Novel genomic safe harbor and uses thereof

Abstract

The present invention relates to a novel genome safe harbor (GSH), a method for expressing an exogenous gene using the same, and a cell into which an exogenous gene is introduced by the same. According to the method for safely expressing the exogenous gene by using the novel genome, the exogenous gene can be safely introduced and stably expressed for a long time without damaging transcription of adjacent genes, so that various exogenous genes can be safely expressed in cells without potential safety hazards.

Description

Technical Field

[0001] The present invention relates to a novel genomic safe harbor (GSH) for gene insertion and a method for expressing a transgene using the same. Specifically, the present invention relates to a novel genomic safe harbor (GSH) for gene insertion, which can express various transgenes in cells without causing safety problems by safely introducing and stably expressing the transgene, and a method for expressing a transgene using the same. Background Art

[0002] Inserting a transgene into the human genome is a powerful means for treating human diseases. The gene inserted into human cells may change the characteristics of the host cell and can thus be used to treat diseases. However, techniques for precisely delivering and continuously expressing the gene should be applied.

[0003] The most common method for inserting a gene into the human genome is based on the use of retroviral or lentiviral vectors. However, these vectors tend to be inserted around actively transcribed genes, thereby increasing the possibility of causing mutations in the host cell. When genes related to cancer are mutated and their expression is disrupted, various types of cancer may develop.

[0004] As an alternative to viral vectors, a site-specific gene insertion system based on CRISPR-Cas9 and homology-directed repair (HDR) is used. CRISPR stands for Clustered Regularly Interspaced Short Palindromic Repeats and is a gene sequence that acts as an adaptive immune system in bacteria. When a bacterium is infected with a virus, the guide RNA (gRNA) expressed by CRISPR binds to the nuclease Cas9 and recognizes and cleaves the part of the viral genome that has a sequence complementary to the gRNA to prevent infection. HDR is a process of repairing damaged DNA using a DNA fragment homologous to the sequence at the corresponding position when a double-strand break (DSB) occurs. By inducing a DSB in the genome via gRNA and Cas9 and simultaneously introducing a donor vector having a sequence homologous to the transgene, gene insertion can be precisely induced.

[0005] With the use of technologies such as CRISPR-Cas9, the exploration of genomic regions suitable for the introduction of transgenes is also underway. Regions that can maintain transgene expression without disrupting the transcription of adjacent genes are called "genomic safe harbors" (GSH). It is well known that the adeno-associated virus integration site 1 (AAVS1) on chromosome 19 studied previously has been used as a GSH, but it is located in a region where genes are densely clustered and may therefore disrupt the transcription of adjacent genes (Sadelain et al., 2012), and the expression of the introduced transgene tends to be inhibited (Ordovas et al., 2015). Therefore, it is necessary to explore new GSH candidates for the safe introduction and stable expression of transgenes.

[0006] The inventors conducted various studies to find regions suitable for new genomic safe harbors. As a result, the inventors discovered a new genomic safe harbor region that does not disrupt the transcription of adjacent genes and stably expresses transgenes. Based on this discovery, the present invention was completed. Summary of the Invention

[0007] Technical Problem

[0008] Therefore, in view of the above problems, the present invention has been completed, and an object of the present invention is to provide a new genomic safe harbor for the safe introduction and stable expression of transgenes.

[0009] Another object of the present invention is to provide a method for expressing a transgene in a cell using the new genomic safe harbor.

[0010] Technical Solution

[0011] According to one aspect of the present invention, the above and other objects can be achieved by providing a method for expressing an exogenous polynucleotide in a cell, the method comprising: (1) expressing a nuclease by introducing a polynucleotide encoding the nuclease into the cell; (2) cleaving a nucleic acid region by specifically binding the nuclease to at least one nucleic acid region selected from the group consisting of: a first nucleic acid region at positions 24894446 to 24894525 in chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 in chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 in chromosome 4; and (3) introducing the exogenous polynucleotide into the cell and inserting the exogenous polynucleotide into the cleavage site of the nucleic acid region.

[0012] In one embodiment, the cell may be derived from human blood, body fluid, tissue, stem cell or cancer.

[0013] In one embodiment, the cell can be a somatic cell, germ cell, stem cell, cancer cell or cell line.

[0014] In one embodiment, the nuclease can include at least one selected from zinc finger nucleases, transcription activator-like effector nucleases (TALENs), and RNA-guided engineered nucleases (RGENs). In one embodiment, the nuclease can be Cas9.

[0015] In one embodiment, the polynucleotide encoding the nuclease can include at least one selected from a DNA binding domain, a guide RNA, and a cleavage domain.

[0016] In one embodiment, the method can further include introducing a polynucleotide encoding a guide RNA into the cell.

[0017] In one embodiment, the exogenous polynucleotide can include a polynucleotide encoding a polypeptide or a polynucleotide encoding a functional polyribonucleotide.

[0018] In one embodiment, the functional polyribonucleotide can include at least one selected from the group consisting of microRNA (miRNA), short hairpin RNA (shRNA), piRNA, small nucleolar RNA (snoRNA), small nuclear RNA (snRNA), and extracellular RNA (exRNA).

[0019] In one embodiment, the exogenous polynucleotide can encode at least one selected from the group consisting of an antibody, an enzyme, a growth factor, a receptor, a hormone, a lymphokine, a cytokine, a signaling factor, a reporter gene, and fragments thereof.

[0020] In one embodiment, the exogenous polynucleotide can be the sonic hedgehog (SHH) gene.

[0021] In one embodiment, the exogenous polynucleotide can include at least one selected from the group consisting of an open reading frame, a polyadenylation sequence, a promoter, an operon, an enhancer, a transcriptional regulatory element, a signal sequence, and at least one homologous region.

[0022] In one embodiment, the method may further include, after (2) cutting a nucleic acid region by specifically binding a nuclease to at least one nucleic acid region selected from the group consisting of a first nucleic acid region at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 on chromosome 4, introducing a left homologous arm (LHA) and a right homologous arm (RHA) into the exogenous polynucleotide, wherein the left homologous arm is a region that binds to a region up to 1 kb to the left of at least one cleavage site among the first to third nucleic acid regions, and the right homologous arm is a region that binds to a region up to 1 kb to the right of at least one cleavage site among the first to third nucleic acid regions.

[0023] In one embodiment, the method may further include, after (2) cutting a nucleic acid region by specifically binding a nuclease to at least one nucleic acid region selected from the group consisting of a first nucleic acid region at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 on chromosome 4, introducing a left homologous arm (LHA) and a right homologous arm (RHA) into the exogenous polynucleotide, wherein the left homologous arm is a region that binds to a region up to 0.8 kb to the left of at least one cleavage site among the first to third nucleic acid regions, and the right homologous arm is a region that binds to a region up to 0.8 kb to the right of at least one cleavage site among the first to third nucleic acid regions.

[0024] According to another aspect of the present invention, there is provided a cell having an exogenous polynucleotide inserted into the genome of the cell by at least one nuclease, wherein the exogenous polynucleotide is inserted into at least one of the following selected from the group consisting of: a first nucleic acid region at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 on chromosome 4.

[0025] According to another aspect of the present invention, there is provided a composition for expressing an exogenous polynucleotide in a cell, the composition comprising a polynucleotide encoding a nuclease and an exogenous polynucleotide, the nuclease specifically binding to at least one selected from a first nucleic acid region located at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region located at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region located at positions 120174229 to 120174308 on chromosome 4.

[0026] In one embodiment, the composition may further comprise a left homologous arm (LHA) and a right homologous arm (RHA), the left homologous arm being a region that binds to a region up to 1 kb to the left of at least one cleavage site among the first nucleic acid region to the third nucleic acid region, and the right homologous arm being a region that binds to a region up to 1 kb to the right of at least one cleavage site among the first nucleic acid region to the third nucleic acid region.

[0027] In one embodiment, the exogenous polynucleotide may be the sonic hedgehog (SHH) gene.

[0028] According to a further aspect of the present invention, there is provided a polynucleotide comprising a sequence having at least 90%, at least 95% or at least 99% sequence homology with any one of the sequences of SEQ ID NOs: 3 to 5.

[0029] The present invention also provides a polynucleotide which may comprise any one of the sequences of SEQ ID NOs: 3 to 5.

[0030] In one embodiment, the sequence of SEQ ID NO: 3 may specifically bind to a nucleic acid region located at positions 24894446 to 24894525 on chromosome 9 of the human genome.

[0031] In one embodiment, the sequence of SEQ ID NO: 4 may specifically bind to a nucleic acid region located at positions 9064276 to 9064355 on chromosome 3 of the human genome.

[0032] In one embodiment, the sequence of SEQ ID NO: 5 may specifically bind to a nucleic acid region located at positions 120174229 to 120174308 on chromosome 4 of the human genome.

[0033] According to a further aspect of the present invention, there is provided a polynucleotide comprising the sequences of SEQ ID NOs: 14 and 15.

[0034] According to a further aspect of the present invention, there is provided a polynucleotide comprising the sequences of SEQ ID NOs: 16 and 17.

[0035] In a further aspect of the present invention, there is provided a polynucleotide comprising the sequences of SEQ ID NO: 17 and 18.

[0036] In a further aspect of the present invention, there is provided a vector comprising the above polynucleotide.

[0037] Beneficial effects

[0038] The genomic safe harbor of the present invention can stably maintain the expression of a transgene even when the transgene is introduced, without interfering with the transcription of adjacent genes. Therefore, the genomic safe harbor of the present invention can be used for intracellular expression of various transgenes. Brief description of the drawings

[0039] Figure 1 It is a schematic diagram showing the gRNA / Cas9 expression vector of the present invention.

[0040] Figure 2 It is a schematic diagram showing the donor vector of the present invention.

[0041] Figure 3 It is a schematic diagram showing the process of generating the gRNA / Cas9 expression vector targeting AAVS1 and GSH1 to GSH3 of the present invention.

[0042] Figure 4 It is a schematic diagram showing the process of generating the donor vector of the present invention.

[0043] Figure 5 It is a schematic diagram showing the process of introducing a transgene using the gRNA / Cas9 expression vector and the donor vector of the present invention.

[0044] Figure 6 It is a graph showing the average fluorescence intensity of cells into which the GFP gene has been introduced.

[0045] Figure 7 It is a graph showing the expression changes of the adjacent genes of AAVS and GSH1 to GSH3 of the present invention.

[0046] Figure 8 It is a schematic diagram of the process of introducing the SHH gene into GSH3 of ES-MSC.

[0047] Figure 9 It is a graph showing the SHH mRNA expression of SHH overexpressing ES-MSC (SHH-ES-MSC) and an image showing the hair follicle regeneration ability of SHH overexpressing ES-MSC (SHH-ES-MSC).

[0048] Best mode

[0049] Hereinafter, with reference to the accompanying drawings, embodiments and examples of the present invention will be described in detail so that those skilled in the art can easily implement the present invention. However, the present invention can be implemented in various forms and is not limited to the embodiments and examples described herein.

[0050] It should be further understood that, unless otherwise defined, the term "comprising" as used herein specifies the presence of another element, but does not exclude the presence or addition of other elements.

[0051] As used herein, the term "genomic safe harbor" refers to a region where the expression of a transgene can be maintained without disrupting the transcription of adjacent genes.

[0052] As used herein, the term "nuclease" refers to a protein used for genome editing or gene editing, and examples thereof include, but are not limited to, zinc finger nucleases, TALENs (transcription activator-like effector nucleases), and RGENs (RNA-guided engineered nucleases).

[0053] As used herein, the term "exogenous polynucleotide" refers to an artificially introduced polynucleotide.

[0054] As used herein, the term "guide RNA" refers to an RNA that is specific for a target DNA, binds complementarily to the target DNA, and allows a nuclease to cleave the target DNA.

[0055] As used herein, the term "left homologous arm (LHA)" means a sequence capable of binding to the left end of a site in the human genomic DNA cleaved by a nuclease, and is preferably 1,000 base pairs, more preferably 800 base pairs.

[0056] As used herein, the term "right homologous arm (RHA)" means a sequence capable of binding to the right end of a site in the human genomic DNA cleaved by a nuclease, and is preferably 1,000 base pairs, more preferably 800 base pairs.

[0057] As used herein, the term "vector" refers to a construct capable of delivering one or more target genes or sequences into a host cell and preferably expressing one or more target genes or sequences in the host cell. Examples of vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors associated with cationic condensing agents, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic cells, such as producer cells.

[0058] As used herein, the term "prevention" means any act of inhibiting or delaying the onset of a disease by administering a composition, and the term "treatment" means any act of improving or beneficially altering the symptoms of a subject suspected of having a disease and having already started to develop by administering a composition.

[0059] The present invention will be described in more detail below in conjunction with embodiments. However, it is obvious to those skilled in the art that these embodiments are only used to illustrate the present invention and should not be construed as limiting the scope of the present invention.

[0060] [Embodiment 1]

[0061] Generation of a vector expressing a genomic safe harbor

[0062] A gRNA / Cas9 expression vector of SEQ ID NO.1 containing a gRNA sequence was prepared, and thus the vector was capable of expressing Cas9 protein, and since Cas9 acts on a sequence complementary to the gRNA, it induces double-strand DNA breaks (DSBs).

[0063] As Figure 1 shown, the gRNA / Cas9 expression vector includes an origin of replication (ori), a U6 promoter, a gRNA scaffold, a cytomegalovirus promoter (CMV promoter), a chicken β-actin promoter, a Cas9 gene, a puromycin resistance gene, a poly(A) tail, and an ampicillin resistance gene.

[0064] A donor vector of SEQ ID NO.2 was prepared for inserting a gene sequence encoding a target protein into the GSH. In this study, the efficiency of the system was measured by inserting a gene sequence encoding the green fluorescent protein (GFP) that emits fluorescence. As Figure 2 shown, the donor vector includes an origin of replication, a GSH homologous region, a puromycin resistance gene, a chicken β-actin promoter, a cytomegalovirus promoter, a GFP gene, a cHS4 insulator, and a kanamycin resistance gene, wherein the homologous region is designed to vary according to the position of the GSH.

[0065] [Table 1]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077] [Example 2]

[0078] Selection of genomic safe harbor candidates

[0079] The selection of GSH candidates was based on the following requirements: cancer-related genes, miRNAs, positions more than 300 kb away from functional small RNAs, positions more than 50 kb away from the 5' end of genes, positions more than 50 kb away from replication origins, positions more than 50 kb away from ultra-conserved regions, positions with low transcriptional activity, positions not included in copy number variation regions, positions included in open chromatin regions, sequences with only one copy on human chromosomes, and sequences without TTAA sequences (transposons).

[0080] Then, as shown in Table 1, three GSH candidate regions and the corresponding gRNA sequences were obtained using CRISPick, DeepSpCas9, and RGEN as gRNA derivation tools. CRISPick (Broad Institute) indicates the specificity degree of the gRNA's response to complementary positions on the genome based on the on-target score. DeepSpCas9 indicates the genome editing efficiency of the gRNA based on the indel frequency score. RGEN indicates whether there is a mismatch between the chromosome and the gRNA.

[0081] [Table 2]

[0082]

[0083] [Example 3]

[0084] Generation of gRNA / Cas9 expression vectors targeting AAVS1 and genomic safe harbors

[0085] gRNA inserts targeting AAVS1, GSH1, GSH2, and GSH3 were introduced into the gRNA / Cas9 expression vector (px459) as follows.

[0086] DNA oligonucleotides based on gRNA insertion sequences targeting AAVS1, GSH1, GSH2, and GSH3 were synthesized. Then, the gRNA / Cas9 expression vector was digested with the restriction enzyme BbsI, and the synthesized DNA oligonucleotides were introduced into the digested and linearized gRNA / Cas9 expression vector, followed by ligation. The introduction of the gRNA was verified by PCR, and the gRNA sequence introduced into the vector was verified by Sanger sequencing. The schematic diagram of this process is shown in Figure 3 as follows.

[0087] [Table 3]

[0088] SEQ ID NO: Name Base sequence 6 GSH1 - Primer F CACCGTTCAGTGCTCTACTCTTGT 7 GSH1 - Primer R AAACACAAGAGTAGAGCACTGAAC 8 GSH2 - Primer F CACCGTAAGCAAACCACAACGTCT 9 GSH2 - Primer R AAACAGACGTTGTGGTTTGCTTAC 10 GSH3 - Primer F CACCGTCTGAGACAGCTAATATCA 11 GSH3 - Primer R AAACTGATATTAGCTGTCTCAGAC 12 AAVS1 - Primer F ACCGTCCCCTCCACCCCACAGTG 13 AAVS1 - Primer R AACCACTGTGGGGTGGAGGGGAC

[0089] [Example 4]

[0090] Generation of the Donor Vector

[0091] To facilitate efficient HDR, target-dependent homologous sequences (≥800 kb) were introduced into the donor vector as follows. Approximately 800 kb upstream and downstream of the position where the CRISPR-Cas9 system induces DSBs are respectively referred to as the "left homologous arm" and the "right homologous arm". Then, based on the genome obtained from human adipose stem cells, the left and right homologous sequences of SEQ ID NOs: 14 to 21 according to the positions of AAVS1, GSH1, GSH2, and GSH3 in the genome were synthesized by PCR. Then, the donor vector was digested with the restriction enzymes PmeI and NotI. The homologous sequences were introduced into the donor vector linearized by digestion using the Gibson Assembly Master Mix (NEB), the introduction was verified by PCR, and the homologous DNA sequences introduced into the vector were verified by Sanger sequencing. As a result of this method, donor vectors of SEQ ID NOs: 22 to 25 were obtained, and the schematic diagram of this process is shown in Figure 4 as follows.

[0092] [Table 4]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106]

[0107]

[0108]

[0109]

[0110]

[0111]

[0112]

[0113]

[0114]

[0115]

[0116]

[0117]

[0118]

[0119]

[0120] [Example 5]

[0121] The GFP expression cassette of the donor vector was introduced into the AAVS1, GSH1, GSH2, and GSH3 sites in the genome and expression was verified.

[0122] 293T cells were used to verify the introduction and expression of the GFP gene. 293T cells were cultured in Dulbecco's modified Eagle's medium (Gibco) supplemented with 10% fetal bovine serum (v / v), penicillin (100 U / ml), and streptomycin (100 μg / ml).

[0123] 293T cells were seeded in 24-well culture dishes at a density of 5×10 4 cells / well one day before transfection and incubated in a CO 2 incubator for 24 hours. After 24 hours, the medium was replaced with 293T cell medium without antibiotics. 25 μl of Opti-MEM (Gibco) was seeded into two 1.5 ml tubes. In one tube (tube 1), 650 ng of gRNA / Cas9 vector was mixed with 1,300 ng of donor vector. In the other tube (tube 2), 2 μl of Lipofectamine 2000 was mixed. The solution in tube 2 was transferred to tube 1, then mixed and incubated at room temperature for 10 minutes. After 10 minutes, approximately 50 μl of the solution containing the vector was added to the 293T cells in the 24-well culture dish to induce transfection. After 48 hours, the medium was replaced with fresh medium.

[0124] The transfected cells were seeded at a density of 1,000 cells / 100 mm culture dish, and single-cell-derived colonies expressing GFP were screened after 2 weeks. 6, 7, 6, and 6 colonies were screened from 293T cells in which the GFP expression cassette was introduced into AAVS1, GSH1, GSH2, and GSH3, respectively. PCR was performed as shown in Figure 5 A to verify the transgenes introduced due to HDR, and the results are shown in Figure 5 B to 5E.

[0125] In addition, as shown in Table 5 below, the clones with verified gene introduction in AAVS1, GSH1, GSH2, and GSH3 were 16.67%, 42.85%, 50%, and 66.67%, respectively.

[0126] [Table 5]

[0127] GSH Knock - in % AAVS1 16.67 GSH1 42.85 GSH2 50.00 GSH3 66.67

[0128] To verify the expression stability of the introduced GFP gene, the mean fluorescence intensity (MFI) of GFP was measured once a week by flow cytometry for 4 weeks. As shown in Figure 6 the figure, when GFP was introduced into GSH1, GSH2, and GSH3, the MFI was higher compared to when GFP was introduced into AAVS1.

[0129] [Example 6]

[0130] Determine the changes in the expression of adjacent genes

[0131] It was verified whether stable expression of the transgene could be induced without disturbing the transcription of adjacent genes when the transgene was introduced into the GSH locus. The expression changes of 10 adjacent genes in AAVS1, 3 adjacent genes in GSH1, 1 adjacent gene in GSH2, and 4 adjacent genes in GSH3 were analyzed using real-time PCR. The positions of AAVS1, GSH1, GSH2, and GSH3 and the distances between adjacent genes are shown in Table 6.

[0132] Total RNA was extracted from 293T cells in which the GFP expression cassette had been introduced into AAVS1, GSH1, GSH2, and GSH3 using the PureLink RNA Mini Kit (Invitrogen). The extracted RNA was assayed and complementary DNA (cDNA) was synthesized using the AccuPower RT Master Mix (BIONEER). 100 ng of cDNA was analyzed using TB Green Premix Ex Taq± in the QuantStudio 1 Real-Time PCR System (Thermo Fisher) to measure the relative expression of each gene. Genes with a Ct of 37 or higher (IZUMO3) were excluded.

[0133] As Figure 7 shown in A, the expression of 5 out of 10 genes (NLRP2, EPS8L1, TNNI3, SYT5, and PTPRH) near AAVS1 was significantly increased or decreased. As Figure 7 shown in B, there was no significant difference in the expression of genes adjacent to GSH1. As Figure 7 shown in C, there was no significant difference in the expression of the gene NXPH1 adjacent to GSH2. As Figure 7 shown in D, there was no significant difference in the expression of all four genes adjacent to GSH3.

[0134] Therefore, it can be seen that the GSH1, GSH2, and GSH3 loci have higher gene expression efficiency than AAVS1 and do not affect the transcription of adjacent genes, and thus have excellent safety when introducing transgenes.

[0135] [Table 6]

[0136]

[0137] [Example 7]

[0138] Evaluation of hair follicle formation after introducing the sonic hedgehog (SHH) gene into the GSH3 locus of human embryonic stem cell-derived mesenchymal stem cells (ES-MSC)

[0139] 7.1 Generation of the SHH expression cassette

[0140] To introduce the SHH gene into the GSH3 locus of ES-MSC, a donor vector was produced, in which the SHH gene sequence was inserted instead of GFP, as Figure 8 shown. The production of the donor vector was carried out as follows. First, the GFP gene sequence was removed from the donor vector by restriction enzyme treatment. Then, the SHH gene fragment was generated from the SHH expression vector (OriGene) by PCR. The SHH gene fragment was inserted into the donor vector by Gibson assembly. The introduction of the fragment into the vector was verified by PCR, and the homologous DNA sequence introduced into the vector was verified by Sanger sequencing.

[0141] 7.2 Introduction of the SHH expression cassette into GSH3

[0142] The SHH expression cassette of the donor vector was introduced into the GSH3 locus. Then, experiments were conducted to verify the expression of the SHH expression cassette. ES-MSC was incubated in StemPro MSC SFM XenoFree medium (Gibco) containing L-glutamine (2 mM), penicillin (100 U / ml), and streptomycin (100 μg / ml). The gRNA / Cas9 expression vector was mixed with the donor vector at a ratio of 1:2, and the resulting mixture was transfected into 2x10 6 ES-MSC cells using a Neon electroporation device (Invitrogen). The overexpression of the SHH gene was verified by real-time PCR. As Figure 9 shown in A, the results showed that the expression of SHH mRNA in the transfected cells increased by approximately 13-fold.

[0143] 7.3 Evaluation of hair follicle neogenesis of the SHH expression cassette

[0144] The patch test was used to evaluate the hair follicle neogenesis of SHH-overexpressing ES-MSC (SHH-ES-MSC). Epidermal cells and dermal cells were isolated from the skin of neonatal C57BL / 6 mice. 100 ES-MSC spheres (n = 1×10 4 cells) cultured in an ultra-low attachment 96-well round bottom plate (S-Bio) were mixed with 1×10 6 epidermal cells, and the resulting mixture was subcutaneously transplanted onto the back of 6-week-old nude mice (BALB / cAJcl-nu). The group transplanted with the mixture of epidermal and dermal cells was used as a positive control, and the group transplanted with only epidermal cells was used as a negative control. As Figure 9 shown in B, hair follicles formed in the group transplanted with SHH-ES-MSC 3 weeks after transplantation.

Claims

1. A method for expressing an exogenous polynucleotide in a cell, the method comprising: (1) expressing a nuclease by introducing a polynucleotide encoding the nuclease into the cell; (2) cleaving a nucleic acid region by specifically binding the nuclease to at least one nucleic acid region selected from the group consisting of: a first nucleic acid region at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 on chromosome 4; and (3) introducing the exogenous polynucleotide into the cell and inserting the exogenous polynucleotide into the cleavage site of the nucleic acid region.

2. The method according to claim 1, wherein, the cell is derived from human blood, body fluid, tissue, stem cell or cancer.

3. The method according to claim 1, wherein, the cell is a somatic cell, germ cell, stem cell, cancer cell or cell line.

4. The method according to claim 1, wherein, the nuclease comprises at least one selected from the group consisting of zinc finger nuclease, transcription activator-like effector nuclease (TALEN) and RNA-guided engineered nuclease (RGEN).

5. The method according to claim 4, wherein, the nuclease is Cas9.

6. The method according to claim 1, wherein, the polynucleotide encoding the nuclease comprises at least one selected from the group consisting of a DNA binding domain, a guide RNA and a cleavage domain.

7. The method according to claim 1, further comprising introducing a polynucleotide encoding a guide RNA into the cell.

8. The method according to claim 1, wherein, the exogenous polynucleotide comprises a polynucleotide encoding a polypeptide or a polynucleotide encoding a functional polyribonucleotide.

9. The method according to claim 8, wherein, the functional polyribonucleotide comprises at least one selected from the group consisting of microRNA (miRNA), short hairpin RNA (shRNA), piRNA, small nucleolar RNA (snoRNA), small nuclear RNA (snRNA) and extracellular RNA (exRNA).

10. The method according to claim 8, wherein, the exogenous polynucleotide encodes at least one selected from the group consisting of an antibody, an enzyme, a growth factor, a receptor, a hormone, a lymphokine, a cytokine, a signal transduction factor, a reporter gene and a fragment thereof.

11. The method according to claim 8, wherein, the exogenous polynucleotide is the sonic hedgehog (SHH) gene.

12. The method according to claim 8, wherein, the exogenous polynucleotide comprises at least one selected from the group consisting of an open reading frame, a polyadenylation sequence, a promoter, an operon, an enhancer, a transcriptional regulatory element, a signal sequence and at least one homologous region.

13. The method according to claim 1 further comprises introducing a left homologous arm (LHA) and a right homologous arm (RHA) into the exogenous polynucleotide, wherein the left homologous arm is a region that binds to a region up to 1 kb to the left of at least one cleavage site among the first nucleic acid region to the third nucleic acid region, and the right homologous arm is a region that binds to a region up to 1 kb to the right of at least one cleavage site among the first nucleic acid region to the third nucleic acid region.

14. The method according to claim 13 further comprises introducing a left homologous arm (LHA) and a right homologous arm (RHA) into the exogenous polynucleotide, wherein the left homologous arm is a region that binds to a region up to 0.8 kb to the left of at least one cleavage site among the first nucleic acid region to the third nucleic acid region, and the right homologous arm is a region that binds to a region up to 0.8 kb to the right of at least one cleavage site among the first nucleic acid region to the third nucleic acid region.

15. A cell having an exogenous polynucleotide inserted into the cell genome by at least one nuclease, wherein, the exogenous polynucleotide is inserted into at least one of the following selected from the genome of the cell: a first nucleic acid region at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 on chromosome 4.

16. A composition for expressing an exogenous polynucleotide in a cell, the composition comprising: a polynucleotide encoding a nuclease that specifically binds to at least one of a first nucleic acid region at positions 24894446 to 24894525 on chromosome 9 of the human genome, a second nucleic acid region at positions 9064276 to 9064355 on chromosome 3, and a third nucleic acid region at positions 120174229 to 120174308 on chromosome 4; and an exogenous polynucleotide.

17. The composition according to claim 16, the composition further comprising: a left homologous arm (LHA), the left homologous arm being a region that binds to a region up to 1 kb to the left of at least one cleavage site among the first nucleic acid region to the third nucleic acid region; and a right homologous arm (RHA), the right homologous arm being a region that binds to a region up to 1 kb to the right of at least one cleavage site among the first nucleic acid region to the third nucleic acid region.

18. The composition according to claim 17, the composition further comprising: a left homologous arm (LHA), the left homologous arm being a region that binds to a region up to 0.8 kb to the left of at least one cleavage site among the first nucleic acid region to the third nucleic acid region; and a right homologous arm (RHA), the right homologous arm being a region that binds to a region up to 0.8 kb to the right of at least one cleavage site among the first nucleic acid region to the third nucleic acid region.

19. The composition according to claim 16, wherein, the exogenous polynucleotide is the sonic hedgehog (SHH) gene.

20. A polynucleotide comprising a sequence having 90% or higher sequence homology with any one of the sequences of SEQ ID NOs: 3 to 5.

21. The polynucleotide according to claim 20, wherein, the polynucleotide comprises a sequence having 95% or higher sequence homology with any one of the sequences of SEQ ID NOs: 3 to 5.

22. The polynucleotide according to claim 20, wherein, the polynucleotide comprises a sequence having 99% or higher sequence homology with any one of the sequences of SEQ ID NOs: 3 to 5.

23. The polynucleotide according to claim 20, wherein, the polynucleotide comprises any one of the sequences of SEQ ID NOs: 3 to 5.

24. The polynucleotide according to claim 20, wherein, the sequence of SEQ ID NO: 3 specifically binds to the nucleic acid region at positions 24894446 to 24894525 in chromosome 9 of the human genome.

25. The polynucleotide according to claim 20, wherein, the sequence of SEQ ID NO: 4 specifically binds to the nucleic acid region at positions 9064276 to 9064355 in chromosome 3 of the human genome.

26. The polynucleotide according to claim 20, wherein, the sequence of SEQ ID NO: 5 specifically binds to the nucleic acid region at positions 120174229 to 120174308 in chromosome 4 of the human genome.

27. A polynucleotide comprising the sequences of SEQ ID NOs: 14 and 15.

28. A polynucleotide comprising the sequences of SEQ ID NOs: 16 and 17.

29. A polynucleotide comprising the sequences of SEQ ID NOs: 18 and 19.

30. A vector comprising the polynucleotide according to any one of claims 27 to 29.

Images