Preparation and application of bovine M.haemolya and P.multocida fusion protein subunit vaccine

Abstract

The invention belongs to the technical field of vaccine preparation, and particularly relates to preparation and application of a bovine M.haemolya and P.multocida fusion protein subunit vaccine, and the bovine M.haemolya and P.multocida fusion protein subunit vaccine comprises the following components: a recombinant fusion protein rChaN-DsbA and an adjuvant, the recombinant fusion protein rChaN-DsbA is a recombinant fusion protein, and the adjuvant is a recombinant fusion protein. The preparation method of the bovine M.haemolya and P.multocida fusion protein subunit vaccine comprises the following steps: connecting a mannheimia haemolytica ChaN protein and a pasteurella multocida DsbA protein through a homologous recombination technology, carrying out induced expression in escherichia coli, and carrying out purification so as to obtain a recombinant fusion protein rChaN-DsbA, and carrying out subunit vaccine preparation on the recombinant fusion protein rChaN-DsbA and the recombinant fusion protein rChaN-DsbA so as to obtain the bovine M.haemolya and P.multocida fusion protein subunit vaccine. The recombinant fusion protein rChaN-DsbA and a white oil adjuvant are emulsified to prepare a vaccine preparation. The bovine M.haemolya and P.multocida fusion protein subunit vaccine is prepared by carrying out recombinant fusion expression on bovine-derived mannheimia haemolytica ChaN protein and pasteurella multocida DsbA, and the bovine M.haemolya and P.multocida fusion protein subunit vaccine can be used for preventing respiratory diseases caused by two bacteria at the same time.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccine preparation, and particularly relates to the preparation and application of a bovine Mannheimia haemolytica and Pasteurella multocida fusion protein subunit vaccine. Background Art

[0002] Bovine respiratory disease (BRD) is widespread worldwide. Research shows that the cases of cattle deaths caused by BRD account for 46% - 67% of the total death cases. This disease seriously endangers the health of the cattle herd and causes certain economic losses to the cattle breeding industry. BRD is mostly caused by the interaction between environmental factors and pathogens, resulting in severe respiratory symptoms in cattle. Pathogenic microorganism infections are the main pathogenic factors, including bacterial infections and viral infections. In recent years, with the expansion of the breeding scale, the increase in breeding density, and the unsatisfactory breeding environment in China, the incidence of BRD has been increasing. Mannheimia haemolytica (Mh) and Pasteurella multocida (Pm), as common pathogenic bacteria causing BRD, invade the lungs of cattle and cause infections when the cattle are in poor health, under stress, or infected with viruses.

[0003] Currently, under large-scale breeding conditions, in addition to improving feeding management conditions, the prevention of BRD mainly relies on immunization. Currently, most of the commercially available vaccines are whole-bacteria inactivated vaccines or attenuated live vaccines against a single serotype of Mh or Pm. Due to the incomplete inactivation, poor stability, and easy spreading of live viruses in whole-bacteria inactivated vaccines, multi-component vaccines with high safety and against multiple pathogens have become a research hotspot. Summary of the Invention

[0004] The purpose of the present invention is to provide the preparation and application of a bovine Mannheimia haemolytica and Pasteurella multocida fusion protein subunit vaccine. By recombinantly fusing and expressing the bovine-derived Mannheimia haemolytica ChaN protein and Pasteurella multocida DsbA, a vaccine for preventing respiratory infections caused by Mannheimia haemolytica and Pasteurella multocida in cattle is prepared, which can be used to prevent respiratory diseases caused by both bacteria simultaneously.

[0005] The technical solution adopted by the present invention is specifically as follows: A bovine Mannheimia haemolytica and Pasteurella multocida fusion protein subunit vaccine, comprising the following components: (a) Recombinant fusion protein rChaN-DsbA; (b) An adjuvant, and the adjuvant is a white oil adjuvant; The preparation method of the bovine M. haemolytica and P. multocida fusion protein subunit vaccine includes the following steps: S1: Connect the ChaN protein of Mannheimia haemolytica (accession number: PQ280750) and the DsbA protein of Pasteurella multocida (accession number: PQ582062) by homologous recombination technology, induce expression in Escherichia coli and purify to obtain the recombinant fusion protein rChaN-DsbA, and verify its expression by SDS-PAGE and Western Blot; S2: Emulsify the recombinant fusion protein rChaN-DsbA with white oil adjuvant to prepare a vaccine preparation.

[0006] In a preferred embodiment, as in S1, obtaining the recombinant fusion protein rChaN-DsbA includes the following steps: S11: Design specific primers to amplify the ChaN gene of Mannheimia haemolytica and the DsbA gene of Pasteurella multocida. The restriction enzyme sites of the ChaN gene are BamHI and Xhol, and the restriction enzyme sites of the DsbA gene are Xhol and Hindlll; S12: Insert the amplified gene fragment into the expression vector pET-32a(+) by seamless cloning technology to construct the recombinant plasmid pET-32a-rCD; S13: Transform the recombinant plasmid into Escherichia coli BL21(DE3), induce expression with IPTG, and purify by nickel column affinity chromatography to obtain the recombinant fusion protein rChaN-DsbA.

[0007] In a preferred embodiment, as in S2, the volume ratio of the recombinant fusion protein rChaN-DsbA to the white oil adjuvant is 1:1.5 - 2.5. Preferably, the volume ratio of the recombinant fusion protein rChaN-DsbA to the white oil adjuvant is 1:2.

[0008] In a preferred embodiment, the coding gene sequence of the recombinant fusion protein rChaN-DsbA is as shown in SEQ ID NO: 1.

[0009] In a preferred embodiment, in S13, the conditions for induced expression are: 37°C, induce for 6 hours, and the recombinant protein is expressed in the form of inclusion bodies. The protein molecular weight of the recombinant fusion protein rChaN-DsbA is 46 kDa.

[0010] In a preferred embodiment, the content of the recombinant fusion protein rChaN-DsbA in each dose of the bovine M. haemolytica and P. multocida fusion protein subunit vaccine is 600 μg.

[0011] In a preferred embodiment, the bivalent subunit vaccine of Mannheimia haemolytica and Pasteurella multocida is administered by subcutaneous injection into the neck, the number of injections is 2, the injection interval is 14 days, and the single immunization dose is 1 mL per animal.

[0012] In a preferred embodiment, the bivalent subunit vaccine of Mannheimia haemolytica and Pasteurella multocida is used for cattle aged 3 - 6 months of different strains or 1 month before transfer, and pregnant cows are prohibited from using it.

[0013] In a preferred embodiment, the storage temperature of the bivalent subunit vaccine of Mannheimia haemolytica and Pasteurella multocida is -20°C.

[0014] In a preferred embodiment, the bivalent subunit vaccine of Mannheimia haemolytica and Pasteurella multocida is milky white and does not disperse or dissolve in water.

[0015] Application of the bovine M.haemolytica and P.multocida fusion protein subunit vaccine in preventing infections of Mannheimia haemolytica and Pasteurella multocida.

[0016] The technical effects achieved by the present invention are as follows: In the present invention, the bovine-derived Mannheimia haemolytica ChaN protein and Pasteurella multocida DsbA are recombinantly fused and expressed to prepare a bovine M.haemolytica and P.multocida fusion protein subunit vaccine, which can be used to prevent and treat respiratory diseases caused by Mannheimia haemolytica or / and Pasteurella multocida simultaneously. It has the advantages of low cost, simple operation, small dosage, simple and safe vaccination method, etc., avoids environmental pollution caused by certain types of vaccines, and solves the problem of preventing "shipping fever" (bovine respiratory syndrome) for cattle herds and during short-term transportation. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is the PCR amplification electrophoresis diagram of the recombinant fusion gene in Example 2 of the present invention; Figure 2 is the schematic diagram of the double digestion verification result of the recombinant fusion gene plasmid in Example 3 of the present invention; Figure 3 is the schematic diagram of the induced expression and purification results of the recombinant fusion protein rCD in Example 4 of the present invention; Figure 4 is the schematic diagram of the reactivity analysis of the recombinant fusion protein rCD with bovine Mh positive serum and Pm positive serum in Example 5 of the present invention; Figure 5 is the schematic diagram of the detection results of rCD immunized mouse IL-2 and IL-10 in Test Example 1 of the present invention; Figure 6This is a schematic diagram of HE staining results of the main organs of mice immunized with the recombinant fusion protein rCD-white oil adjuvant in Test Example 1 of the present invention; Figure 7 It is a schematic diagram of the detection results of IgG, IgG2a / IgG1 and IgG subtypes of Mh antibodies after mice were immunized with rCD-white oil adjuvant in Test Example 2 of the present invention; Figure 8 It is a schematic diagram of the detection results of IgG, IgG2a / IgG1 and IgG subtypes of Pm antibodies after mice were immunized with rCD-white oil adjuvant in Test Example 2 of the present invention; Figure 9 This is a schematic diagram of the detection results of mouse serum cytokines IFN-γ, TNF-α, IL-4, IL-6 and IL-17 after mice were immunized with rCD-white oil adjuvant in Test Example 3 of the present invention; Figure 10 This is a schematic diagram of the HE staining results of the main organs of mice after being challenged with the highly virulent strains WT Mh95 and WT PmA1 in Test Example 4 of the present invention; Figure 11 This is a schematic diagram of the results of ELISpot detection of IFN-γ secretion by spleen lymphocytes of rCD immunized mice in Test Example 5 of the present invention; Figure 12 It is a schematic diagram of the detection results of IFN-γ and IL-4 in the cell supernatant after the spleen lymphocytes of immunized mice were stimulated by the same protein in Test Example 6 of the present invention; Figure 13 It is a schematic diagram of the detection results of Mh and Pm IgG antibodies in the serum of calves immunized with rCD in Test Example 7 of the present invention. DETAILED DESCRIPTION

[0018] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the accompanying drawings.

[0019] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0020] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure or characteristic that may be included in at least one implementation of the present invention. The term "in a preferred embodiment" that appears in different places in this specification does not refer to the same embodiment, nor is it a separate or selective embodiment that is mutually exclusive with other embodiments.

[0021] Embodiment 1 Primer design Primers were designed based on the chaN of Mannheimia haemolytica (accession number: PQ280750) and dsbA of Pasteurella multocida (accession number: PQ582062) published by NCBI. The restriction enzyme sites of the chaN gene of Mannheimia haemolytica are "BamHⅠ" and "XhoⅠ", and the restriction enzyme sites of the dsbA gene of Pasteurella multocida are "XhoⅠ" and "HindⅢ". Homologous arms of primers were designed based on pET-32a(+). The primer information is shown in Table 1; Table 1: ;

[0022] Example 2 PCR amplification of the target gene Using the genomic DNA of Mannheimia haemolytica as a template, a 798bp target fragment of the chaN gene was obtained by PCR amplification; using the genomic DNA of Pasteurella multocida as a template, a 621bp target fragment of the dsbA gene was obtained by PCR amplification; the PCR products were fused using homologous recombination method, and then amplified using the upstream primer of chaN and the downstream primer of dsbA to obtain a 1419bp homologous recombinant gene. The results are shown in the appendix Figure 1 ; Among them, using the genomic DNA extracted from Mannheimia haemolytica and Pasteurella multocida as templates, the PCR reaction system is 50 μL: 2×Taq Plus Master MixⅡ 25 μL, ddH 2 O 21 μL, 1 μL each of the upstream and downstream primers, and 2 μL of the template; the reaction conditions are: pre-denaturation at 95℃ for 5 min; denaturation at 94℃ for 40 s, annealing for 50 s, extension at 72℃ for 60 s, for a total of 35 cycles; final extension at 72℃ for 10 min. The PCR products were verified by 1.5% agarose gel electrophoresis.

[0023] Example 3 Construction of the expression vector pET-32a(+) was double-digested with the restriction endonucleases XhoⅠ and BamHⅠ, and after verification by 1.5% agarose gel electrophoresis, gel extraction was carried out. A seamless cloning kit was used for ligation, and after ligation, it was transformed into E. coli BL21(DE3) to construct a recombinant plasmid expression vector. The recombinant plasmid was double-digested with the restriction endonucleases XhoⅠ and BamHⅠ, and the bacterial liquid PCR was carried out using the T7 primer. The digested products and PCR were subjected to 1.5% agarose gel electrophoresis, and the PCR products were sequenced and identified. The sequencing results were compared by NCBI Blast, and the inserted gene was consistent with the target gene, and the prokaryotic expression vector pET-32a-rCD(DE3) was successfully constructed. The results are shown in the appendix Figure 2 ; Among them, seamless cloning includes the following steps: (1) Measure the concentration of PCR products and the concentration of linearized pET-32a(+) plasmid using Nanodrop; (2) Calculate the usage amounts of the vector and the target fragment; (3) Prepare according to the system in Table 2 on ice; (4) Gently pipette and mix the mixed products, and briefly centrifuge to the bottom of a 0.2 mL PCR tube; (5) Incubate the mixed products in a 50 °C water bath for 15 min, and then immediately place on ice;

[0024] Example 4 Induced expression and purification of recombinant fusion protein Inoculate the pET-32a(+)-CD(DE3) expression engineering bacteria into 2 mL of LB(Amp+) liquid medium, and culture overnight at 37 °C and 200 rpm / min. Inoculate the above cultured bacterial solution into 200 mL of LB(Amp+) liquid medium, and culture at 37 °C and 200 rpm / min for 1 h; add IPTG with a final concentration of 1 mM, and induce expression at 37 °C; Take 1 mL of bacterial solution before induction, at 0 h, 2 h, 4 h, 6 h, and 8 h respectively, centrifuge at 8000 rpm / min and 4 °C for 5 min, collect the bacterial cells, and resuspend with 100 μL of PBS; After induction, the bacterial solution is centrifuged at 8000 rpm / min and 4 °C for 5 min, collect the bacterial cells, resuspend with 20 mL of PBS and wash repeatedly 3 times, and then resuspend with 20 mL of PBS; Under the condition of ice-water bath, ultrasonically disrupt with 60 W for 40 min, then centrifuge at 8000 rpm / min and 4 °C for 5 min, and collect the precipitate and supernatant. After the precipitate is resuspended with Package A, SDS-PAGE electrophoresis is performed on the precipitate and supernatant respectively to analyze the solubility of the recombinant protein. In order to obtain the target protein with a single band, the precipitate or supernatant verified by SDS-PAGE is purified using a 3 mL purification column containing His tag, and the prepared recombinant protein is stored in a -80 °C refrigerator.

[0025] After induced expression of E. coli BL21(DE3) containing the recombinant plasmid, it is ultrasonically disrupted, centrifuged to separate the precipitate and supernatant, and SDS-PAGE electrophoresis is performed. The results show that the optimal induction temperature of the recombinant fusion protein rChaN-DsbA is 37 °C, the optimal induction time is 6 h, the recombinant fusion protein rChaN-DsbA has an obvious band at 46 kDa, the size is in line with expectations, and the protein is mainly expressed in the precipitate, and the protein expression content in the supernatant is relatively low. After the protein is purified by Ni-NTA, SDS-PAGE electrophoresis is performed (please refer to Figure 3As shown in the figure, the results show that the protein band after purification is relatively single and the purification effect is good.

[0026] The coding gene sequence of the recombinant fusion protein rChaN-DsbA is shown in SEQ ID NO: 1; SEQ ID NO: 1: ATGGCTTTTTTTCTTTTAGGCTGCTCGGTTTCAACGCAATCCCTTAATGAACAAAACG TGGACTCTATCGGCCAAATTATTGATCTGAATACCAATCAAACGATTTCATTTACTGAA CTACTTTCCCGTCTATCTTCTCAAGATTACGTTTTAGTTGGTGAGGAGCATACTCAGT TAATTCACCACCAAATTGAATTGTATTTATTTAATCAACTTACGAAGAAAGCCAAGTT ACATTTAATTGCGTTGGAGATGTTAAATGTGGATCAGCAGCCTGCGATTGATCGCAT TCAGTTTAACCGACCGGTTAATTTATCAGCCACGGATTTAAGAGAGGCAATTCAATG GCAAAAATGGGATTGGAAGATGTATCAAGATTTAGTGGTAGAGAGCTTAGGTTCAA ATAGTCGTGTTATAGCCACTAACTTAACAGATAAAGAGGTTGAAATTTTATTAAATGG GGCGGAGCCATTAAAAGGTTCTGTATCCACTTCCTCTGAAGTTAAGCAAAAGATCGC ACAACTGTTGCTGTCAATGAATCACGGAATGCCTTACCCGATGGAAAATATGGTGGC AGTACAACAATTCCGTGATCGCAGAATGGCAGAAAAATTAGTAAAAAATGCGTTATC GACTAGCTTGCTGATTGCAGGTAACCACCACGTTCGCAAAGATCTTGGCGTTCCGTT GCATATTGCGGAATATGACCGAACAAAAAAAGTAGCGGTGCTAATGCTTAAAACAG AGAGAGAAGAAATTACTTCTTCACAGGCAGATTATCTTTGGGTCACTCAATAAgggtc actcaataaATGAAAAAATTAGTTTTAGCGGTGACGTCATTCCTTTTTGCTGTTTCTGTA CAAGCGACAAATTTAACCGAGGGTAAGCAGTATGTGACGTTAAATCAGGCACCTGT ACAACAAGCAGAAGTCATCGAGTTTTTCTCTTTTTATTGTCCACATTGTTATTCGTTT GAATACGAATACCAAATCCCAAATAAAGTGAAACAGCAGTTGCCAGAAGGTGTGAG CTTGAAACAATATCATGTCAACTTTTTAGGCGGTGAAATGGGGAAAAATCTTACTCG TGCATGGGCATTGGCTATGGCGACCGGTGTACAAGATAAAGTAAAAGAACCTTTATT TTTCGCGGCACAGCAAAATAAATTACGTAGTATGGATGATATTCGTCAAATCTTTTTG GCTAATGGTCTCAGTGCAGAACAATTTGATGGCGGAATTAACAGTTTTGCCGTCACA GCGTTAACCAATAAGCAAGTGACAGCGGCTGAACACATGAAAGTGCGTGGTGTGC CAGATTTTTACGTAAACGGGCGTTATCGTGTTAATCCTGAAGGACTGAAAAACGACA GTCATGAAGCGTTTGTTGCTGATTATGTCGAAACAGTAAAAGGTTTATTGCAAAAATAA

[0027] Example 5 Analysis of the Reactogenicity of the Recombinant Fusion Protein rChaN-DsbA Mix the purified recombinant fusion protein rChaN-DsbA (hereinafter referred to as recombinant fusion protein rCD) with 5×SDS-PAGE loading buffer in a ratio of 4:1, boil at 95°C for 5 min, centrifuge at 3000 rpm / min for 30 s, and use bovine Mh positive serum and bovine Pm positive serum as primary antibodies for Western Blot assay. Observe the results using a gel imaging system for color development and luminescence. React the primary antibodies with the recombinant fusion protein rCD using clinical bovine positive sera of Mannheimia haemolytica and Pasteurella multocida respectively. Please refer to Figure 4 As shown, the results show that the recombinant fusion protein rCD can specifically bind to bovine Mh and Pm positive sera respectively.

[0028] Test Example (1)Grouping for safety test For BALB / c mice weighing 20 to 24 g, with an equal number of males and females, group them for safety test according to Table 3; ; (2)Grouping for immunity test For BALB / c mice weighing 20 to 24 g, with an equal number of males and females, 25 mice in one group, group them for immunity according to Table 4;

[0029] Test Example 1 Verification of the immune safety of recombinant fusion protein rCD To analyze whether the combination of recombinant fusion protein rCD and different adjuvants is safe for immunizing mice, combine the recombinant fusion protein rCD with different adjuvants and immunize mice once. Detect the IL-2 and IL-10 cytokines in mice on the 7th and 42nd days after immunization. Please refer to Figure 5 As shown, the results show that the combination of recombinant fusion protein rCD and white oil adjuvant can stimulate the body to produce IL-2 cytokine and there is a highly significant difference compared with the PBS group (P < 0.0001), which indicates that the addition of white oil adjuvant helps to stimulate cellular immunity in the body; while there is no significant difference in IL-10 compared with the PBS group (P > 0.05); Dissect some mice on the 7th day after immunization, take the main organs for sectioning and HE staining. Please refer to Figure 6 As shown, the results show that compared with the mice in the PBS group, there are no obvious organic lesions in the lungs, livers, spleens, kidneys and hearts. Generally, the recombinant protein is safe for immunizing mice.

[0030] Test Example 2 Detection results of serum antibody titers in mice immunized with recombinant fusion protein rCD To study the specific antibody levels in mice after immunization with recombinant fusion protein, the mice were primed on day 0, boosted on days 14 and 28, and orbital venous blood was collected every 7 days to isolate serum for detecting antibody titers. The specific IgG antibodies and subtypes in the mice were monitored until day 119. In each immunization group with rCD recombinant fusion protein, the IgG antibody levels against Mannheimia haemolytica showed an upward trend, and the antibody levels were the highest in the immunization group 28 days after the first immunization. Overall, the antibody levels in the rCD-white oil adjuvant group and the PBS group were extremely significantly different (P < 0.001) (as Figure 7 shown); the IgG2a / IgG1 results showed that the IgG2a / IgG1 in the rND-white oil adjuvant group was overall < 1 during the monitoring period (as Figure 8 shown). The IgG antibody levels against Pasteurella multocida generally showed an upward trend. The antibody levels in the rCD-white oil adjuvant group were the highest on day 42 after the first immunization. Overall, the IgG antibody levels in each immunization group were extremely significantly different from those in the PBS group (P < 0.001), and the rCD-white oil adjuvant antibodies still existed until day 119 of the monitoring; the IgG2a / IgG1 results showed that the IgG2a / IgG1 in the rCD-white oil adjuvant group was overall < 1 (as Figure 8 shown); the IgG subtype detection showed that the body mainly produced IgG1 and IgG2b antibodies against Mh, and mainly produced IgG2a and IgG2b antibodies against Pm (as Figure 8 shown).

[0031] Test Example 3 Detection results of serum cytokines in mice immunized with recombinant fusion protein rCD Please refer to Figure 9 shown. After immunizing the mice according to the immunization protocol, blood was collected on days 7 and 42, and commercial ELISA kits were used to detect the IFN-γ, TNF-α, IL-4, IL-6, and IL-17 cytokines in the mice. The results were as Figure 9 shown. It can be seen that the IFN-γ, TNF-α, IL-4, IL-6, and IL-17 cytokines in the rCD-white oil adjuvant group were significantly or extremely significantly higher than those in the PBS group on days 7 and 42 (P < 0.05 or P < 0.01).

[0032] Test Example 4 Results of challenge protection of mice immunized with recombinant fusion protein rCD Please refer to Figure 10 shown. On day 42 after immunizing the mice with recombinant fusion protein, 10 mice in each rCD group were challenged with 5×LD of the WTMh95 strain 50 and 5×LD of the WT PmA1 strain 50Virus challenge was carried out. After virus challenge, the death situation of mice within seven days was counted. On the 8th day, the surviving mice were dissected and the main organs were subjected to HE staining. The results showed that all the mice in the PBS control group died within 7 days. The survival rate of the rCD adjuvant with white oil group against WT Mh95 virus challenge reached 90%, and the protective effect against type A1 Mh strains was relatively high. The survival rate of the rCD-white oil adjuvant group against WT PmA1 virus challenge was 80%. After HE staining of the main organs, the results showed that the mice in the white oil adjuvant group all showed relatively obvious protective effects on the tissues and organs, and the organic lesions were weak.

[0033] Test Example Five Results of detecting the secretion of IFN-γ by splenic lymphocytes of mice by ELISpot Please refer to Figure 11 As shown, the immune level of splenic lymphocytes of rCD-immunized mice was detected by ELISpot. On the 42nd day after mouse immunization, splenic lymphocytes were isolated. The results showed that after the splenic lymphocytes of the rCD-white oil adjuvant group were restimulated with specific antigens, the secretion of IFN-γ increased significantly, and was extremely significantly higher than that of the PBS control group (p < 0.001). The results indicate that rCD-white oil adjuvants can significantly induce the improvement of the cellular immune level of mice.

[0034] Test Example Six Results of detecting the secretion of IFN-γ and IL-4 by splenic lymphocytes of mice Please refer to Figure 12 As shown, the levels of Th1-type factor IFN-γ and Th2-type cytokine IL-4 in mouse serum were detected by ELISA method. On the 42nd day of immunization, the expression level of IFN-γ in the rCD white oil adjuvant group was significantly higher than that in the PBS group (P < 0.05); the expression level of IL-4 in the rCD-white oil adjuvant group at 42 days of immunization was extremely significantly higher than that of the PBS control group in each immunized group (P < 0.001), indicating that the white oil adjuvant can stimulate both Th1-type and Th2-type cellular immunity.

[0035] Test Example Seven Analysis of antibody levels in calf serum Please refer to Figure 13As shown, 20 calves aged 20 to 30 days were selected and randomly divided into 5 groups, with 4 calves in each group. They were immunized according to the table. One group was the PBS group, and the immunization method was subcutaneous injection in the neck. All calves were primed on day 0 and boosted on day 14. From day 0 to day 42, jugular vein blood was collected every 7 days, and the serum was separated to detect the antibody titer. The IgG antibody detection results showed that for the Mh antibody, the antibody in each rCD immunized group reached the peak on day 21 and then began to decline. Generally, the immunization effect of the white oil adjuvant group was higher than that of the propolis adjuvant group, and the rCD immunization effect was better. For the Pm antibody, the antibody in each rCD immunized group reached the peak on day 35 and then began to decline. Generally, the immunization effect of the white oil adjuvant group was higher than that of the propolis adjuvant group and the antibody decline was slower, and the rCD immunization effect was better.

[0036] In summary, by innovatively recombinantly expressing the bovine-origin Mannheimia haemolytica ChaN protein and Pasteurella multocida DsbA, a novel bovine M. haemolytica and P. multocida fusion protein subunit vaccine was successfully prepared. This vaccine has significant advantages and can simultaneously and effectively prevent and control respiratory diseases caused by Mannheimia haemolytica or / and Pasteurella multocida.

[0037] From the perspective of cost and operation, this vaccine has low cost and simple preparation process. In terms of use, its dosage is extremely small, the inoculation method is simple, safe and reliable, effectively avoiding a large amount of vaccine solution from spreading into the environment and reducing the potential impact on the environment. It is particularly worth mentioning that it can perfectly solve the problem of preventing "shipping fever" (i.e., bovine respiratory syndrome) in cattle herds during short-term transportation.

[0038] In terms of the inoculation method, this vaccine is immunized by subcutaneous injection in the neck. It not only has a small dosage, but also the inoculation process is simple and safe, without a large amount of vaccine solution leaking into the environment, and at the same time completely eliminates the risk of infection for epidemic prevention personnel. After immunization, the immunized animals can rapidly produce persistent antibodies, showing good immune protection and a long immune persistence period, enabling the immune antibodies to persist stably within 3 months, effectively solving the problem of low and slow antibody production after immunization with traditional bovine Mannheimia haemolytica vaccines and Pasteurella multocida vaccines.

[0039] In addition, this vaccine can also avoid unsafe side effects on immunized animals such as abortion of pregnant animals and allergic reactions caused by injection immunization. More importantly, it successfully solves the key problem that the current bovine Mannheimia haemolytica vaccines and Pasteurella multocida vaccines cannot achieve joint prevention and control, providing the best strategy choice for the control and purification of bovine Mannheimia haemolytica and Pasteurella multocida respiratory diseases.

[0040] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention. The structures, devices, and operation methods not specifically described and explained in the present invention are implemented according to the conventional means in the art without special instructions and limitations.

Claims

1. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine, characterized in that: Includes the following components: (a) Recombinant fusion protein rChaN-DsbA; (b) an adjuvant, wherein the adjuvant is a white oil adjuvant; The method for preparing the bovine M.haemolytica and P.multocida fusion protein subunit vaccine comprises the following steps: S1: The ChaN protein of Mannheimia haemolytica (accession number: PQ280750) and the DsbA protein of Pasteurella multocida (accession number: PQ582062) were connected by homologous recombination technology, induced to express in Escherichia coli and purified to obtain the recombinant fusion protein rChaN-DsbA; S2: The recombinant fusion protein rChaN-DsbA and white oil adjuvant are emulsified to prepare a vaccine preparation.

2. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine according to claim 1, characterized in that: As described in S1, obtaining the recombinant fusion protein rChaN-DsbA comprises the following steps: S11: Design specific primers to amplify the ChaN gene of Mannheimia haemolytica and the DsbA gene of Pasteurella multocida, wherein the restriction sites of the ChaN gene are BamHI and Xhol, and the restriction sites of the DsbA gene are Xhol and Hindlll; S12: insert the amplified gene fragment into the expression vector pET-32a (+) to construct the recombinant plasmid pET-32a-rCD; S13: The recombinant plasmid was transformed into Escherichia coli BL21 (DE3), and the recombinant fusion protein rChaN-DsbA was obtained by inducing expression and purification.

3. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine according to claim 1, characterized in that: As described in S2, the volume ratio of the recombinant fusion protein rChaN-DsbA and the white oil adjuvant is 1:1.5-2.

5.

4. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine according to claim 1, characterized in that: The coding gene sequence of the recombinant fusion protein rChaN-DsbA is shown in SEQ ID NO:

1.

5. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine according to claim 2, characterized in that: In the S13, the expression induction condition is: 37° C., and the protein molecular weight of the recombinant fusion protein rChaN-DsbA is 46 kDa.

6. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine according to claim 1, characterized in that: The content of the recombinant fusion protein rChaN-DsbA in each dose of the bovine M. haemolytica and P. multocida fusion protein subunit vaccine is 600 μg.

7. A bovine M.haemolytica and P.multocida fusion protein subunit vaccine according to claim 1, characterized in that: The dual subunit vaccine of Mannheimia haemolytica and Pasteurella multocida is administered by subcutaneous injection in the neck.

8. Use of the bovine M. haemolytica and P. multocida fusion protein subunit vaccine according to any one of claims 1 to 7 in preventing infection by Mannheimia haemolytica and Pasteurella multocida.

Images