072] The OsSPL17 transgenic lines (NIP#1 and NIP#2) with the Nipponbare background obtained in Example 2, the OsSPL17 transgenic lines (WYJ7#1 and WYJ7#2) with the Wuyunjing 7 background, and wild-type Nipponbare and Wuyunjing 7 were planted in the transgenic experimental field, with 80 plants of each line. During the grain-filling stage, plants with normal growth but not adjacent to the edges were selected, and 2-3 stems were taken from each plant for stem morphology and stem bending resistance. Stem morphology was mainly measured by measuring stem thickness and stem wall thickness. Stem bending resistance was measured by placing the middle of the internode of the stem horizontally on two support points with a distance of 5 cm between the two support points. Force was applied to the middle of the internode until it broke, and the peak value of the force was the bending resistance of that internode.
[0073] like Figure 2 , Figure 5 As shown, the stem thickness of the OsSPL17 transgenic lines was significantly increased under both background conditions. Statistical results are as follows: Figure 3 , Figure 6 The results showed that, compared with wild-type Nipponbare, NIP#1 and NIP#2 exhibited increased stem thickness, increased stem wall thickness, and increased stem bending resistance, respectively. Under the Wuyunjing 7 background, WYJ7#1 and WYJ7#2 showed increased stem thickness, increased stem wall thickness, and increased stem bending resistance, respectively. These results indicate that OsSPL17 positively regulates rice stem thickness, stem wall thickness, and stem bending resistance. Increasing OsSPL17 expression can effectively increase rice stem strength, providing a new direction and target gene for the research and genetic improvement of lodging resistance traits in rice.
[0074] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An OsSPL17 gene for improving rice stem strength, characterized in that, The nucleotide sequence of the OsSPL17 gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the OsSPL17 gene is shown in SEQ ID NO.
2.
2. The application of the OsSPL17 gene as described in claim 1 in improving rice stem strength.
3. The application according to claim 2, characterized in that, The improvement of rice stem strength includes increasing rice stem thickness, rice stem wall thickness, and rice stem bending resistance.
4. The application of the OsSPL17 gene as described in claim 1 in regulating lodging resistance in rice.
5. A method for improving the strength of rice stems, characterized in that, Includes the following steps: The OsSPL17 gene and its promoter, as described in claim 1, were ligated together to the final vector pCAMBIA1300 using homologous recombination. The final vector was transformed into Agrobacterium competent cells and infected rice callus tissue to regenerate transgenic rice plants. Rice plants with increased stem thickness, increased stem wall thickness, and increased stem bending resistance were selected.
6. The method according to claim 5, characterized in that, The promoter nucleotide sequence of the OsSPL17 gene is shown in SEQ ID NO.
3.
7. The method according to claim 5 or 6, characterized in that, The nucleotide sequence of the upstream primer OsSPL17-pro-F used to amplify the OsSPL17 promoter is shown in SEQ ID NO.4, and the nucleotide sequence of the downstream primer OsSPL17-pro-R is shown in SEQ ID NO.
5.
8. The method according to claim 5, characterized in that, The nucleotide sequence of the upstream primer OsSPL17-gDNA-F used to amplify the OsSPL17 gene is shown in SEQ ID NO.6, and the nucleotide sequence of the downstream primer OsSPL17-gDNA-R is shown in SEQ ID NO.
7.
9. The method according to claim 5, characterized in that, The Agrobacterium is Agrobacterium tumefaciens EHA105.
10. The method according to claim 5, characterized in that, The rice recipient material is Japonica rice Nipponbare and / or Wuyun Japonica 7.