Rabbit-derived antibody aiming at mouse nerve cell adhesion molecule 1 and application thereof

Abstract

The invention belongs to the technical field of antibody preparation, and particularly relates to a rabbit-derived antibody aiming at a mouse nerve cell adhesion molecule 1 and application of the rabbit-derived antibody. The amino acid sequences of CDR1-3 on a light chain variable region of the antibody are respectively shown as SEQ ID NO.3-5, and the amino acid sequences of CDR1-3 on a heavy chain variable region of the antibody are respectively shown as SEQ ID NO.8-10. An effective antibody tool is provided for detection of the level of the mouse nerve cell adhesion molecule 1 and diagnosis of abnormal expression diseases, the antibody strain has specific and sensitive recognition and combination capacity on the mouse nerve cell adhesion molecule 1, CD56 / NCAM-1 protein positioned on the cell surface can be effectively recognized and detected, positive signals are obvious, membrane positioning is accurate, and the antibody strain has a good application prospect. And the antibody has no specific binding and cross reaction to non-target antigens, and has the advantages of high reliability, strong specificity, good reliability and the like when being used for immunodetection of the CD56 / NCAM-1 protein.

Description

Technical Field

[0001] The present invention relates to the technical field of antibody preparation, and particularly to a rabbit-derived antibody against mouse neural cell adhesion molecule 1 and its application. Background Art

[0002] Neural cell adhesion molecule 1 (NCAM-1), also known as CD56, belongs to the immunoglobulin superfamily (IgSF). CD56 / NCAM-1 is a single-pass type I transmembrane protein with a molecular weight of 120-180 kDa. The amino acid sequence from positions 20 to 711 is its extracellular domain, the amino acid sequence from positions 712 to 729 is its transmembrane domain, and the amino acid sequence from positions 730 to 1115 is its cytoplasmic domain. Due to different splicing patterns of mRNA, CD56 / NCAM-1 has three different molecular subtypes, and each subtype has differences in the cytoplasmic domain. The CD56 / NCAM-1 protein is mainly present on the surfaces of neurons, glial cells, lymphocytes and other cells; as a cell adhesion molecule, it plays an important role in embryonic development and the interaction of nerve cells. During the development of the nervous system, nerve cells recognize and adhere to each other through the CD56 molecule, thereby guiding the migration of neurons and the growth of axons, and helping to construct a complex neural network. In addition to the cell adhesion function, CD56 can also regulate the differentiation of neural stem cells. During the regeneration process after nerve injury, CD56 also helps to repair and reconnect damaged nerve fibers, and promotes the recovery of nerve function.

[0003] CD56 / NCAM-1 is mainly expressed on undifferentiated tissues or malignant tumor cells, such as tumors derived from the neuroectoderm (such as retinoblastoma, astrocytoma, neuroblastoma, etc.), neuroendocrine tumors, small cell lung cancer, NK / T cell lymphoma / leukemia, multiple myeloma and acute myeloid leukemia, etc.; it has been used as a marker for NK cells and the aforementioned tumor cells, and can be used for cell labeling, sorting and tumor molecular diagnosis. For example, CD56 is highly specifically expressed on the cell membrane surface of almost all small cell lung cancer (SCLC), while it is not expressed or weakly expressed in non-small cell lung cancer (NSCLC). This feature makes CD56 a reference index for differentiating SCLC from NSCLC. For another example, almost all tumor cells in nasal type NK / T cell lymphoma express CD56, which helps to distinguish it from other types of lymphoma. In addition, studies have shown that CD56 is highly expressed in normal thyroid tissue, nodular goiter, follicular adenoma and papillary hyperplasia, while it is lost or weakly expressed focally in papillary thyroid carcinoma. Therefore, the diagnosis of papillary thyroid carcinoma can be assisted by detecting molecular markers such as CD56, and the diagnostic sensitivity, specificity and accuracy can be improved.

[0004] In the clinical diagnosis and treatment targeting CD56 / NCAM-1, immunodetection techniques based on the specific reaction of antigen and antibody, such as immunoblotting and flow cytometry, are reliable means for detecting the CD56 protein level on pathological cells / tissues. These methods all involve anti-CD56 / NCAM-1 antibodies. Therefore, screening a highly sensitive and strongly specific anti-CD56 / NCAM-1 antibody plays a very important role in identifying and detecting the expression of CD56 / NCAM-1 protein on tumor cells or immune cells. Summary of the Invention

[0005] Aiming at the problems of poor specificity and low sensitivity of anti-mouse neural cell adhesion molecule 1 (CD56 / NCAM-1) antibodies used in immunodetection in the prior art, the present invention provides a novel rabbit-derived antibody against mouse CD56 / NCAM-1, and further provides the application of the rabbit-derived antibody and antibody conjugate in the preparation of a mouse CD56 / NCAM-1 immunodetection kit and related immunodetection kits. To achieve the foregoing objectives, the present invention is specifically realized through the following technical solutions:

[0006] The first aspect of the present invention provides a rabbit-derived antibody against mouse neural cell adhesion molecule 1, including a light chain variable region and a heavy chain variable region. The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are respectively as shown in SEQ ID NO.3-5, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are respectively as shown in SEQ ID NO.8-10.

[0007] Further, the amino acid sequence of the light chain variable region is as shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is as shown in SEQ ID NO.7.

[0008] Further, the amino acid sequence of the antibody light chain is as shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is as shown in SEQ ID NO.6.

[0009] Further, the antibody is a full-length antibody or its antigen-binding region; the antigen-binding region is selected from at least one of Fab fragment, F(ab) 2 fragment, Fv fragment, (Fv) 2 fragment, scFv fragment, and sc(Fv) 2 fragment.

[0010] The second aspect of the present invention provides an antibody conjugate, including the rabbit-derived antibody against mouse neural cell adhesion molecule 1 as described above and a detection label connected to the antibody.

[0011] In the third aspect of the present invention, there is provided a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule, or a host cell containing the nucleic acid molecule, and the nucleic acid molecule encodes a rabbit-derived antibody against mouse neural cell adhesion molecule 1 as described above.

[0012] Further, the nucleic acid sequence of the variable region of the antibody light chain is as shown in SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the variable region of the heavy chain is as shown in SEQ ID NO.14 or a sequence complementary thereto.

[0013] Even further, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a sequence complementary thereto.

[0014] In the fourth aspect of the present invention, there is provided the use of the rabbit-derived antibody or antibody conjugate against mouse neural cell adhesion molecule 1 as described above in the preparation of an immunoassay kit for mouse neural cell adhesion molecule 1.

[0015] Further, the kit is selected from an enzyme-linked immunosorbent assay kit, an enzyme-linked immunospot kit, an immunohistochemistry kit, an immunofluorescence kit, an immunoblot kit, or a flow cytometry kit.

[0016] In the fifth aspect of the present invention, there is provided an immunoassay kit for mouse neural cell adhesion molecule 1, and the kit includes the rabbit-derived antibody or antibody conjugate against mouse neural cell adhesion molecule 1 as described above.

[0017] The advantages and positive effects of the present invention are as follows:

[0018] The present invention provides an effective antibody tool for the detection of mouse neural cell adhesion molecule 1 (CD56 / NCAM-1) level and the diagnosis of diseases with abnormal expression. The provided antibody strain has specific and sensitive recognition and binding ability to mouse CD56 / NCAM-1, can effectively recognize and detect the CD56 / NCAM-1 protein located on the cell surface, and has obvious positive signals and accurate membrane localization. Moreover, it has no specific binding and cross-reaction with non-target antigens, and has advantages such as high credibility, strong specificity, and good reliability for immunoassay of CD56 / NCAM-1 protein. It is especially suitable for the detection and screening fields of immunoassay, such as immunofluorescence and flow cytometry analysis, and has good application prospects. Description of the Drawings

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the accompanying drawings required for the description of the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0020] Figure 1 This is the detection result graph of the immune serum titer after immunizing a New Zealand white rabbit with the extracellular domain of mouse neural cell adhesion molecule 1 in Example 1 of the present invention;

[0021] Figure 2 This is the flow cytometry detection result graph of the immune serum binding to positive cell samples after immunizing a New Zealand white rabbit with the extracellular domain of mouse neural cell adhesion molecule 1 in Example 1 of the present invention;

[0022] Figure 3 This is the flow cytometry detection result graph of the immune serum binding to negative cell samples after immunizing a New Zealand white rabbit with the extracellular domain of mouse neural cell adhesion molecule 1 in Example 1 of the present invention;

[0023] Figure 4 This is the pRB322 vector map for constructing a rabbit - derived antibody expression vector against mouse neural cell adhesion molecule 1 in Example 1 of the present invention. From left to right are the vectors pre - carrying the constant region of the antibody light chain and the constant region of the heavy chain;

[0024] Figure 5 This is the flow cytometry detection result graph of the rabbit - derived antibody against mouse neural cell adhesion molecule 1 binding to positive and negative cells in Example 2 of the present invention;

[0025] Figure 6 This is the immunofluorescence detection result graph of the rabbit - derived antibody against mouse neural cell adhesion molecule 1 binding to positive cells in Example 2 of the present invention. Detailed implementation manners

[0026] In order to make the purpose, technical solutions and advantages of the present invention clearer, the following further details the present invention with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0027] Based on the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for schematically illustrating specific aspects of the present invention. In fact, all various changes that those skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.

[0028] For a better understanding of the present invention and not as a limitation on its scope, all numbers representing amounts, percentages, and other numerical values used in the present invention should be understood to be modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters set forth in the specification and the appended claims are approximations that may vary depending on the desired properties sought. Each numerical parameter should at least be construed in light of the reported significant digits and by applying ordinary rounding techniques.

[0029] In addition, it should be noted that, unless otherwise defined, scientific and technical terms used in the context of the present invention shall have the meanings commonly understood by those of ordinary skill in the art.

[0030] The meanings of terms such as "comprising", "including", "containing", "having", and the like are non-limiting, i.e., other steps and other components can be added without affecting the result.

[0031] The term "and / or" shall be regarded as a specific disclosure of each of two designated features or components with or without the other. For example, "A and / or B" is regarded as including the following cases: (i) A, (ii) B, and (iii) A and B.

[0032] Terms such as "rabbit monoclonal antibody", "monoclonal antibody", "rabbit-derived antibody", and "rabbit mAb" and the like have the same meaning, and unless otherwise specified, all refer to an antibody that specifically binds to mouse neural cell adhesion molecule 1. Terms such as "neural cell adhesion molecule 1", "NCAM-1", "NCAM1", "CD56 / NCAM-1", "CD56", "Neural cell adhesion molecule 1" and the like have the same meaning. The modifier "rabbit" indicates that the complementarity-determining regions (CDRs) of the antibody are derived from rabbit immunoglobulin sequences.

[0033] An antibody is an immunoglobulin molecule that can specifically bind to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and includes different antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and their genetic or chemical modifications, as long as they exhibit the desired antigen-binding activity. An antibody fragment can be one or more parts or fragments of a full-length antibody that retain the ability of the antibody to specifically bind to the target antigen.

[0034] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). The light chains can be divided into two types, namely κ chains and λ chains; the heavy chains can be classified into five types, namely μ, δ, γ, α, and ε chains, and the antibodies are defined as IgM, IgD, IgG, IgA, and IgE respectively. The amino acid sequences near the N-terminus of the heavy and light chains vary greatly, while the amino acid sequences in other parts are relatively constant. The regions with relatively large amino acid sequence variations near the N-terminus in the light and heavy chains are called variable regions (V), and the regions with relatively stable amino acid sequences near the C-terminus are called constant regions (C). The variable regions of the heavy chain (VH) and the variable region of the light chain (VL) are usually the most variable parts of the antibody and contain antigen recognition sites. The VH and VL regions can be further subdivided into hypervariable regions (HVR) and framework regions (FR). The hypervariable regions are also called complementarity-determining regions (CDR), which are loop structures. The CDRs of the heavy chain and the CDRs of the light chain are closely juxtaposed and cooperate with each other through the FR regions to jointly form a surface that is complementary to the three-dimensional structure of the target antigen or epitope, determining the specificity of the antibody and being the sites where the antibody recognizes and binds to the antigen. The FR regions are the more conserved parts of VH and VL. They generally adopt a β-sheet conformation and are connected by three CDRs forming connecting loops. Each VH and VL usually consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0035] The CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, the cumulative of the Kabat definition and the Chothia definition, the AbM definition, the contact definition, the IMGT unique numbering definition, and / or the conformational definition or any CDR determination method well-known in the art. As used in the present invention, it is defined by the Kabat numbering system.

[0036] The constant region of the light chain (CL) and the constant region of the heavy chain (CH) do not directly participate in the binding of the antibody to the antigen, but they exhibit different effector functions, such as participating in antibody-dependent cell cytotoxicity. The lengths of the CLs of different Ig types (κ or λ) are basically the same, but the lengths of the CHs of different Ig classes are different. For example, IgG, IgA, and IgD include CH1, CH2, and CH3, while IgM and IgE include CH1, CH2, CH3, and CH4. The amino acid sequences of the constant regions of the antibody heavy and light chains are well-known in the art and can be obtained by querying the IMGT database.

[0037] Full-length antibodies are the most complete antibody molecular structures, with a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "intact antibody", and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0038] Antibody fragments are one or more parts or fragments of a full-length antibody, which basically retain the same biological function or activity as the full-length form. Specifically, antibody fragments at least include the same CDR regions as the full-length antibody, and more preferably have the same variable regions, thereby retaining a complete antigen recognition and binding site, and being able to bind to the same antigen as the full-length antibody, especially binding to the same epitope. In a typical example, antibody fragments include: Fab, F(ab) 2 、Fab’, F(ab’) 2 、Fv、(Fv) 2 、scFv、sc(Fv) 2 , and these antibody fragments can be obtained by conventional techniques in the art.

[0039] (i) Fab: The antigen-binding fragment (Fab) is a monovalent fragment composed of a complete light chain (variable region and constant region) and a partial heavy chain (variable region and the first constant region). By protease digestion of the full-length antibody, Fab, F(ab’) 2 、Fab’ and other fragments can be obtained. For example, under the action of papain, IgG can be degraded into two Fab fragments and one Fc fragment; under the action of pepsin, IgG can be degraded into one F(ab’) 2 fragment and one pFc' fragment. The F(ab') 2 fragment is further reduced to form two Fab’ fragments. Since Fab has an antigen-binding region and a partial constant region, it not only has the same antibody-antigen affinity as scFv, excellent tissue penetration, etc., but also has a more stable structure.

[0040] (ii) F(ab) 2 : A bivalent fragment containing two Fabs linked by a hinge region disulfide bridge.

[0041] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment and only contains the variable region. It is composed of the variable regions of one light chain and one heavy chain, and is a non-covalently bound dimer of a VH and a VL (VH-VL dimer). The 3 CDRs of each variable region interact to form an antigen-binding site on the surface of the VH-VL dimer, and have the ability to recognize and bind antigens, although the affinity is lower than that of the full-length antibody.

[0042] (iv) (Fv) 2: It consists of two Fv fragments covalently linked together.

[0043] (v)scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, which is formed by connecting a variable heavy chain region (VH) and a variable light chain region (VL) through a flexible linker (usually composed of 10 - 25 amino acids). It retains the binding specificity of the original antibody to the antigen. In the present invention, the linker only needs to not interfere with the expression of the antibody variable regions connected at both ends, and there is no particular limitation. Compared with the full-length antibody, scFv has the characteristics of a small molecular weight, so it has higher penetrability and lower immune side reactions.

[0044] (vi)sc(Fv) 2 fragment, which is formed by connecting two variable heavy chain regions and two variable light chain regions through a linker or the like.

[0045] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may contain complementary determining regions (CDRs) and framework regions (FRs) from rabbit immunoglobulin sequences. In other embodiments, the antibody may contain amino acid residues encoded by non-rabbit immunoglobulin sequences, such as, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to an antibody in which a part is derived from a specific source or species, while the remaining part is derived from a different source or species. The term "humanized antibody" is a chimeric antibody with the CDR regions of a non-human antibody such as a rabbit antibody and the FR regions from a human antibody. In some cases, the variable region of the non-human antibody is combined with the constant region of the human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR regions of the non-human antibody are combined with the FR regions and constant regions derived from the human antibody sequence, that is, the CDR regions of the non-human antibody are grafted onto the human antibody framework (FR) sequence, and this framework sequence is derived from a single or multiple other human antibody variable region framework sequences. In the present invention, the CDR regions in the chimeric antibody or humanized antibody are derived from rabbit CDR regions.

[0046] The terms "monoclonal antibody" or "mAb" and similar terms are used interchangeably and refer to a homogeneous population of antibodies, i.e., each antibody constituting the population is identical except for minor mutations and / or post-translational modifications (such as isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially the same epitope on an antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous population of antibodies and should not be construed as limiting the source or method of preparation of the antibody. The antibody can be prepared by a variety of methods, including but not limited to the hybridoma method, phage display method, yeast display method, recombinant DNA method, single cell screening or single cell sequencing method.

[0047] The term "specific binding" is well known in the art. A molecule exhibits "specific binding" if it reacts more frequently, more rapidly, for a longer duration, and / or with greater affinity with a particular target antigen or epitope than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding. To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of specific embodiments of the present invention will be given with reference to the accompanying drawings.

[0048] An embodiment of the present invention provides a rabbit-derived antibody against mouse neural cell adhesion molecule 1 (CD56 / NCAM-1), which includes a light chain variable region and a heavy chain variable region. Both the light chain variable region and the heavy chain variable region include 3 complementarity determining regions (CDRs), named CDR1, CDR2, and CDR3 respectively. Among them, the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5 respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10 respectively.

[0049] The immune response mechanisms of rabbits and mice are different. Relatively speaking, the immune response generated by rabbits is stronger than that of mice. In the present invention, the extracellular domain of mouse CD56 / NCAM-1 protein is used to immunize New Zealand white rabbits. Then, through B cell labeling and sorting techniques, B cells that can recognize CD56 are enriched and isolated from the spleens of immunized rabbits, cultured in the form of single cells, and directly rabbit-derived monoclonal antibodies are obtained, omitting the complex process of preparing mouse anti-hybridomas. Finally, the monoclonal antibody gene is expressed by genetic engineering recombinant expression technology to scale up the production of the target antibody strain. The obtained rabbit anti-structure is simpler and more stable than mouse anti, and the production and development of rabbit mAbs are relatively less difficult, the antibody preparation process is simple, and the cost is low. Moreover, the antibody products obtained based on recombinant expression have good batch stability and high consistency.

[0050] The antibody strain provided by the present invention has specific and sensitive recognition and binding capabilities for mouse CD56 / NCAM-1, can effectively recognize and detect CD56 protein located on the cell surface, with obvious positive signals and accurate membrane localization, and has no specific binding and cross-reaction with other components of the cell (non-target antigens), and has excellent anti-interference ability. It has advantages such as high credibility, strong specificity, and good reliability for detecting CD56 / NCAM-1 protein, which is beneficial to obtaining accurate evaluation and detection results. The present invention provides an effective antibody tool for the detection of mouse CD56 / NCAM-1 protein level and the diagnosis of diseases with abnormal expression, effectively broadening the applicable scenarios of immunodiagnostic antibodies, especially applicable to the detection and screening fields such as immunofluorescence and flow cytometry analysis, and has good application prospects in the diagnosis and treatment of diseases such as retinoblastoma, astrocytoma, neuroblastoma, neuroendocrine tumor, small cell lung cancer, NK / T cell lymphoma / leukemia, multiple myeloma, acute myeloid leukemia, papillary thyroid carcinoma, etc.

[0051] Optionally, both the light chain variable region and the heavy chain variable region include 4 framework regions (FRs), and the 4 FRs and 3 CDRs are arranged alternately in sequence to form the variable region. The amino acid sequence of the light chain variable region (VL) of the antibody of the present invention is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region (VH) is shown in SEQ ID NO.7.

[0052] Optionally, the antibody of the present invention further includes a light chain constant region (CL) and a heavy chain constant region (CH). CL and VL form a complete light chain (FL), and CH and VH form a complete heavy chain (FH). The constant region of the antibody can usually be obtained through public queries. For example, through the IMGT online database (www.imgt.org), search for rabbit IgG gamma C reign to obtain CH, and search for rabbit IgG Kappa C reign to obtain CL.

[0053] Specifically, the amino acid sequence of the light chain of the antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6.

[0054] It should be noted that the monoclonal antibody of the present invention can be a full-length antibody (with a typical Y-shaped molecular structure) or the antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that basically retains the same biological function or activity as the full-length form. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining the complete antigen recognition and binding site, and can bind to the same antigen as the full-length antibody, especially bind to the same epitope. Optionally, the antigen-binding region is selected from Fab, F(ab) 2, Fab’, F(ab’) 2 , Fv, (Fv) 2 , scFv and sc(Fv) 2 At least one of those. These antigen-binding regions can be obtained by conventional techniques in the art.

[0055] Another embodiment of the present invention provides an antibody conjugate, comprising a rabbit antibody against mouse neural cell adhesion molecule 1 (CD56 / NCAM-1) as described above and a detection label linked to the antibody.

[0056] The detection label is used to generate a recognizable signal change to identify the antibody of the present invention according to the signal change, and further identify the expression of CD56 / NCAM-1 protein in the sample to be detected through the specific reaction of antigen and antibody. The detection label includes but is not limited to: biotin, fluorescent dyes (such as umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0057] It should be emphasized that the antibody of the present invention can be used alone or linked to a detection label (covalently or non-covalently) to form an antibody conjugate. In some embodiments, the antibody of the present invention is used as an antigen-binding (or capture) antibody, which specifically recognizes and binds the CD56 / NCAM-1 protein in the sample to be detected, and then qualitatively or quantitatively detects CD56 / NCAM-1 by analyzing the signal of the detection label linked thereto; in other embodiments, the antibody against CD56 / NCAM-1 protein (as a primary antibody or capture antibody) is not labeled, but the detection label is conjugated to a secondary antibody (as a detection antibody) or other molecules that can bind to the primary antibody. For example, if the anti-CD56 / NCAM-1 antibody is a rabbit IgG antibody, then the secondary antibody can be an anti-rabbit IgG antibody. Thus, by analyzing the signal change of the detection label generated after the secondary antibody specifically binds to the antibody of the present invention, qualitative or quantitative detection of CD56 / NCAM-1 can be achieved, such as the multiple detection systems established in Example 2 below of the present invention.

[0058] Another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector containing the nucleic acid molecule or a host cell containing the nucleic acid molecule, and the nucleic acid molecule encodes a rabbit antibody against CD56 / NCAM-1 as described above.

[0059] The nucleic acid molecule can be in the form of DNA (such as cDNA, genomic DNA, or synthetic DNA) or RNA (such as mRNA or synthetic RNA). The DNA can be single-stranded or double-stranded, and can also be the coding strand or the non-coding strand.

[0060] The sequence of the nucleic acid molecule can be obtained by derivation through conventional means such as codon coding rules based on the antibody AA sequence. The full-length sequence or a fragment of the nucleic acid molecule can usually be obtained by PCR amplification, recombination, or artificial synthesis methods.

[0061] Exemplarily, the nucleic acid sequence of the variable region of the antibody light chain is as shown in SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the variable region of the heavy chain is as shown in SEQ ID NO.14 or a sequence complementary thereto.

[0062] Exemplarily, the nucleic acid sequence of the antibody light chain is as shown in SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is as shown in SEQ ID NO.13 or a sequence complementary thereto.

[0063] The original vectors for constructing the recombinant vector are various conventional vectors in the art, as long as they can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series), viral vectors, phages (such as λgt4λB, λ-Charon, λΔz1, and M13), cosmids, and minichromosomes. The vector can be a cloning vector (i.e., used to transfer the nucleic acid molecule into a host and multiply it in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). Insert the nucleic acid molecule into a suitable vector to form a cloning vector or an expression vector carrying the nucleic acid molecule, then introduce it into the host cell and culture it under specific conditions to express and obtain the antibody. This is well-known technology in the art and will not be described in detail here.

[0064] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors respectively, which can be introduced into the same or different host cells. When the heavy chain and the light chain are expressed in different host cells, each chain can be separated from the host cell expressing it, and the separated heavy chain and light chain are mixed and incubated under suitable conditions to form the antibody. In some other embodiments, the nucleic acid molecules of the antibodies FL and FH can also be cloned into one vector, and each nucleic acid sequence is linked downstream of a suitable promoter; for example, each nucleic acid sequence encoding the heavy chain and the light chain can be operably linked to different promoters, or the nucleic acid sequences encoding the heavy chain and the light chain can be operably linked to a single promoter such that both the heavy chain and the light chain can be expressed by the same promoter. The choice of the expression vector / promoter depends on the type of host cell used to produce the antibody.

[0065] The transfection or transformation of the recombinant vector into the host cell is carried out by conventional techniques. When the host is a prokaryote such as Escherichia coli, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl 2 method or MgCl 2 treatment; it can also be through microinjection, electroporation or liposome packaging, etc. When the host is a eukaryote, the following DNA transfection methods can be selected: calcium phosphate co-precipitation method, microinjection method, electroporation method, liposome packaging or gene gun bombardment and other methods to achieve gene introduction.

[0066] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include but are not limited to Escherichia coli (such as DH5α, JM109, BL21, W3110), Bacillus spp. (such as Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (such as Salmonella typhimurium, Serratia marcescens) and Pseudomonas spp. Examples of eukaryotic host cells that can be used for transformation include but are not limited to yeast, insect cells and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK and HEK293 cell lines. After obtaining the host cell transfected or transformed with the recombinant vector as described above, it is cultured under suitable conditions, and then the antibody can be expressed, and then separated to obtain the purified antibody.

[0067] In a typical embodiment, the method for preparing the antibody includes, after the heavy chain gene and light chain gene of the antibody are concatenated with a signal peptide, they are respectively loaded on the expression vector pBR322, co-transfected into human renal epithelial cells (293F), the 293F cells are cultured, the cell culture supernatant is collected, and the target antibody strain is obtained by purification. The selection of the signal peptide is designed according to the host cell, and the present invention has no special limitation on this.

[0068] Another embodiment of the present invention provides the use of the rabbit-derived antibody or antibody conjugate against mouse neural cell adhesion molecule 1 (CD56 / NCAM-1) as described above in the preparation of a mouse neural cell adhesion molecule 1 immunoassay kit.

[0069] The advantages of the use of the rabbit-derived antibody or antibody conjugate against mouse CD56 / NCAM-1 in the preparation of a mouse neural cell adhesion molecule 1 immunoassay kit are the same as the advantages of the rabbit-derived antibody against mouse CD56 / NCAM-1 as described above compared with the prior art, and will not be elaborated here.

[0070] Based on the same inventive concept, an embodiment of the present invention also provides a kit for immunodetection of mouse neural cell adhesion molecule 1, which includes the rabbit-derived antibody or antibody conjugate against mouse neural cell adhesion molecule 1 as described above.

[0071] The above-mentioned immunodetection methods include but are not limited to: Enzyme linked immunosorbent assay (ELISA), Enzyme-linked Immunospot (ELISPOT), Immunohistochemistry (IHC), Immunofluorescence (IF), Western blot (WB), Immunoprecipitation (IP), and Flow Cytometry (FC). The detection kit can be an ELISA kit, an ELISPOT kit, an IHC kit, an IF kit, a WB kit, or an FC kit.

[0072] Preferably, the detection kit is an FC kit or an IF kit.

[0073] The present invention will be further described below in conjunction with specific embodiments. For the experimental methods without specific conditions noted in the following embodiments, they are usually carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory, or usually according to the conditions recommended by the manufacturer.

[0074] Example 1 Preparation of Rabbit-derived Antibody against Mouse Neural Cell Adhesion Molecule 1

[0075] The extracellular domain of mouse neural cell adhesion molecule 1 (CD56 / NCAM-1) was used to immunize a New Zealand white rabbit. Then, based on single B cell labeling and sorting technology, B cells that could recognize the target antigen were directly enriched and sorted from the spleen of the rabbit immunized with CD56 / NCAM-1. The isolated B cells were cultured in single cell form to obtain monoclonal antibody 1A2. Finally, through genetic engineering recombinant expression technology, the genes of the naturally paired antibody light chain (VL) and heavy chain variable region (VH) were first obtained by PCR amplification from the B cells secreting the monoclonal antibody, and were respectively inserted in series with the light chain (CL) and heavy chain constant region (CH) into the expression vector, and monoclonal antibody 1A2 was mass-produced by recombinant expression of the antibody gene.

[0076] The antibody sequencing work was completed by Wuhan Kingcare Biotechnology Co., Ltd. The amino acid (AA) and nucleotide (DNA) sequences of the antibody are shown in Table 1. In the table, LCDR1-3 represent the complementarity-determining regions CDR1-3 on the light chain, and HCDR1-3 represent the complementarity-determining regions CDR1-3 on the heavy chain.

[0077] Table 1 Sequence information of rabbit-derived antibody 1A2 in this example

[0078]

[0079]

[0080] 1.1 Antigen preparation: The immunogen for preparing rabbit monoclonal antibody is the extracellular domain (AA fragment at positions 20-711) of mouse CD56 / NCAM-1 protein. The amino acid sequence of CD56 / NCAM-1 can be found in NCBI accession number NP_001106675.1 or Uniprot number P13595, and the gene sequence can be found in NCBI accession number NM_001113204.2. The gene sequence corresponding to the AA fragment at positions 20-711 of CD56 protein was constructed into the pYURK-Chis vector and expressed in 293F cells through a eukaryotic expression system to obtain a biologically active recombinant mouse CD56 / NCAM-1 protein. The purity of the recombinant protein was detected to be greater than 90%.

[0081] 1.2 Animal immunization: Four New Zealand white rabbits were immunized with the above-prepared recombinant mouse CD56 / NCAM-1 protein at a dose of 200 μg per rabbit. Before the first immunization, the antigen was mixed with an equal volume of complete Freund's adjuvant (purchased from Sigma) to make an emulsifier, which was injected subcutaneously at multiple points on the abdomen and back of the rabbit. Every 3 weeks after the first immunization, 100 μg of the immunogen was mixed with an equal volume of incomplete Freund's adjuvant (purchased from Sigma) to make an emulsifier, which was injected subcutaneously at multiple points on the abdomen and back of the rabbit for two booster immunizations. After three immunizations, rabbit serum samples were collected, and the titer against mouse CD56 / NCAM-1 protein was determined by enzyme-linked immunosorbent assay (ELISA), and the recognition specificity and binding affinity of the serum to endogenous samples (positive cells Neuro-2a expressing CD56 and negative cells L-929 not expressing CD56) were detected by flow cytometry (FC).

[0082] The results of ELISA determination of serum titer are shown in Figure 1, where WA-64785D is the project number, N19737 and N19738 are rabbit numbers, NC represents the negative serum control, the coating concentration of the antigen recombinant mouse CD56 / NCAM-1 protein (20-711AA) is 1 μg / mL, the primary antibody is the immune serum, and the secondary antibody is goat anti-rabbit IgG conjugated with horseradish peroxidase (HRP) (purchased from jacksonimmunoresearch, 111-035-045). The results of FC detection of the binding specificity between the serum and the CD56 protein on the surface of the positive cell Neuro-2a are shown in Figure 2 , and the results of FC detection of the binding specificity between the serum and the CD56 protein on the surface of the negative cell L-929 are shown in Figure 3 , where the abscissa represents the relative fluorescence intensity, the ordinate represents the relative number of cells, the red curve is the blank control, the blue curve is the isotype control, and the yellow curve is the serum to be tested. The serum dilution ratios from left to right are 1:500 and 1:2000. From Figure 1-2 , it can be seen that after immunization with the extracellular domain of the CD56 / NCAM-1 protein, specific antibodies that can recognize the target antigen have been produced in the rabbits. Rabbits with high serum titers and the best endogenous detection were selected, and immunized subcutaneously at multiple points with 200 μg of the immunogen for a booster immunization once. Three days later, the animals were sacrificed and the spleens were taken.

[0083] 1.3 Isolation of B cells in the spleen and sorting of antigen-specific B cells: For the relevant methods, refer to the publicly disclosed patents "Method for efficiently isolating single antigen-specific B lymphocytes from spleen cells (Publication No.: CN110016462A, Publication Date: July 16, 2019)" and "An in vitro culture system for B lymphocytes and its application (Publication No.: CN111518765A, Publication Date: August 11, 2020)".

[0084] 1.4 Cloning of genes encoding rabbit monoclonal antibodies: The supernatant of the cultured B cells was identified for positive clones by ELISA coated with the antigen. After the cells of the positive clones were collected and lysed, RNA was extracted using the Quick-RNA TM Micro Prep kit (purchased from ZYMO, product number R1051) and reverse transcribed into cDNA. Using the aforementioned cDNA as a template, the naturally paired variable light chain (VL) and variable heavy chain (VH) of the rabbit antibody were amplified by PCR and sequenced. The PCR reaction system includes: 4 μL of cDNA, 1 μL of forward primer (10 mM), 1 μL of reverse primer (10 mM), 12.5 μL of 2×Gloria HiFi (from ABclonal, product number RK20717), and 6.5 μL of H 2O; The PCR amplification program includes: pre-denaturation at 98°C for 30 s, followed by 40 cycles under the conditions of 98°C for 10 s, 64°C for 30 s, and 72°C for 30 s, and finally holding at 72°C for 5 min. The obtained reaction solution was stored at 4°C. The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent the forward primer and the reverse primer, respectively.

[0085] VL-F: 5'-tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC-3' (SEQ ID NO.15);

[0086] VL-R: 5'-cacacacacgatggtgactgTTCCAGTTGCCACCTGATCAG-3' (SEQ ID NO.16);

[0087] VH-F: 5’-tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG-3’ (SEQ ID NO.17);

[0088] VH-R: 5’-gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG-3’ (SEQ ID NO.18).

[0089] The amplified DNA products were sequenced to obtain the VL sequence as shown in SEQ ID NO.2 and the VH sequence as shown in SEQ ID NO.7; then the sequence of the constant region was obtained by querying the IMGT online database (www.imgt.org), and the antibody 1A2 with the complete light chain (FL) as shown in SEQ ID NO.1 and the complete heavy chain (FH) as shown in SEQ ID NO.6 was obtained.

[0090] 1.5 Expression and large-scale production of rabbit-derived antibody 1A2: The obtained heavy chain and light chain genes of the antibody were respectively loaded on the expression vectors. In this example, the light chain constant region (CL) and the heavy chain constant region gene (CH) were pre-inserted into the mammalian expression vector pBR322, and its expression map is shown in Figure 4, In the figure, pBR322 origin and f1 origin are replication promoters, Ampcillin is a resistance gene, CMV promoter is a transcription promoter, SV40 PA terminator is a polyadenylation signal, Lightchain constant is the nucleic acid sequence of CL (left figure), and Heavy chain constant is the nucleic acid sequence of CH (right figure). Then, the amplified VL and VH genes were ligated to the expression vector pBR322 carrying the CL and CH genes, which were linearized with XbaI (955 bp) and NheI (949 bp) restriction endonucleases respectively, by homologous recombination to obtain the complete light chain (FL) and heavy chain (FH) gene expression vectors. The successful construction of the vectors was verified by sequencing.

[0091] To more conveniently purify the antibody, the antibody was secreted and expressed by adding a signal peptide upstream of the VL and VH genes. The signal peptide commonly used in the art for antibody expression can be used, such as the signal peptide "MDTRAPTQLLGLLLLWLPGARC (the encoding gene in this example is atggacacgagggcccccac tcagctgctggggctgttgctgctgtggctgcccggggctagatgc)" upstream of VL and the signal peptide "METGLRWLLLVAVLKGVQC (the encoding gene in this example is atggagactgggctgcgctggcttctcctggtcgccgtgctgaagggcgtccagtgc)" upstream of VH in the patents "Rabbit monoclonal antibody against human interferon α2 and its application (Publication No.: CN116063487A, Publication Date: May 5, 2023)" and "High-affinity Human IL-5 rabbit monoclonal antibody and its application (Publication No.: CN115819578A, Publication Date: March 21, 2023)". Of course, those skilled in the art can also replace other signal peptides for antibody expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not shown in the antibody sequence in Table 1 of this example.

[0092] The successfully constructed FL and FH expression vectors were co-transfected into 293F cells, and the cells were cultured for 72 - 96 h after transfection to obtain an antibody recognizing mouse CD56 / NCAM-1 protein in the culture supernatant. The target antibody was purified from the culture supernatant using protein A affinity gel resin (purchased from Tiandi Renhe, product number SA015100). The purity of the antibody was verified to be ≥95% using 12% polyacrylamide gel electrophoresis (SDS-PAGE). The purified antibody was aliquoted and stored at -20 °C for later use.

[0093] Establishment and Application Evaluation of an Immunodetection Method for Rabbit-derived Antibodies against Mouse CD56 / NCAM-1 Protein

[0094] 1. Establishment of the Flow Cytometry (FC) Detection Method for Antibody 1A2

[0095] The FC detection includes the following steps: 1) Disinfect the laminar flow hood with ultraviolet light for 15 - 20 min, turn on the blower for 5 min, and prepare for sterile work; 2) Collect and wash the cells, determine the total number of cells, and select cells with a viability of 90% - 95%; 3) Resuspend the cells with 1×PBS solution to about 3×10 6 -5×10 6 cells / mL, dispense the cells into a 96-well V-bottom plate at 100 μL / well, and wash once with 1×PBS; 4) Use the Zombie NIR Fixable Viability Kit (Cat. No. 423105) from Biolegend to stain the cells. Dilute the L / D staining solution with 1×PBS at a ratio of 1:1500, and dispense the diluted L / D staining solution into the well plate at 100 μL / well to resuspend the cells in the wells; 5) Wrap with aluminum foil, gently mix on a microplate shaker for 15 min, then centrifuge at 400 g for 5 min, discard the supernatant, and wash twice with FACS buffer (formula includes 1000 mL of PBS, 40 mL of FBS, and 1 mL of 0.5 M EDTA); 6) Dispense the primary antibody 1A2 diluted with PBS containing 0.5% (wt) BSA (0.5% BSA / PBS) (final concentration of the primary antibody is 2 μg / mL) into the well plate at 100 μL / well to resuspend the cells in the wells; 7) Wrap with aluminum foil, gently mix on a microplate shaker for 15 min, then centrifuge at 400 g for 5 min, discard the supernatant, and wash twice with 0.5% BSA / PBS; 8) Dispense the fluorescent secondary antibody Alexa 647 AffiniPure F(ab')2 Fragment Goat Anti-Rabbit IgG, Fc fragment specific (purchased from jackson, Cat# 111-606-046) diluted with 0.5% BSA / PBS (dilution ratio 1:600) into the well plate at 100 μL / well to resuspend the cells in the wells; 9) Repeat step 7); 10) Resuspend the cells in each well with 200 μL of 0.5% BSA / PBS and store in the dark.

[0096] Analyze according to the operation of Beckman cytoflex flow cytometer use and maintenance SOP-105-AND-CA-008. The FC detection graph of monoclonal antibody 1A2 against mouse CD56 / NCAM-1 protein is shown in Figure 5 , in which the left graph is the FC detection result of positive cells expressing CD56 / NCAM-1 protein - mouse neuroblastoma cells (Neuro-2a), and the right graph is the FC detection result of negative cells not expressing CD56 / NCAM-1 protein - mouse fibroblasts (L-929). The abscissa in the graph represents the relative fluorescence intensity, and the ordinate represents the relative cell number. The red curve is the negative control, the blue curve is the isotype control (used to eliminate background staining caused by non-specific binding of antibodies to cells), and the yellow curve is antibody 1A2. It can be seen from the graph that antibody 1A2 has an obvious fluorescence transition on positive cells Neuro-2a, but there is no transition signal on negative cells L-929, indicating that antibody 1A2 has specific and sensitive recognition and binding ability to CD56 / NCAM-1, and has no specific binding and cross-reaction with other components of cells (non-target antigens), which is beneficial to improving the specificity, sensitivity and accuracy of CD56 / NCAM-1 protein detection.

[0097] 2. Establishment of immunofluorescence (IF) detection method for antibody 1A2

[0098] Take the positive cells Neuro-2 that express CD56 / NCAM-1 protein. After washing with PBS, add 4% neutral formaldehyde fixative and fix at room temperature for 15 min. After fixation, centrifuge at 3000 rpm for 3 min, leave the cells precipitated at the bottom, discard the upper fixative, add PBS to resuspend the cells, place at room temperature for 3 min, then centrifuge at 3000 rpm for 3 min, leave the cells precipitated at the bottom, and repeat the PBS washing once. Aspirate the cell suspension and spread it on a glass slide, and observe under a microscope whether the cell density is appropriate. After the smear is made, let it dry overnight. Add TBS buffer containing 5% blank goat serum to the prepared cell smear, completely cover the aforementioned cell sample, and incubate in a 37 °C constant temperature and humidity incubator for 30 min. Remove the blocking solution, then add the working solution of antibody 1A2 prepared with TBS buffer (the dilution ratio of the primary antibody is 1:200), and incubate overnight at 4 °C; take it out and warm it to room temperature for 15 min, remove the primary antibody working solution, wash with TBST buffer, then add the fluorescent secondary antibody Cy3-conjugated Goat anti-Rabbit IgG(H+L) solution (the dilution ratio of the secondary antibody is 1:500, purchased from ABclonal, product number AS007), incubate in the dark at room temperature for 1 h, remove the secondary antibody working solution, wash with TBST buffer, add DAPI working solution to the sample, and incubate for 30 min to stain the cell nuclei; remove the DAPI working solution, wash with TBST buffer, and finally add an anti-fluorescence quenching mounting medium, and then observe and collect images under a Confocal fluorescence microscope.

[0099] The IF detection results of Neuro-2 cells are shown in Figure 6 , in which, the left figure is the fluorescence imaging of positive cells Neuro-2 bound by antibody 1A2. After antibody 1A2 binds to CD56 / NCAM-1 protein, it is labeled with the fluorescent secondary antibody as Cy3 red. The right figure is the comparison figure of using DAPI to counterstain the cell nuclei (blue) and merging the red and blue colors. It can be seen from the figure that the Neuro-2 cells labeled with 1A2 only have a red coloration around the DAPI-stained cell nuclei, and the fluorescence signal in the target area is clear and bright without background binding, indicating that CD56 is localized on the cell membrane. CD56 belongs to a transmembrane protein. It can be seen that the actual localization of antibody 1A2 in detecting CD56 is consistent with its theoretical localization, and the detection results have high credibility and good specificity.

[0100] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A rabbit antibody against mouse neural cell adhesion molecule 1, characterized in that: It comprises a light chain variable region and a heavy chain variable region, wherein the amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region are shown as SEQ ID NO.3, SEQ ID NO.4 and SEQ ID NO.5 respectively; the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown as SEQ ID NO.8, SEQ ID NO.9 and SEQ ID NO.10 respectively.

2. The rabbit antibody against mouse neural cell adhesion molecule 1 according to claim 1, characterized in that: The amino acid sequence of the light chain variable region is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

7.

3. The rabbit antibody against mouse neural cell adhesion molecule 1 according to claim 2, characterized in that: The amino acid sequence of the antibody light chain is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

6.

4. The rabbit antibody against mouse neural cell adhesion molecule 1 according to claim 1, characterized in that: The antibody is a full-length antibody or an antigen-binding region thereof; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. An antibody conjugate, characterized in that: The method comprises the rabbit antibody against mouse neural cell adhesion molecule 1 as claimed in any one of claims 1 to 4 and a detection marker connected to the antibody.

6. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the rabbit antibody against mouse neural cell adhesion molecule 1 as described in any one of claims 1 to 4.

7. The nucleic acid molecule according to claim 6, characterized in that The nucleic acid sequence of the antibody light chain variable region is shown as SEQ ID NO.12 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.14 or a sequence complementary thereto.

8. The nucleic acid molecule according to claim 7, characterized in that The nucleic acid sequence of the antibody light chain is shown as SEQ ID NO.11 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.13 or a sequence complementary thereto.

9. Use of the rabbit antibody against mouse neural cell adhesion molecule 1 according to any one of claims 1 to 4 or the antibody conjugate according to claim 5 in the preparation of a mouse neural cell adhesion molecule 1 immunoassay kit, characterized in that: The kit is selected from an enzyme-linked immunosorbent assay kit, an enzyme-linked immunospot assay kit, an immunohistochemistry kit, an immunofluorescence assay kit, an immunoblotting assay kit or a flow cytometry assay kit.

10. A mouse neural cell adhesion molecule 1 immunoassay kit, characterized in that: It comprises the rabbit antibody against mouse neural cell adhesion molecule 1 as described in any one of claims 1 to 4 or the antibody conjugate as described in claim 5.

Images