A spirotetramat / SPc / dsDpp multi-component compound insecticide and its preparation method

Abstract

The present invention provides a spirotetramat / SPc / ds Dpp Multi-component compound insecticide and preparation method thereof, the compound insecticide comprising spirotetramat / SPc complex and ds Dpp The SPc and ds in the spirotetramat / SPc complex Dpp The mass ratio of ds is 0.1-10; Dpp The nucleotide sequence of the nucleotide sequence is shown in SEQ ID NO. 1. The spirotetramat / SPc / ds Dpp ds in multi-component compound insecticides Dpp Silencing of fatty acid synthesis and epidermal formation by RNAi Dpp Gene, leading to aphid molting failure and epidermal defects; SPI further destroys the epidermal barrier by inhibiting lipid metabolism. The combination of the two significantly increases the mortality rate to 94.5-96.6% and shortens the initial onset time.

Description

Technical Field

[0001] The present invention belongs to the field of insecticides, and in particular relates to a spirotetramat / SPc / ds Dpp Multi-component compound insecticide and preparation method thereof. Background Art

[0002] Faced with the limitations of traditional synthetic pesticides due to environmental pollution and increased pest resistance, RNAi technology, with its high specificity and low residual potential, has become a revolutionary approach to green pesticides. However, it is limited by the susceptibility of dsRNA to degradation in insects, low efficiency of single-target targets, and high costs of target screening. The introduction of nanomaterials (such as chitosan and liposomes) protects dsRNA by encapsulating it and promoting internalization, but still struggles to overcome the limitations of single-target bioavailability. The existing commercial agent, spirotetramat, suffers from slow action and poor efficacy, further limiting its potential for rapid pest control. Summary of the Invention

[0003] In view of this, the present invention aims to overcome the defects in the prior art and proposes a spirotetramat / SPc / ds Dpp Multi-component compound insecticide and preparation method thereof.

[0004] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0005] The present invention provides a spirotetramat / SPc / ds Dpp Multi-component compound insecticide, the compound insecticide comprises spirotetramat / SPc complex and ds Dpp , the ds Dpp The mass ratio of ds to SPc in the spirotetramat / SPc complex is 0.1-3:1; Dpp The nucleotide sequence is shown in SEQ ID NO.1.

[0006] Furthermore, the spirotetramat / SPc complex is formed by incubating the nanocarrier SPc with spirotetramat, and the mass ratio of the nanocarrier SPc to spirotetramat is 1-6:1.

[0007] Preferably, the ds Dpp The mass ratio of spirotetramat to SPc in the spirotetramat / SPc complex is 0.5-2:1.

[0008] The present invention also provides a spirotetramat / SPc / ds Dpp The preparation method of the multi-component compound insecticide comprises the following steps:

[0009] Step 1 is to incubate the nanocarrier SPc with an excess of spirotetramat to obtain a spirotetramat / SPc complex;

[0010] Step 2 is to combine the spirotetramat / SPc complex with ds Dpp Incubate to obtain the spirotetramat / SPc / ds Dpp Multi-component compound insecticide.

[0011] Furthermore, the incubation step in step 1 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

[0012] Furthermore, the incubation step in step 2 is performed at a temperature of 20-35° C. and for a time of 1-30 minutes.

[0013] The star-shaped polycation (SPc), with its combined hydrophobic core and multifunctional hydrophilic shell, not only enhances the stability of dsRNA but also, through a multi-component synergistic delivery strategy, achieves a dual linkage effect of "gene regulation + chemical intervention," significantly improving control effectiveness and reducing R&D costs. This technological system, through the multifunctional integration of nanocarriers and the spatiotemporal synergy of multiple active ingredients, offers a new paradigm for addressing the challenges of RNA pesticide industrialization, combining high efficiency, sustainability, and environmental friendliness.

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] The spirotetramat / SPc / ds of the present invention Dpp ds in multi-component compound insecticides Dpp Silencing of fatty acid synthesis and epidermal formation by RNAi Dpp gene, leading to molting failure and epidermal defects in aphids; SPI further destroys the epidermal barrier by inhibiting lipid metabolism. The combination of the two significantly increases the mortality rate to 94.5-96.6% and shortens the initial onset time; SPc loads SPI through the hydrophobic core and electrostatically adsorbs ds Dpp , forming stable nanoparticles (322.95 nm, +28.22mV), whose positive charge characteristics enhance the contact area between plant leaves and aphids, promote transmembrane absorption and stomach toxicity / contact toxicity; and SPc delivers ds Dpp Rapid action overcomes the short-term effectiveness and hysteresis of the single component of SPI, achieving efficient prevention and control of target pests. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 ds described in Example 2 of the present invention Dpp Myzus persicae Dpp The relative expression level of

[0017] Figure 2 ds described in Example 2 of the present invention Dpp Mortality of peach aphid after treatment;

[0018] Figure 3 ds described in Example 2 of the present invention Dpp The death phenotype of peach aphid after treatment;

[0019] Figure 4 ds described in Example 2 of the present invention Dpp Volcano plot of transcriptome analysis after processing;

[0020] Figure 5 ds described in Example 2 of the present invention Dpp KEGG analysis after processing;

[0021] Figure 6 This is a heat map of gene expression related to fatty acid synthesis described in Example 2 of the present invention;

[0022] Figure 7 The drug loading efficiency of the nanocarrier for spirotetramat described in Example 2 of the present invention is shown in Figure a: wherein Figure a shows the absorbance values ​​at different concentrations, Figure b shows the curve of the ultraviolet absorbance value of spirotetramat at 277 nm versus its concentration, and Figure c shows the drug loading efficiency;

[0023] Figure 8 ds described in Example 2 of the present invention Dpp Agarose gel electrophoresis of spirotetramat / SPc binding;

[0024] Figure 9 ds described in Example 2 of the present invention Dpp Isothermal titration calorimetry results of spirotetramat / SPc titration;

[0025] Figure 10 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Transmission electron micrographs of: Figure a is spirotetramat, Figure b is spirotetramat / SPc, and Figure c is ds Dpp d is spirotetramat / SPc / ds Dpp ;

[0026] Figure 11 The brilliant blue-labeled spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Statistical analysis of multi-component insecticides on the back of green peach aphid;

[0027] Figure 12 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Mortality of green peach aphid after application of multi-component compound insecticide on backboard;

[0028] Figure 13 The spirotetramat / SPc / ds described in Example 2 of the present invention DppFluorescence quantitative results of green peach aphids after multi-component compound insecticide was applied to the back of the board: Figure a is AAC, Figure b is FAS, Figure c is FABP, and Figure d is FACR;

[0029] Figure 14 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Triglyceride content after the multi-component compound insecticide was applied to the back of the peach aphid;

[0030] Figure 15 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Mortality of green peach aphids after feeding multi-component insecticides through membranes;

[0031] Figure 16 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Fluorescence quantitative results of green peach aphids fed with multi-component compound insecticide films: Figure a is AAC, Figure b is FAS, Figure c is FABP, and Figure d is FACR;

[0032] Figure 17 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Triglyceride content after feeding green peach aphids with multi-component insecticide film;

[0033] Figure 18 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp The mortality rate of simple mixtures of multi-component insecticides and other pesticides;

[0034] Figure 19 The spirotetramat / SPc / ds described in Example 2 of the present invention Dpp Multicomponent compound insecticide and spirotetramat / SPc / ds Scr mortality rate. DETAILED DESCRIPTION

[0035] Unless otherwise defined, the technical terms used in the following examples have the same meanings as commonly understood by those skilled in the art to which this invention belongs. The experimental reagents used in the following examples, unless otherwise specified, are conventional biochemical reagents; the experimental methods described, unless otherwise specified, are conventional methods.

[0036] For the preparation method of SPc, please refer to the article "A Facile-Synthesized Star Polycation Constructed as a Highly Efficient Gene Vector in Pest Management".

[0037] The present invention will be described in detail below with reference to the embodiments.

[0038] Example 1 Spirotetramat / SPc / ds Dpp Preparation of multi-component compound insecticide

[0039] 1.ds Dpp Synthesis

[0040] First, total RNA from each instar of P. persicae was extracted using an RNA extraction kit (Quanshijin, China), and its quality was checked by measuring RNA concentration and performing 1% agarose gel electrophoresis. Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara, Japan).

[0041] Obtained from NCBI website Dpp (gene number: LOC111033800), the target fragment primers were designed and synthesized (forward primer: GGTTTGCACACAACAACTGC, the nucleotide sequence is shown in SEQ ID NO.2; backward primer: TCCAGTGTGCTTTTCTGGCT, the nucleotide sequence is shown in SEQ ID NO.3). Using the green peach aphid cDNA as a template, the above primers were used to amplify the target fragment by PCR. Dpp The target fragment was detected by agarose gel electrophoresis. After the target band was recovered using a gel extraction kit, it was ligated with pMD19T-Vector and transformed into competent E. coli (DH5α) cells. The transformation product was evenly spread on LB solid medium supplemented with 100 mg / L ampicillin and incubated in an inverted manner at 37°C overnight. The next day, a single colony was selected as a template for PCR verification, and positive strains were sequenced.

[0042] Extract the plasmid of the strain with the correct sequencing results as a template and use the T7 sequence Dpp The primers were used for PCR amplification again, and the amplified products were recovered using a gel recovery kit. Finally, the ds Dpp .

[0043] 2.ds Dpp Analysis of the lethal mechanism of interference with green peach aphid

[0044] 150 ng of ds eGFP (control) and ds Dpp Twenty peach aphids were treated separately, with three replicates for each treatment. Total RNA was extracted 24 hours after treatment. After reverse transcription, the RNA was determined by fluorescence quantitative PCR. Dpp The relative expression of genes, such as Figure 1 As shown, it was found that ds DppMyzus persicae Dpp The expression level of α-glucose was reduced to 47.2%; the mortality rate within 3 days was observed and recorded, and the mortality rate was expressed as ds eGFP The treatment was used as the control and the corrected mortality rate was calculated as Figure 2 As shown, it was found that ds Dpp The mortality rate of green peach aphid reached 35.1%, ds Dpp The death phenotype of peach aphid after treatment is as follows Figure 3 As shown. Total RNA from each aphid tissue was extracted 24 hours after treatment using TRNzol (TIANGEN, China). Three independent samples were prepared for each treatment. Transcriptome libraries were constructed using the Illumina HiSeq sequencing platform and compared and annotated with the KEGG database using BLASTX. The expression level of each transcript was characterized by the FPKM value. Transcriptome analysis revealed that the ds Dpp Processing, ds eGFP The expression of 391 genes was significantly changed in the treatment. A total of 348 genes were up-regulated and 43 genes were down-regulated, such as Figure 4 KEGG analysis revealed that DEGs can be divided into multiple gene pathways, such as fat digestion and absorption, hormone synthesis and metabolism, and stratum corneum formation. Figure 5 DESeq was used to analyze the differentially expressed genes (DEGs) between different treatments, and the screening conditions were fold change ≥ 2.0 and FDR < 0.01, to further explore the ds Dpp The molecular mechanism of the lethal effect of interference on green peach aphid. Dpp Compared to ds eGFP Treatment, the expression of a variety of genes related to fatty acid synthesis was down-regulated, and interference was found Dpp Genes can reduce the synthesis of fatty acids in green peach aphids, such as Figure 6 As described. FASL、FACR1 and FACR3 Reducing the expression of the gene can significantly reduce the synthesis of fatty acids. FABP plays an important role in the transport of long-chain fatty acids in cells. ELOVL4 is involved in the synthesis of long-chain fatty acids and plays an important role in body wall development. Long-chain fatty acids are not only important components of cell membranes but also important respiratory substrates, interfering with Dpp This leads to a decrease in long-chain fatty acids, which seriously affects the growth and development of peach aphids, especially during the molting process when the consumption capacity is relatively high, resulting in the peach aphids being unable to molt successfully and dying.

[0045] 3. Preparation of spirotetramat / SPc / ds using nanocarriers Dpp Multi-component compound insecticide

[0046] After incubating the nanocarrier (SPc) with an excess of spirotetramat, the mixture was dialyzed using a 20,000 Da dialysis bag to remove any spirotetramat not bound to the nanocarrier. This resulted in a spirotetramat / SPc complex, and the drug loading efficiency of SPc on spirotetramat was calculated. Spirotetramat spontaneously binds to SPc in aqueous solution to form the spirotetramat / SPc complex. The UV absorbance of spirotetramat at 277 nm is proportional to its concentration. Based on this, the drug loading efficiency of SPc on spirotetramat was calculated to be 24.7%. Figure 7 Then, spirotetramat and SPc were added accurately according to the drug loading rate and incubated at room temperature for 15 minutes to obtain spirotetramat / SPc complex. Subsequently, ds Dpp , incubated at room temperature for 15 min, and the ds Dpp The optimal binding ratio with spirotetramat / SPc complex is when ds Dpp After binding to spirotetramat / SPc, it is difficult to move in agarose gel under the action of electric field, e.g. Figure 8 As shown, when ds Dpp When the mass ratio of ds to SPc is 1:1, Dpp Completely bind to spirotetramat / SPc. Finally, add ds Dpp The spirotetramat / SPc complex was incubated at room temperature for 15 min to obtain spirotetramat / SPc / ds Dpp Multi-component compound insecticide.

[0047] Example 2 Spirotetramat / SPc / ds Dpp Testing of multi-component compound pesticides

[0048] 1. Spirotetramat / SPc / ds Dpp Analysis and characterization of the binding mechanism of multi-component compound insecticides

[0049] Analysis of spirotetramat / SPc and ds using isothermal titration calorimetry (ITC) Dpp The specific operation is as follows: in 2 mL of spirotetramat / SPc (0.1 mM) solution, 250 μL of 1 mM ds Dpp , and record the thermodynamic parameters during the titration process to analyze the binding mechanism of the multi-component compound insecticide. The isothermal titration calorimetry results are as follows Figure 9 As shown, ds Dpp Has a low dissociation coefficient K with spirotetramat / SPc d (M) is 7.9×10 -6, indicating that there is a strong interaction between the two. The entropy change ΔH is -10.1 kJ / mol, the function change ΔS is 64.1 J / mol•K, and according to Gibbs free energy: ΔG=ΔH-TΔS, the Gibbs free energy ΔG of the interaction reaction between the two substances is calculated to be -29.2 kJ / mol, indicating that ds Dpp It can spontaneously bind to spirotetramat / SPc. Based on the ΔH and ΔS of the reaction, it can be inferred that ds Dpp The binding interaction between spirotetramat / SPc is mainly electrostatic.

[0050] In addition, high-sensitivity Zeta potential and particle size analyzer were used to determine spirotetramat, ds Dpp , SPc and its different combinations (spirotetramat / SPc, ds Dpp / SPc、Spirotetramat / SPc / ds Dpp ). Transmission electron microscopy was used to observe the particle morphology, thereby characterizing the structural characteristics of the multi-component compound insecticide. The particle size of spirotetramat in aqueous solution was 350 nm, while the particle size of the spirotetramat / SPc complex was reduced to 142 nm. After dsRNA bound to spirotetramat / SPc, particles with a size of were formed, as shown in Table 1.

[0051] Table 1 Particle size of different components

[0052]

[0053] The results in Table 1 are consistent with the results of transmission electron microscopy. Spirotetramat is an irregular accumulation, spirotetramat / SPc is an irregular near-spherical body, ds Dpp It is a linear chain and forms spheres of uniform size after combining with spirotetramat / SPc, such as Figure 10 shown.

[0054] 2. Spirotetramat / SPc / ds Dpp Effects of multi-component compound insecticides on the attachment of aphids

[0055] In water, spirotetramat / SPc, ds Dpp and spirotetramat / SPc / ds Dpp Brilliant blue solution was added to the solution to mark the solution. The above solutions were dripped onto the back of peach aphids, and then the peach aphid images were taken under a stereo microscope. The area of ​​solution adhesion of different treatment groups was statistically analyzed using ImageJ software, and the area of ​​solution in the water treatment group was used as the normalization benchmark. After the solution with brilliant blue marker was dripped onto the back of peach aphids, the area of ​​brilliant blue adhesion was calculated, and it was found that ds Dpp There is a certain improvement in adhesion ability but no significant difference, spirotetramat / SPc and spirotetramat / SPc / ds DppThe multi-component insecticides increased by 1.5 times and 1.6 times respectively. Figure 11 shown.

[0056] 6. Spirotetramat / SPc / ds Dpp Activity testing of multi-component compound insecticides

[0057] Evaluation of spirotetramat / SPc / ds by membrane feeding method Dpp Toxicity of multi-component compound insecticides to aphids. The following treatments were set: water (control), SPc, spirotetramat (10 mg / L), spirotetramat / SPc (10 mg / L), dsDpp / SPc (100 mg / L), and spirotetramat / SPc / ds Dpp (Spirotetramat: 10 mg / L, ds Dpp Each treatment was fed approximately 20 peach aphids, with three replicates. Mortality was observed and recorded over a four-day period, and the corrected mortality rate was calculated using the water-treated group as the control.

[0058] The back plate drop method was used to further evaluate the effect of spirotetramat / SPc / ds Dpp The toxicity of multi-component compound insecticide to aphids. The treatment groups and concentration settings were the same as above. Each group treated approximately 20 peach aphids with 3 replicates. The mortality rate of aphids was recorded within 4 days. The corrected mortality rate was finally calculated using the water treatment group as the control. Figure 12 As shown, 4 days after treatment Dpp The corrected mortality rate of spirotetramat was 25.7%, the corrected mortality rate of spirotetramat was 60.7%, the mortality rate of spirotetramat / SPc increased to 79.5%, and the mortality rate of spirotetramat / SPc / ds Dpp The multi-component insecticide increased it to 98.0%, and almost all of them died.

[0059] To further investigate the effects of various treatments on genes related to fatty acid synthesis and physiological parameters in peach aphids, total RNA was extracted 24 hours after treatment. After reverse transcription, the relative expression levels of genes related to fatty acid synthesis, such as AAC, FAS, FABP, and FACR, were determined by quantitative PCR, with three replicates for each treatment. Furthermore, triglyceride levels in peach aphids were measured using a triglyceride detection kit two days after each treatment, also with three replicates for each treatment.

[0060] One day after treatment, fluorescence quantitative analysis revealed that genes related to fatty acid synthesis and transport, such as AAC, FAS, FABP, and FACR, were significantly downregulated. Figure 13 As shown. After 2 days of treatment, the triglyceride detection kit detected ds DppAfter treatment with spirotetramat and spirotetramat / SPc, the triglyceride content decreased significantly. Dpp There was a further significant decrease in the efficacy of multi-component insecticides, such as Figure 14 shown.

[0061] Evaluation of spirotetramat / SPc / ds by membrane feeding method Dpp The toxicity of multi-component compound insecticides to aphids. Figure 15 As shown, 4 days after treatment Dpp The corrected mortality rate of spirotetramat was 40.5%, the corrected mortality rate of spirotetramat was 74.1%, the mortality rate of spirotetramat / SPc increased to 93.5%, and the mortality rate of spirotetramat / SPc / ds Dpp The multi-component insecticide was increased to 100%, and all of them died.

[0062] One day after treatment, fluorescence quantitative analysis revealed that genes related to fatty acid synthesis and transport, such as AAC, FAS, FABP, and FACR, were significantly downregulated. Figure 16 As shown. After 2 days of treatment, the triglyceride detection kit detected ds Dpp After treatment with spirotetramat and spirotetramat / SPc, the triglyceride content decreased significantly. Dpp There was a further significant decrease in the efficacy of multi-component insecticides, such as Figure 17 shown.

[0063] Comparison of spirotetramat / SPc / ds using the backplate drip method Dpp Multi-component compound insecticide with imidacloprid (wherein the mass ratio of imidacloprid to spirotetramat is 1:1) and ds Dpp The results are as follows: Figure 18 As shown, 4 days after treatment, spirotetramat / SPc / ds Dpp The multi-component insecticide increased to 96.1%, almost all of them died, but when ds Dpp When spirotetramat / SPc / ds was mixed with imidacloprid, the mortality rate was only 67.8%, indicating that the multi-component compound insecticide with spirotetramat was more effective. Scr After compounding to form a ternary complex (ds Scr The nucleotide sequence of the nucleotide sequence is shown in SEQ ID NO. 4) and the mortality rate was only 64.9%, while spirotetramat / SPc / ds Dpp It reached 94.5%, and the results were as follows Figure 19 shown.

[0064] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A spirotetramat / SPc / ds Dpp Multi-component compound insecticide, characterized by: The compound insecticide comprises spirotetramat / SPc complex and ds Dpp , the ds Dpp The mass ratio of ds to SPc in the spirotetramat / SPc complex is 0.5-2:1; Dpp The nucleotide sequence is shown in SEQ ID NO.1; the spirotetramat / SPc complex is formed by incubating the nanocarrier SPc with spirotetramat, and the mass ratio of the nanocarrier SPc to spirotetramat is 1-6:

1.

2. Spirotetramat / SPc / ds according to claim 1 Dpp The preparation method of the multi-component compound insecticide is characterized by: The steps include: Step 1 is to incubate the nanocarrier SPc with an excess of spirotetramat to obtain a spirotetramat / SPc complex; Step 2 is to combine the spirotetramat / SPc complex with ds Dpp Incubate to obtain the spirotetramat / SPc / ds Dpp Multi-component compound insecticide.

3. Spirotetramat / SPc / ds according to claim 2 Dpp The preparation method of the multi-component compound insecticide is characterized by: The temperature of the incubation step in step 1 is 20-35° C. and the time is 1-30 minutes.

4. Spirotetramat / SPc / ds according to claim 2 Dpp The preparation method of the multi-component compound insecticide is characterized by: The temperature of the incubation step in step 2 is 20-35° C. and the time is 1-30 minutes.

Images