Application of OSI-027 in inhibition of proliferation of cells carrying beta-catenin activation mutation

Abstract

The invention relates to the technical field of biological medicines, in particular to application of OSI-027 in inhibition of proliferation of cells carrying beta-catenin activation mutation. The mTORC inhibitor OSI-027 is found to be capable of inhibiting proliferation of embryo fibroblasts carrying beta-catenin activation mutation and hepatoma carcinoma cells such as HEPA1-6, HUH7, SNU886, HepG2 and HCCLM3, and has no toxic or side effect under a proper dosage; and after the beta-catenin is knocked down, the proliferation inhibition capability of the OSI-027 on HepG2 and HCCLM3 cells is obviously reduced. Therefore, the OSI-027 can be used for preparing a cell proliferation inhibitor carrying beta-catenin activation mutation when the beta-catenin is activated and mutated into a treatment target of the OSI-027.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of OSI-027 in inhibiting the proliferation of cells carrying β-catenin activation mutations. Background Art

[0002] Metabolic disorders are associated with a variety of diseases, including tumors. Tumors are a type of metabolic disease. Metabolic reprogramming promotes abnormal cell proliferation and the development of tumors. Tumors are characterized by their hidden occurrence, high malignancy, and rapid development.

[0003] CTNNB1 encodes β-catenin, one of the most commonly mutated oncogenes in tumors. Exon 3 of CTNNB1 is the most common mutation region of β-catenin, and these mutations cause β-catenin to be continuously activated without degradation (CTNNB1 activating mutation). Since the second-generation sequencing analysis is difficult to identify medium-sized DNA fragment deletions (≥50bp) in the exon 3 region of CTNNB1, the actual frequency of CTNNB1 mutations in liver cancer is often underestimated. CTNNB1 activating mutations play an important role in the occurrence of tumors, but since β-catenin regulates multiple cell functions, direct intervention with β-catenin may have large side effects, and there is no safe and effective drug targeting β-catenin to treat tumors in clinical practice. Summary of the invention

[0004] In order to solve the above problems, the present invention provides the use of OSI-027 in inhibiting the proliferation of cells carrying β-catenin activating mutations. The present invention finds that OSI-027 can inhibit the proliferation of cells carrying β-catenin activating mutations (including embryonic fibroblasts and / or liver cancer cells carrying β-catenin activating mutations) and has no toxic side effects at a suitable dose.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] The present invention provides the use of OSI-027 in preparing a cell proliferation inhibitor, wherein the cell is a cell carrying a beta-catenin activation mutation.

[0007] Preferably, the β-catenin activating mutation is an activating mutation in exon 3 of the CTNNB1 gene.

[0008] Preferably, the cells include: embryonic fibroblasts and / or hepatoma cells carrying a β-catenin activation mutation.

[0009] Preferably, the liver cancer cells include one or more of HEPA1-6, HUH7, SNU886, HepG2, and HCCLM3.

[0010] The present invention provides a cell proliferation inhibitor for cells carrying an activated β-catenin mutation, and the active ingredient of the cell proliferation inhibitor includes OSI-027.

[0011] Preferably, the unit concentration dose of OSI-027 in the cell proliferation inhibitor is 2-6 μM; or calculated based on the body weight of a mouse, the unit dose of OSI-027 in the cell proliferation inhibitor is 15 mg / kg body weight.

[0012] Preferably, the unit concentration dose of OSI-027 in the cell proliferation inhibitor is 2.5-5 μM.

[0013] Preferably, the cell proliferation inhibitor further includes a pharmaceutically acceptable excipient.

[0014] Preferably, the dosage form of the cell proliferation inhibitor includes a solution or an injection.

[0015] Beneficial effects:

[0016] The present invention provides the use of OSI-027 in the preparation of a cell proliferation inhibitor for cells carrying an activated β-catenin mutation. The present invention discovers that OSI-027 can inhibit the proliferation of cells carrying an activated β-catenin mutation and has no toxic or side effects at appropriate doses. The results of the examples show that OSI-027 can inhibit the proliferation of embryonic fibroblasts carrying an activated β-catenin mutation and liver cancer cells such as HEPA1-6, HUH7, SNU886, HepG2, and HCCLM3. After knocking down β-catenin, the ability of OSI-027 to inhibit the proliferation of HepG2 and HCCLM3 cells significantly decreases. It can be seen that the activated β-catenin mutation is a therapeutic target for OSI-027, and OSI-027 can be used to prepare a cell proliferation inhibitor for cells carrying an activated β-catenin mutation. Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0018] Figure 1Results of the construction of β-catenin-activated mutant mouse embryonic fibroblast cell lines; among them, A shows the results of the genotype identification of mouse embryonic fibroblasts, B shows the Western Blot detection results of mouse embryonic fibroblasts, and C shows the CCK8 detection results of WT and B+MEFs;

[0019] Figure 2 Results of detecting the inhibition of the proliferation of β-catenin-activated mouse embryonic fibroblasts (MEF) by OSI-027 in vitro using the CCK-8 method;

[0020] Figure 3 Experimental results of the in vivo therapeutic effect of OSI-027; among them, A shows the gross images of the subcutaneous xenograft tumors generated in mice after 16 days of intraperitoneal injection of the same volume of normal saline (control) or OSI-027 into nude mice, B shows the change curve of the liver weight to body weight ratio of nude mice, and C shows the tumor volume growth curve;

[0021] Figure 4 Experimental results of the in vivo therapeutic effect of OSI-027 on liver cancer; among them, A shows the representative tumor images after 10 days of treatment, B shows the body weight change curve, C shows the ratio of liver weight to body weight, D shows the number of tumors, and E shows the maximum tumor diameter;

[0022] Figure 5 Experimental results of the selective inhibition of the proliferation of β-catenin-mutated liver cancer cells by OSI-027; among them, A shows the mutation sites of the S33 / S37 / T47 / S45-activated mutant β-catenin plasmid and the mutation sites of β-catenin in different liver cancer cell lines, and "-" indicates no β-catenin mutation; B shows the transfection efficiency of the β-catenin overexpression plasmid in SNU886 detected by Westernblot experiment; C shows the proliferation inhibition rate of the drug on SNU886 cells; D shows the transfection efficiency of the β-catenin overexpression plasmid in HUH7 detected by Westernblot experiment; E shows the proliferation inhibition rate of the drug on HUH7 cells; F shows the knockdown efficiency of β-catenin siRNA in HepG2 detected by Westernblot experiment; G shows the proliferation inhibition rate of the drug on HepG2 cells; H shows the knockdown efficiency of β-catenin siRNA in HCCLM3 detected by Western blot experiment; I shows the proliferation inhibition rate of the drug on HCCLM3 cells;

[0023] ** represents P<0.01, and *** represents P<0.001. Detailed implementation methods

[0024] The present invention provides the use of OSI-027 in the preparation of a cell proliferation inhibitor, and the cells are cells carrying an activated mutation of β-catenin. OSI-027 in the present invention is an inhibitor of mTORC1 and mTORC2. There is no special requirement for the source of OSI-027 in the present invention, and commercially available products well-known to those skilled in the art can be used.

[0025] As an embodiment, the activated mutation of β-catenin is an activated mutation in exon 3 of the CTNNB1 gene. The activated mutation of β-catenin in the present invention is a gene mutation that causes β-catenin to be continuously activated by escaping degradation.

[0026] As an embodiment, the cells include: embryonic fibroblasts and / or hepatoma cells carrying an activated mutation of β-catenin. As another embodiment, the hepatoma cells include one or more of HEPA1-6, HUH7, SNU886, HepG2, and HCCLM3.

[0027] The present invention discovers that OSI-027 can inhibit the proliferation of embryonic fibroblasts carrying an activated mutation of β-catenin and hepatoma cells such as HEPA1-6, HUH7, SNU886, HepG2, and HCCLM3, and has no toxic and side effects at appropriate doses; after knocking down β-catenin, the ability of OSI-027 to inhibit the proliferation of HepG2 and HCCLM3 cells significantly decreases. It can be seen that the activated mutation of β-catenin is a therapeutic target for OSI-027, and OSI-027 can be used to prepare a cell proliferation inhibitor for cells carrying an activated mutation of β-catenin.

[0028] Based on the above advantages, the present invention provides a cell proliferation inhibitor, the cells are cells carrying an activated mutation of β-catenin, and the active ingredient of the cell proliferation inhibitor includes OSI-027.

[0029] As an embodiment, the unit concentration dose of OSI-027 in the cell proliferation inhibitor is 2-6 μM; or based on the body weight of the mouse, the unit dose of OSI-027 in the cell proliferation inhibitor is 15 mg / kg body weight. As another embodiment, the unit concentration dose of OSI-027 in the cell proliferation inhibitor is 2.5-5 μM. As another embodiment, the unit concentration dose of OSI-027 in the cell proliferation inhibitor is 3-5 μM. As another embodiment, the unit concentration dose of OSI-027 in the cell proliferation inhibitor is 4-5 μM. The unit concentration dose or unit dose in the cell proliferation inhibitor provided by the present invention is a dose unit that can effectively inhibit the proliferation of cells carrying activated β-catenin mutations and has no toxic side effects on cells or the host.

[0030] As an embodiment, the cell proliferation inhibitor further comprises a pharmaceutically acceptable excipient.

[0031] As an embodiment, the dosage form of the cell proliferation inhibitor includes a solution or an injection. As another embodiment, when the dosage form is a solution or an injection, the excipient can be a pharmaceutically acceptable solvent, such as water, Ringer's solution or isotonic sodium chloride solution.

[0032] To further illustrate the present invention, the application of OSI-027 provided by the present invention in inhibiting the proliferation of cells carrying activated β-catenin mutations will be described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0033] Example 1 In vitro therapeutic effect of OSI-027

[0034] 1. Establishment of a mouse embryonic fibroblast cell line with activated β-catenin mutation

[0035] The mutation of exon 3 of β-catenin protects β-catenin from degradation, leading to the continuous activation of the β-catenin signaling pathway and promoting tumorigenesis. Based on the fact that mouse embryonic fibroblast cell lines (MEFs) are important tools in tumor molecular biology research, the present invention constructed MEFs with activated β-catenin mutations through β-catenin exon 3 loxp mice and immortalized the cells by knocking out TP53. The steps are as follows:

[0036] β-catenin (exon3)flox / + ; TP53 flox / flox (TTβ+) mice and TP53 flox / flox(TT) mice (purchased from the Model Animal Research Center of Nanjing University) were mated, and mouse embryos at day 13.5 were taken for fibroblast extraction; the β-catenin (exon3)flox / + ; TP53 flox / flox (TTβ+) mice were deposited in the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences and were reported in the literature

Oncogenic β-catenin stimulation of AKT2-CAD-mediated pyrimidine synthesis is targetable vulnerability in liver cancer. Proc Natl Acad Sci U S A. 2022 Sep 27;119(39):e2202157119.

[0037] Adenovirus Cre (purchased from VectorBiolabs, catalog number #1700) was added to the medium to knockout TP53 and activate mutant β-catenin. After the cells were passaged more than 10 times, a stable immortalized cell line was obtained. MEFs with wild-type β-catenin were set as control cells. Cell proteins were taken for western blot detection, and the results are shown in Figure 1 B. The results showed that exon 3 of mutant β-catenin was successfully knocked out and showed a downward shift of the band. Abnormal activation of β-catenin is a key pathway regulating cell proliferation. The CCK8 results showed that the proliferation rate of cells carrying mutant β-catenin was significantly higher than that of cells carrying wild-type β-catenin ( Figure 1 C). The above results indicate that the present invention successfully constructed a MEFs cell model with activated mutant β-catenin.

[0038] 2. The β-catenin-activated mutant MEFs cells (β-catenin Δ(ex3) / + ) constructed in step 1 were seeded at 3×10 3The cells were inoculated into 96-well plates at a density of [number of cells / well], and after the cells adhered to the wall, OSI-027 at different concentrations (2.5 μM, 5 μM, and 10 μM) was added. After 48 hours, 10 μl of CCK8 reagent (Shanghai Yisheng) was added to each well. At the same time, wild-type MEFs were set as the control group. After the cells were incubated for 2 hours, the absorbance at 450 nm was measured with an enzyme-linked immunosorbent assay (ELISA) reader, and the inhibition rate of cell proliferation was calculated. The inhibition rate = [(absorbance of the control well - absorbance of the experimental well) / (absorbance of the control well - absorbance of the blank well)] × 100%. The results are shown in Figure 2 。

[0039] The results showed that OSI-027 selectively inhibited the proliferation of MEFs cells with activated β-catenin mutations in a concentration-dependent manner. OSI-027 had no inhibitory effect on wild-type MEFs cells at concentrations below 5 μM.

[0040] Example 2 In vivo therapeutic effect of OSI-027

[0041] 1. Construction of disease model

[0042] To determine whether OSI-027 inhibits tumor development in vivo, a nude mouse subcutaneous xenograft tumor model was established using the MEFs cells with activated β-catenin mutations constructed in Example 1. Each C57BL6 mouse was injected subcutaneously with 1 × 10 6 MEFs cells.

[0043] 2. Treatment strategy

[0044] When the average tumor volume of the mice reached 100 mm 3 , the mice were randomly divided into two groups: intraperitoneal injection of DMSO (control group) or 15 mg / kg body weight of OSI-027 (treatment group) for treatment, once every other day, and the body weight and tumor size of the mice were measured. When the average tumor volume of the control group mice reached 1000 mm 3 , the experiment was terminated, and the body weight and tumor weight of the mice were recorded. The results are shown in Figure 3 。

[0045] The results showed that the treatment with OSI-027 could significantly inhibit the occurrence and development of xenograft tumors. The volume of xenograft tumors in the OSI-027 treatment group was 114.34 ± 96.57 mm 3 , which was significantly smaller than that in the control group (1745.48 ± 1584.74 mm 3 ). And the liver weight / body weight ratio of the treatment group mice showed no significant change compared with the control group, indicating that OSI-027 had no drug toxicity and side effects.

[0046] Example 3 In vivo therapeutic effect of OSI-027 on liver cancer

[0047] 1. Hepatocellular carcinoma model with activated β-catenin mutation

[0048] To determine the effect of OSI-027 on hepatocellular carcinoma with activated β-catenin mutation, the present invention selected the mouse hepatocellular carcinoma cell line HEPA1-6 (with an activating mutation in exon 3 of β-catenin, purchased from Wuhan Punosai Life Science Co., Ltd.) to establish a mouse orthotopic hepatocellular carcinoma. Each wild-type C57BL6 mouse was injected with 2×10 6 HEPA1-6 cells by orthotopic liver injection.

[0049] 2. Treatment strategy

[0050] On the third day after inoculation, the mice were evenly divided into two groups, with 7 mice in each group. The mice were treated by intraperitoneal injection of DMSO (control group) or 15 mg / kg body weight of OSI-027 (treatment group), and the injection was performed every other day. The body weight of the mice was measured. On the 25th day, liver samples were taken, and the body weight, liver weight, and number of tumors of the mice were recorded. The results are shown in Figure 4 .

[0051] Results limitation: Macroscopically, obvious liver tumor nodules were formed in the control group mice, while the treatment with OSI-027 significantly delayed the occurrence and development of tumors ( Figure 4 A in). The liver weight / body weight ratio of the orthotopic liver in the OSI-027 treatment group was 57.78 ± 24.65%, and the liver weight / body weight ratio of the orthotopic liver in the control group was 74.43 ± 29.72% ( Figure 4 C in). The tumor diameter and the number of tumors in the OSI-027 treatment group were significantly reduced ( Figure 4 D and E in). There was no significant change in the body weight of the treatment group mice compared with the control group ( Figure 4 B in), indicating that 15 mg / kg of OSI-027 is a safe dose for mice.

[0052] Example 4 OSI-027 selectively inhibits the proliferation of hepatocellular carcinoma cells with β-catenin mutation

[0053] To further determine whether OSI-027 can selectively inhibit hepatocellular carcinoma cells with β-catenin mutation, the present invention commissioned Beijing Tsingke Biotechnology Co., Ltd. to construct an S33 / S37 / T47 / S45 activated mutant β-catenin plasmid with a FLAG tag (denoted as β-catenin mutant plasmid), and the mutation sites are shown in Figure 5 A in, and an empty vector was provided as a control. The β-catenin mutant plasmid was stably transfected into hepatocellular carcinoma cells (HUH7, SNU886) with wild-type β-catenin to continuously activate the protein ( Figure 5 A in).

[0054] The transfection efficiency was detected by Western Blot. β-catenin was overexpressed in the hepatoma cell line transfected with the β-catenin mutant plasmid (β-catenin mut ), and the expression of its downstream target genes LGR5 and Cyclin D1 was up-regulated, and the FLAG-tagged protein was stably expressed ( Figure 5 B and D in).

[0055] HUH7 or SNU886 transfected with the empty vector and the β-catenin mutant plasmid were treated with OSI-027 at a concentration of 5 μM for 48 hours, and the CCK8 assay was used to detect the proliferation inhibition rate of the drug on the cells. The results are shown in Figure 5 C and E in. The CCK8 results showed that OSI-027 exhibited good anti-tumor proliferation characteristics on the β-catenin mutant hepatoma cell line at a concentration of 5 μM.

[0056] In the present invention, the expression of β-catenin was inhibited by in vitro siRNA (targeting sequences are shown in Table 1) interference in β-catenin-activated mutant hepatoma cells (HepG2, HCCLM3, mutation sites are shown in Figure 5 A in), and the empty vector (siCtrl) was set as a control. Both the siRNA and the empty vector were constructed by Beijing Tsingke Biotechnology Co., Ltd.

[0057] Table 1 Sequence information of siRNA

[0058] Gene Name Targeting Sequence (5'→3') SEQ ID NO. siCTNNB1-1 TTGTTATCAGAGGACTAAAT 1 siCTNNB1-2 GCTTGGAATGAGACTGCTGAT 2

[0059] The knockdown efficiency of two pairs of CTNNB1 siRNAs was detected by Western Blot. The results are shown in Figure 5 F and H in. The results showed that the β-catenin protein level in HepG2 and HCCLM3 cells decreased significantly, and the expression of its downstream target genes LGR5 and Cyclin D1 was down-regulated.

[0060] HepG2 and HCCLM3 transfected with the empty vector and β-catenin siRNA were treated with OSI-027 at a concentration of 30 μM for 48 hours, and the CCK8 assay was used to detect the proliferation inhibition rate of the drug on the cells. The results are shown in Figure 5 G and I in. The CCK-8 assay results showed that after knocking down β-catenin, the proliferation inhibitory ability of OSI-027 on HepG2 and HCCLM3 cells decreased significantly.

[0061] In summary, OSI-027 can inhibit the proliferation of cells carrying β-catenin activation mutations and has no toxic side effects at appropriate doses.

[0062] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Use of OSI-027 in the preparation of a cell proliferation inhibitor, wherein the cell is a cell carrying a β-catenin activation mutation.

2. The use according to claim 1, characterized in that: The β-catenin activating mutation is an activating mutation in exon 3 of the CTNNB1 gene.

3. The use according to claim 1 or 2, characterized in that: The cells include: embryonic fibroblasts and / or liver cancer cells carrying β-catenin activation mutations.

4. The use according to claim 1 or 2, characterized in that: The liver cancer cells include: one or more of HEPA1-6, HUH7, SNU886, HepG2 and HCCLM3.

5. A cell proliferation inhibitor, characterized in that The cells are cells carrying β-catenin activation mutations, and the effective ingredients of the cell proliferation inhibitor include OSI-027.

6. The cell proliferation inhibitor according to claim 5, characterized in that The unit concentration dose of OSI-027 in the cell proliferation inhibitor is 2-6 μM; or based on the body weight of mice, the unit dose of OSI-027 in the cell proliferation inhibitor is 15 mg / kg body weight.

7. The cell proliferation inhibitor according to claim 6, characterized in that The unit concentration dose of OSI-027 in the cell proliferation inhibitor is 2.5-5 μM.

8. The cell proliferation inhibitor according to any one of claims 5 to 7, characterized in that The cell proliferation inhibitor further comprises a pharmaceutically acceptable excipient.

9. The cell proliferation inhibitor according to any one of claims 5 to 7, characterized in that The dosage form of the cell proliferation inhibitor includes a solution or an injection.

Images