Construction of MSC biomimetic co-delivery system and its application in synergistic glioma therapy

Abstract

The present application relates to the field of nanomedicine, in particular to a kind of multi-targeting property, co-loading drug's biomimetic nanosystem, and its application in glioma synergistic treatment.The present application constructs a kind of central target, co-loading drug's nanomedicine delivery system Ang2-Pmsc-NPs, with good cross-BBB transport characteristics and tumor tissue penetration characteristics.Carrying siRNA treatment gene and PROTAC molecule, kill GSCs, inhibit the NAD + energy metabolic pathway of tumor, realize multi-target point anti brain glioma effect, provide new ideas and experimental basis for the nanomedicine treatment of brain glioma.

Description

Technical Field

[0001] This invention relates to the field of nanomedicine technology, specifically to a method for preparing Ang-Pmsc-NPs, a biomimetic nanomedicine system for the central nervous system, which has multiple targeted drug delivery characteristics and co-loads siRNA and PROTAC molecules, and its application in the targeted therapy of gliomas. Background Technology

[0002] Glioblastoma multiforme (GBM) is one of the most malignant brain tumors, characterized by highly invasive growth and a 5-year survival rate of less than 5%. Glioma stem cells (GSCs) are a highly tumorigenic cell group within gliomas, playing a crucial role in inducing glioma development and invasion, leading to drug resistance, and tumor metastasis and recurrence. STAT3 (signal transducer and activator of transcription 3) is involved in multiple signaling pathways related to tumor progression and immune escape. STAT3 is persistently activated in 66-83% of GBMs, and this persistent activation promotes GSC proliferation and maintains their stemness. Therefore, downregulating STAT3 protein expression in GSCs using RNA interference technology can silence target genes related to GSC stemness maintenance and proliferation, killing GSCs and inhibiting glioma proliferation, invasion, and migration.

[0003] Researchers have revealed that cancer gene amplification and epigenetic remodeling depend on nicotinamide adenine dinucleotide (NAD). + ) pathways to intervene in NAD + Metabolism is an important target for precision cancer treatment. Tumor cells' response to NAD+... + Nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in biosynthesis, is highly sensitive and can increase NAD through upregulation of biosynthesis. +Level. The expression level of NAMPT gene in tumor cells of GBM patients is abnormally elevated. NAMPT exists in the cell as iNAMPT, exerting enzymatic activity and affecting the metabolic epigenetic modification and genomic stability of tumor cells. Proteolytic targeting chimera (PROTAC) technology is a new drug molecule technology that chemically induces the polyubiquitination of target proteins and ultimately degrades the target proteins through the proteasome pathway. The research group has synthesized a PROTAC molecule NPT-B2 with NAMPT degradation activity. See the literature BI K, et al. discovery of highly potent nicotinamide phosphoribosyltransferase degraders for efficient treatment of ovarian cancer. Journal of Medicinal Chemistry, 2023,66 (1):1048-1062. In this literature, it is code-named PROTAC B3 (i.e. NPT-B2 in this invention), and its structural formula is shown in Formula I. However, it has poor water solubility and a large molecular weight, making it difficult to cross the blood-brain barrier (BBB) ​​and enter the brain.

[0004]

[0005] Formula I

[0006] The chemical name of NPT-B2 is:

[0007] (2S,4R)-1-((S)-3,3-Dimethyl-2-(9-(4-((4-(3-(pyridin-3-ylmethyl)-ureido)phenyl)sulfonyl)piperazin-1-yl)n onanamido)butanoyl)-4-hydroxy-N-((S)-1-(4-(4-methyl-thiazol-5-yl)phenyl)ethyl)-pyrrolidine-2-carboxamide

[0008] (2S,4R)-1-((S)-3,3-dimethyl-2-(9-(4-((4-(3-(pyridin-3-ylmethyl)-ureido)phenyl)sulfonyl)piperazin-1-yl)nonanamide)butyryl)-4-hydroxy-N-((S)-1-(4-(4-methyl-thiazolyl-5-yl)phenyl)ethyl)pyrrolidine-2-carboxamide

[0009] The synthesis method of NPT-B2 is as follows:

[0010]

[0011] Biomimetic nanomedicine systems utilizing cells and cell membranes to construct carriers for enhanced drug delivery have been studied. Based on cell membrane biomimetic nanocarriers, cell membrane protein modification technology has been developed. Source cell membrane proteins are extracted and modified into lipid bilayers, inheriting the targeting properties of surface functional proteins from the source cells while reducing the difficulty of cell membrane encapsulation. Further modification with functionalized lipids can achieve even more efficient targeting performance. Mesenchymal stem cells (MSCs) are a type of adult stem cell originating from the mesoderm. Studies have shown that MSC membrane proteins mediate inflammatory homing mechanisms and deep penetration into tumor tissues, and can reduce the clearance of mononuclear macrophages. Extracting MSC surface proteins and modifying them onto biomimetic nanocarriers can prolong the circulation time of drug delivery systems, enhance their penetration into tumor tissues, and achieve targeted drug delivery to gliomas. Simultaneously, low-density lipoprotein receptor-associated protein (LRP-1) is highly expressed in both BBB and glioma cells. Angiopep-2 is a Kunitz-type enzyme inhibitory peptide with high affinity for LRP-1. Multiple studies have shown that Angiopep-2 can serve as a functionalized ligand to improve the BBB transport efficiency of nanocarriers and their guidance to tumor tissues after entering the brain.

[0012] However, there are currently no reports on the preparation method of Ang-Pmsc-NPs, a biomimetic nanomedicine system with centrally targeted drug delivery characteristics and co-loaded siRNA and PROTAC molecules, and its application in the synergistic treatment of glioma. Summary of the Invention

[0013] The purpose of this invention is to provide a biomimetic nanosystem (Ang2-Pmsc-NPs) with multiple targeting characteristics for central nervous system tumors and co-loaded with drugs for the treatment of gliomas. It uses an albumin-loaded protein degradation targeting chimera (PROTAC) molecule as its core, with cationic lipids loading siRNA and then complexing it with the albumin core. The nanosystem is further surface-modified with angiopep-2 peptide and mesenchymal stem cell (MSC) membrane proteins, targeting glioma stem cells (GSCs) and tumor NADs. + Energy metabolism is inhibited.

[0014] In a first aspect, the present invention provides a method for preparing an MSC biomimetic nanoparticle co-loaded drug system, comprising the following steps:

[0015] (A) Preparation of albumin nanoparticles (B2-NPs) loaded with NPT-B2 by thermally driven method:

[0016] rBSA was prepared by adding 2% SDS (m / v) and DTT (BSA:DTT = 30:1~20:1, w:w, preferably 27:1) to a deionized BSA aqueous solution and reacting with magnetic stirring at 90℃ for 2 h; rBSA and NPT-B2 were co-incubated in MES (pH 4.8) solution at 37℃ in a certain ratio (10:1~15:1, w:w, preferably 10:1) for 2 h to obtain B2-NPs;

[0017] (B) Extraction of mesenchymal stem cell membrane proteins (Pmsc):

[0018] Primary bone marrow mesenchymal stem cells (MSCs) were isolated and cultured using the semi-adherent method, passaged to the third generation, identified, and membrane proteins (Pmsc) were extracted using a membrane protein extraction kit.

[0019] (C) Preparation of Ang2-Pmsc-NPs by thin film dispersion-extrusion method:

[0020] Dlin-MC3-DMA, DMG-PEG, DSPC, Chol (60:5:15:20, M:M) and 1% (w / w) DSPE-PEG-Angiopep-2 were weighed and dissolved in a methanol:chloroform mixed solvent (1:1, v / v). The solvent was removed by vacuum evaporation at 45°C. 1%~5% (w / w, preferably 1%) Pmsc in MES buffer (pH 4.8) was added for 1 h of hydration. The mixture was intermittently sonicated in an ice bath for 10 min (power 150 W) to obtain LNPs. The LNPs were then repeatedly extruded through a 100 nm membrane with 1%~5% (w / w, preferably 1.5%) siRNA and 3%~10% (calculated as NPT-B2, w / w, preferably 5%) B2-NPs. The product was dialyzed in PBS (0.01M, pH 7.4) to obtain the MSC biomimetic nanoparticle co-loaded drug system Ang2-Pmsc-NPs.

[0021] Furthermore, the siRNA described in this article is a siRNA that downregulates STAT3 protein expression, synthesized according to the nucleotide sequence 5'AGCCCAUGUGAUCUGACACCCUG3' (SEQ ID No. 1).

[0022] In a second aspect, the present invention provides an MSC biomimetic nano-co-delivery drug system, which uses albumin-loaded PROTAC molecule NPT-B2 as the core, cationic lipids loaded with siRNA and then compounded with the albumin core, and the surface of the nanosystem is modified with Angiopep-2 peptide and mesenchymal stem cell (MSC) membrane proteins.

[0023] Furthermore, the MSC biomimetic nanoparticle co-loaded drug system is constructed using any of the preparation methods described above.

[0024] A third aspect of the present invention provides the application of the MSC biomimetic nano-co-delivery drug system described above in a medicament for treating glioma.

[0025] The advantages of this invention are:

[0026] This invention constructs an Ang2-Pmsc-NPs nanomedicine delivery system targeting the central nervous system and co-loaded with drugs, exhibiting excellent cross-BBB transport properties and tumor tissue penetration characteristics. It simultaneously carries siRNA therapeutic genes and PROTAC molecules, killing GSCs and inhibiting tumor NAD. + By interfering with energy metabolism pathways, multi-target anti-glioma effects can be achieved, providing new ideas and experimental basis for nanomedicine therapy of glioma. Attached Figure Description

[0027] Figure 1 Characterization of Ang2-Pmsc-NPs;

[0028] A: Particle size distribution of Ang2-Pmsc-NPs; B: Zeta potential distribution of Ang2-Pmsc-NPs; C: Transmission electron micrograph of Ang2-Pmsc-NPs; D: Gel electrophoresis image of Ang2-Pmsc-NPs (a: siRNA released from Ang2-Pmsc-NPs after demulsification; b: Ang2-Pmsc-NPs; c: siRNA).

[0029] Figure 2 The uptake of DiI nanoparticles by glioma cells and GSCs in each group was investigated.

[0030] A: GL261 uptake of DiI-Ang2-Pmsc-NPs; B: GSCs uptake of DiI-Ang2-Pmsc-NPs (n=3).

[0031] Figure 3 HE staining of a mouse brain tissue section with glioma.

[0032] Figure 4 In vivo brain-targeting properties of DiR nanoparticles in each group (n=3).

[0033] Figure 5 Ang2-Pmsc-NPs inhibit NAMPT and p-STAT3 in tumor cells and GSCs;

[0034] A: NAMPT; B: p-STAT3 (n=3).

[0035] Figure 6 Inhibition of GSC re-spheroidization by Ang2-Pmsc-NPs (n=10, ****P<0.0001).

[0036] Figure 7 Survival curves and weight changes of tumor-bearing mice (n=8). Detailed Implementation

[0037] The specific implementation methods provided by the present invention will be described in detail below with reference to the embodiments.

[0038] Example 1: Preparation and characterization of Ang2-Pmsc-NPs

[0039] NPT-B2-loaded albumin nanoparticles (B2-NPs) were prepared by a thermally driven method: 2% SDS (m / v) and DTT (BSA:DTT = 27:1, w:w) were added to a deionized BSA aqueous solution, and the mixture was stirred at 90°C for 2 h to prepare rBSA. The rBSA and NPT-B2 were then co-incubated in MES (pH 4.8) solution at 37°C for 2 h to obtain B2-NPs. Primary bone marrow mesenchymal stem cells (MSCs) were isolated and cultured using a semi-adherent method, passaged to the third generation, identified, and membrane proteins (Pmsc) were extracted using a membrane protein extraction kit.

[0040] Ang2-Pmsc-NPs were prepared by thin-film dispersion-extrusion method: A certain amount of Dlin-MC3-DMA, DMG-PEG, DSPC, Chol (60:5:15:20, M:M) and 1% (w / w) DSPE-PEG-Angiopep-2 were weighed and dissolved in a methanol:chloroform mixed solvent (1:1, v / v). The solvent was removed by vacuum evaporation at 45℃, and 1% (w / w) Pmsc in MES buffer (pH 4.8) was added for hydration for 1 h. The mixture was intermittently sonicated in an ice bath for 10 min (power 150 W) to obtain LNPs. The LNPs were then repeatedly extruded through a 100 nm membrane with 1.5% siRNA and 5% (calculated as NPT-B2, w / w) B2-NPs. The product was dialyzed in PBS (0.01 M, pH 7.4) to obtain Ang2-Pmsc-NPs. Figure 1 As shown, the particle size and zeta potential of Ang2-Pmsc-NPs are 72.83 nm and 0.64 mV, respectively. Transmission electron microscopy images show that the particle size of Ang2-Pmsc-NPs is approximately 70 nm, exhibiting a core-shell structure. The encapsulation efficiency of NPT-B2 in Ang2-Pmsc-NPs is 85.12%, the drug loading is 6.34%, and the siRNA encapsulation efficiency is 93.22%.

[0041] Example 2: Investigation of the in vitro BBB-permeability of Ang2-Pmsc-NPs

[0042] Nanoparticles (DiI-Ang2-Pmsc-NPs) carrying the fluorescent probe DiI were prepared by thin-film dispersion-extrusion method: Dlin-MC3-DMA, DMG-PEG, DSPC, cholesterol (60:5:15:20, M:M), 1% (w / w) DSPE-PEG-Angiopep-2, and 1% (w / w) DiI were dissolved in a methanol:chloroform mixed solvent (1:1, v / v). The solvent was removed by vacuum evaporation at 45 °C, and the nanoparticles were hydrated in MES buffer (pH 4.8) containing Pmsc for 1 h. The nanoparticles were obtained by intermittent sonication in an ice bath for 10 min (power 150 W). The nanoparticles were repeatedly extruded through a 100 nm membrane with siRNA and B2-NPs. The products were dialyzed in PBS (0.1 M, pH=7.4) (MW=20 K) to obtain DiI-Ang2-Pmsc-NPs. DiI-loaded nanoparticles with different modifications were prepared according to the same method as DiI-Ang2-Pmsc-NPs, namely DiI-NPs, DiI-Ang2-NPs, and DiI-Pmsc-NPs. An in vitro BBB model was constructed by seeding hBMECs in a Transwell cell culture medium. GL261 cells in logarithmic growth phase and GSCs with a diameter of approximately 100 μm were seeded into the lower chamber of the Transwell. 0.5 mL of each group of DiI nanoparticles was added to the upper layer, and the cells were incubated in a CO2 incubator for 12 h. Cells from the lower chamber of the Transwell were collected, and 80 μL of cell lysis buffer was added for 20 min. The supernatant was collected by centrifugation at 16000g for 10 min at 4℃, vacuum dried, and then vortexed with methanol. The supernatant was collected by centrifugation at 16000g for 10 min, and the fluorescence intensity (E) was detected using a fluorescence spectrophotometer. x / E m The concentration of DiI in each group was calculated using a fluorescence intensity-concentration standard curve (549 / 565 nm).

[0043] Experimental results are as follows Figure 2As shown, all groups of DiI nanoparticles could penetrate the upper endothelial cells and be taken up by the lower GL261 cells and GSCs. In GL261 cells, the uptake of DiI-Pmsc-NPs, DiI-Ang2-NPs, and DiI-Ang2-Pmsc-NPs groups was superior to that of the DiI-NPs group (P<0.05, P<0.001, P<0.01); the DiI-Ang2-NPs group was significantly superior to the DiI-Pmsc-NPs group (P<0.001); and the DiI-Ang2-Pmsc-NPs group was significantly superior to the DiI-Pmsc-NPs group (P<0.001). In GSCs, the uptake of DiI-Ang2-NPs was superior to that of DiI-Pmsc-NPs (P<0.05); and the DiI-Ang2-Pmsc-NPs group was significantly superior to the DiI-Pmsc-NPs group (P<0.001). The DiI-NPs and DiI-Pmsc-NPs groups showed lower uptake, while the DiI-Ang2-NPs and DiI-Ang2-Pmsc-NPs groups showed higher uptake, indicating that the unmodified nanoparticles and Pmsc-modified nanoparticles had weaker BBB-penetration capabilities than the Ang2-modified groups. Among GSCs, the DiI-Ang2-Pmsc-NPs group showed significantly higher uptake than the other groups, indicating that the nanoparticles modified with dual ligands possessed better targeting properties.

[0044] Example 3: In vivo brain-targeting properties of Ang2-Pmsc-NPs

[0045] Nanoparticles (DiR-Ang2-Pmsc-NPs) carrying the fluorescent probe DiR were prepared by thin-film dispersion-extrusion method: Dlin-MC3-DMA, DMG-PEG, DSPC, Chol (60:5:15:20, M:M), 1% (w / w) DSPE-PEG-Angiopep-2, and 1% (w / w) DiR were dissolved in a methanol:chloroform mixture (1:1, v / v). The solvent was removed by vacuum evaporation at 45 °C, and the nanoparticles were hydrated for 1 h in MES buffer (pH 4.8) containing Pmsc. The nanoparticles were then intermittently sonicated in an ice bath for 10 min (150 W) to obtain LNPs. The LNPs were repeatedly extruded through a 100 nm membrane with siRNA and B2-NPs. The products were dialyzed overnight in PBS (0.1 M, pH=7.4) (MW=20 K) to obtain DiR-Ang2-Pmsc-NPs. Different modified DiR-loaded nanoparticles were prepared using the same method as DiR-Ang2-Pmsc-NPs: DiR-NPs, DiR-Ang2-NPs, and DiR-Pmsc-NPs.

[0046] GL261 cells in logarithmic growth phase were digested and resuspended in PBS. BALB / c mice were anesthetized intraperitoneally with 150 μL of 1% sodium pentobarbital, fixed in a stereotaxic apparatus, and the right caudate nucleus was located. The cell suspension (3 x 10) was then injected. 6 A mouse glioma orthotopic model was established by sealing the needle insertion site with bone wax, treating the wound with double antibiotics, and perfusing the mice. After model establishment, brain tissue was harvested and paraffin sections (4 μm thick) were prepared. After dewaxing, the paraffin sections were stained with hematoxylin and eosin (HE): sections were stained in Harris hematoxylin for 3-8 min, washed with tap water, differentiated with 1% hydrochloric acid alcohol for a few seconds, washed with tap water, blued with 0.6% ammonia solution, washed again, stained with eosin for 1-3 min, dehydrated with 95% ethanol-anhydrous ethanol-xylene, and mounted with neutral resin. Tumor tissue formation was identified under an inverted phase-contrast microscope. The identification results are as follows: Figure 3 As shown, glioma cells exhibited space-occupying growth in the right caudate nucleus, right hippocampus, and right brain region of the mouse. The tumor cell nuclei were more deeply stained than those of normal brain tissue cells, with clearly defined nucleoli, and the cells were densely packed. The boundaries between the tumor cells and normal brain tissue cells were indistinct, indicating invasive growth. This demonstrates the successful establishment of an orthotopic glioma model, suitable for subsequent experiments.

[0047] Seven days after the establishment of the orthotopic tumor-bearing mouse model, mice were randomly divided into five groups: a control group, DiR-NPs, DiR-Ang2-NPs, DiR-Pmsc-NPs, and DiR-Ang2-Pmsc-NPs groups. The experimental groups received a tail vein injection of nanoparticles containing 20 μg of DiR, while the control group received an equal volume of PBS via tail vein injection. Intra-tissue fluorescence distribution was observed at 2, 4, 8, 12, and 24 hours using a small animal in vivo imaging system. Results are as follows: Figure 4 As shown, each group exhibited some fluorescence in the brain at 2 hours, reaching its maximum intensity at 4 hours, and slightly decreasing by 24 hours. The DiR-NPs group showed no significant brain-targeting effect, while the DiR-Ang2-NPs, DiR-Pmsc-NPs, and DiR-Ang2-Pmsc-NPs groups showed more significant brain-targeting effects compared to the DiR-NPs group. The particle distribution in the brain was similar between the DiR-Ang2-NPs and DiR-Pmsc-NPs groups, but the fluorescence of the DiR-Pmsc-NPs group increased over time compared to the DiR-Ang2-NPs group. The DiR-Ang2-Pmsc-NPs group exhibited the strongest intracranial fluorescence, concentrated in the right brain, demonstrating its ability to penetrate the blood-brain barrier and target tumor tissue.

[0048] Example 4: The degradation of NAMPT and silencing of p-STAT3 in glioma cells and GSCs by Ang2-Pmsc-NPs

[0049] GL261 cells in the logarithmic growth phase were harvested and treated with 1.4 × 10⁻⁶ cells.4 Cells were seeded in wells and cultured for 12 hours to allow cell adhesion. Ang2-Pmsc-NPs with different NPT-B2 concentrations were prepared and added to GL261 cells, then incubated in a CO2 incubator for 72 hours. Third-generation and later GSCs were digested into single-cell suspensions and cultured at 1.4 × 10⁶ cells per well. 4 Cells / wells were plated and cultured for 12 hours, then co-incubated with Ang2-Pmsc-NPs corresponding to different concentrations of siRNA for 72 hours.

[0050] Western blotting was used to investigate the degradation of NAMPT and the silencing of p-STAT3. Figure 5 A shows that in GL261 cells, the degradation efficiencies of NAMPT were 83.31% and 88.08% when NPT-B2 was administered at concentrations of 4 and 8 μM, respectively. In GSCs, the degradation efficiencies of NAMPT were 32.73% and 82.97% when NPT-B2 was administered at concentrations of 4 and 8 μM, respectively. Figure 5 As shown in Figure B, in GL261 cells, the silencing rates of p-STAT3 were 69.26% and 86.40% when siRNA was administered at concentrations of 2 and 4 μg / mL, respectively. In GSCs, the silencing efficiencies of p-STAT3 were 49.51% and 65.24% when STAT3-siRNA was administered at concentrations of 2 and 4 μg / mL, respectively. These results indicate that Ang2-Pmsc-NPs inhibit both NAMPT and p-STAT3 in glioma cells and GSCs in a concentration-dependent manner.

[0051] Example 5: Inhibition of GSCs Steminess by Ang2-Pmsc-NPs

[0052] GSCs with a cell spheroid diameter of approximately 100 μm were digested into a single-cell suspension to prepare experimental groups of nanoparticles with different modifications: NPs, Ang2-NPs, Pmsc-NPs, and Ang2-Pmsc-NPs. These were suspended in SFM medium as experimental groups (siRNA concentration 2 μg / mL). Cells were added to each experimental group solution at a concentration of 2500 cells / mL and mixed thoroughly. Then, 1 mL of cells were seeded into each well and cultured in a constant-temperature CO2 cell culture incubator for 7-10 days. Cell spheroidization was observed, and the number of cell spheroids with a diameter ≥70 μm in each well was recorded. The cell spheroidization efficiency (SFE) was calculated. The results are as follows: Figure 6As shown, after co-incubation with NPs, Ang2-NPs, Pmsc-NPs, and Ang2-Pmsc-NPs, the SFE of GSCs were 1.00±0.19%, 0.03±0.02%, 0.01±0.02%, 0.00±0.00%, and 0.00±0.00%, respectively. The inhibitory ability of each experimental group to re-spheroidize GSCs was significantly inhibited compared to the control group (P<0.0001). The cell spheres formed in the control group were intact, plump, and approximately 50-100 μm in diameter. The NPs group contained a small number of cell spheres, mostly <70 μm in diameter, and the cell spheres were loosely shaped. The Ang2-NPs, Pmsc-NPs, and Ang2-Pmsc-NPs groups showed no cell spheres, a significantly reduced cell number, and a large amount of cell debris. This indicates that Ang2-Pmsc-NPs significantly inhibited the re-spheroidization of GSCs, and the stemness of GSCs was significantly suppressed.

[0053] Example 6: In vivo pharmacodynamic study of Ang2-Pmsc-NPs against glioma

[0054] GL261 cells in logarithmic growth phase were digested and resuspended in PBS. BALB / c mice were anesthetized intraperitoneally with 150 μL of 1% sodium pentobarbital, fixed in a stereotaxic apparatus, and the right caudate nucleus was located. Cell suspension (3 × 10⁻⁶ cells / mL) was injected. 6 The needle insertion site was sealed with bone wax (5 μL), and the wound was treated with double antibiotics to establish an orthotopic mouse glioma model. After surgery, mice were randomly divided into five groups: control group (saline), NPs group, Ang2-NPs group, Pmsc-NPs group, and Ang2-Pmsc-NPs group, with 8 mice in each group. When the mice showed a continuous decrease in body weight, they were administered STAT3 siRNA (1.5 mg / kg, NPT-B2: 5 mg / kg) via tail vein, once every two days, for a total of 5 administrations. The body weight and median survival of the tumor-bearing mice were observed daily.

[0055] Depend on Figure 7The weight curves showed that the body weight of tumor-bearing mice in the control group increased slowly and then decreased, with all control tumor-bearing mice dying by day 15. In the Ang2-NPs and Pmsc-NPs groups, body weight gradually increased after administration, stabilized for about two weeks after administration was stopped, and then gradually decreased until death. The body weight of the Ang2-Pmsc-NPs group remained stable for a longer period than that of the single-ligand modified group, with body weight beginning to gradually decrease around day 42. The median survival time of the NPs group was significantly longer than that of the control group (P<0.01). The median survival time of the Ang2-NPs, Pmsc-NPs, and Ang2-Pmsc-NPs groups was significantly longer than that of the control group. The median survival time of the Ang2-Pmsc-NPs group was significantly longer than that of the NPs group (P<0.001), and longer than that of the Pmsc-NPs and Ang2-NPs groups (P<0.01, P<0.05). The median survival in the Ang2-Pmsc-NPs group was 4 times that of the control group (P<0.001), indicating that Ang2-Pmsc-NPs have superior tumor-targeted drug delivery characteristics and anti-glioma efficacy.

[0056] The preferred embodiments of the present invention have been described in detail above, but the present invention is not limited to the embodiments described. Those skilled in the art can make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application.

Claims

1. A method for preparing an MSC biomimetic nanoparticle co-loaded drug system, characterized in that, Includes the following steps: (A) Preparation of albumin nanoparticles B2-NPs loaded with NPT-B2 by thermally driven method: rBSA was prepared by adding 2% sodium dodecyl sulfate (SDS) (m / v) and DTT to a deionized water solution of BSA, with a BSA:DTT ratio of 30:1 to 20:1 (w:w), and reacting with magnetic stirring at 90°C for 2 h. rBSA was then co-incubated with NPT-B2 at 37°C at a ratio of 10:1 to 15:1 (w:w) for 2 h to obtain B2-NPs. (B) Extraction of mesenchymal stem cell membrane protein Pmsc: Primary bone marrow mesenchymal stem cells were isolated and cultured using the semi-adherent method, passaged to the third generation for identification, and membrane protein Pmsc was extracted using a membrane protein extraction kit. (C) Preparation of Ang2-Pmsc-NPs by thin film dispersion-extrusion method: Dlin-MC3-DMA, DMG-PEG, DSPC, Chol, and 1% (w / w) DSPE-PEG-Angiopep-2 in a molar ratio of 60:5:15:20 were dissolved in a methanol:chloroform mixed solvent with a volume ratio of 1:

1. The solvent was removed by evaporation under reduced pressure at 45°C. The solution was then hydrated for 1 hour with 1%–5% (w / w) Pmsc in pH 4.8 MES buffer. The solution was then intermittently sonicated in an ice bath at 150W for 10 minutes to obtain LNPs. The LNPs were then repeatedly extruded through a 100nm membrane with 1%–5% (w / w) siRNA and 3%–10% (w / w) B2-NPs. The product was dialyzed in 0.01M, pH 7.4 PBS to obtain the MSC biomimetic nanoparticle co-loaded drug system Ang2-Pmsc-NPs. The structural formula of the NPT-B2 is shown in Formula I:

2. The preparation method of the MSC biomimetic nano-co-loaded drug system according to claim 1, characterized in that, The siRNA is a siRNA that downregulates the expression of STAT3 protein, and its nucleotide sequence is shown in SEQ ID No.

1.

3. An MSC biomimetic nanoparticle co-delivery drug system, characterized in that, The system uses albumin-loaded PROTAC molecule NPT-B2 as the core, cationic lipids loaded with siRNA and then complexed with the albumin core, and the surface of the nanosystem is modified with Angiopep-2 peptide and mesenchymal stem cell membrane protein; the MSC biomimetic nano-co-delivery drug system is constructed using the preparation method described in claim 1 or 2.

4. The use of the MSC biomimetic nano-co-delivery drug system as described in claim 3 in the preparation of a drug for treating glioma.

Images