Recombinant microorganism and application thereof in production of hexamethylenediamine

By designing a recombinant microorganism that expresses a specific enzyme, the problem of converting adipic acid into hexanediamine in the prior art was solved, and efficient and green hexanediamine production was achieved, which had important industrial application value.

CN120082491APending Publication Date: 2025-06-03TSINGHUA UNIVERSITY

Patent Information

Application Number
CN202510110234.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-23
Publication Date
2025-06-03

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently convert adipic acid into hexanediamine through biological methods, which has complexity and pollution problems in the production process.

Method used

A recombinant microorganism was designed to achieve the efficient production of hexanediamine from 6-aminocaproic acid or adipic acid by expressing specific enzymes such as carboxylic acid reductase CAR variant, CAR activated enzyme sfp, putrescine aminotransferase patA, adipic acid transporters DcaK and DcaP, acyl CoA transferase DcaI and DcaJ, acylated succinate semialdehyde dehydrogenase sucD and 4-aminobutyrate aminotransferase gabT.

Benefits of technology

It realizes efficient production of hexanediamine by fermentation under normal temperature and pressure, reducing production costs, and the process is green, safe and simple.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure SMS_1
    Figure SMS_1
Patent Text Reader

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses a recombinant microorganism and application thereof in production of hexamethylenediamine. Compared with an original strain, the recombinant microorganism disclosed by the invention expresses a carboxylic acid reductase CAR variant, a CAR activating enzyme sfp and putrescine transaminase patA; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO. 28; preferably, adipic acid transporters DcaK and DcaP, acyl CoA transferases DcaI and DcaJ, an acylated succinate semialdehyde dehydrogenase sucD, and a 4-aminobutyric acid transaminase gabT are also expressed. By utilizing the recombinant microorganism, 6-aminocaproic acid / adipic acid can be efficiently converted into hexamethylenediamine, and a new method is provided for green biosynthesis of hexamethylenediamine.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and specifically, to a recombinant microorganism and its application in the production of hexamethylenediamine. Background Art

[0002] Hexamethylenediamine is an important C6 platform chemical with wide industrial application value. Hexamethylenediamine is a key monomer for high-performance polyamides such as nylon 66 and nylon 610, and the annual demand exceeds 400,000 tons. At present, the production of hexamethylenediamine is mainly through the hydrogenation of adiponitrile. However, the chemical production method has a series of drawbacks, including the difficult synthesis and toxicity of the raw material adiponitrile, the need for harsh catalytic conditions, high equipment requirements, and pollutant emission problems in the production process. Therefore, it is of great significance to develop a green and sustainable biosynthetic method for the production of hexamethylenediamine. At present, important progress has been made in the production of adipic acid by biological methods, but how to directly convert adipic acid into hexamethylenediamine still faces important challenges and it is difficult to achieve efficient biological conversion. Summary of the Invention

[0003] One of the purposes of the present invention is to provide a recombinant microorganism that can efficiently produce hexamethylenediamine.

[0004] The present invention provides a recombinant microorganism. Compared with the starting strain, the recombinant microorganism expresses a carboxylic acid reductase CAR variant, a CAR activating enzyme sfp, and a putrescine transaminase patA; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO. 28; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1; the NCBI accession number of the putrescine transaminase patA is WP_001520281.1.

[0005] Preferably, compared with the starting strain, the recombinant microorganism also expresses an adipic acid transporter DcaK and DcaP, acyl-CoA transferases DcaI and DcaJ, an acylated succinic semialdehyde dehydrogenase sucD, and a 4-aminobutyrate transaminase gabT.

[0006] Hexamethylenediamine is an important C6 platform chemical with wide industrial application. No organism in nature can directly synthesize hexamethylenediamine. The present invention creatively designs an artificial biosynthetic pathway for producing hexamethylenediamine from 6-aminohexanoic acid / adipic acid, and screens for enzymes that can catalyze this artificial pathway. By recombining this artificial biosynthetic pathway in a microorganism, the constructed recombinant microorganism can efficiently produce hexamethylenediamine using 6-aminohexanoic acid / adipic acid, which has important industrial application value.

[0007] Specifically, the present invention proposes a new combination of carboxylic acid reductase CAR variants, CAR activating enzyme sfp, and putrescine aminotransferase patA, enabling recombinant microorganisms to produce hexamethylenediamine from 6 - aminocaproic acid. Further, the present invention also proposes a new route for producing hexamethylenediamine from adipic acid. Compared with the well - studied cascade reaction of carboxylic acid reductase and transaminase, the route of the present invention utilizes an acyl - CoA - dependent pathway to effectively produce adipic semialdehyde, which is then converted into 6 - aminocaproic acid and further into hexamethylenediamine. The schematic diagram of the metabolic process is as shown in Figure 1 shown. Specifically, adipic acid is converted into adipyl - CoA under the action of adipic acid transporters DcaK, DcaP, and acyl - CoA transferases DcaI, DcaJ, and then converted into adipic semialdehyde by acylating succinic semialdehyde dehydrogenase sucD, and further into 6 - aminocaproic acid by 4 - aminobutyrate aminotransferase gabT. 6 - aminocaproic acid is converted into 6 - aminohexanal by carboxylic acid reductase CAR and then into hexamethylenediamine by putrescine aminotransferase patA.

[0008] Using the recombinant microorganisms of the present invention to produce hexamethylenediamine has low costs and can directly utilize the fermentation of recombinant microorganisms to convert 6 - aminocaproic acid / adipic acid into hexamethylenediamine under normal temperature and pressure conditions.

[0009] As a specific embodiment, when the present invention uses 6 - aminocaproic acid to ferment and produce hexamethylenediamine, the recombinant microorganisms expressing carboxylic acid reductase CAR variants, CAR activating enzyme sfp, and putrescine aminotransferase patA can be first inoculated into a culture medium for cultivation. When the OD of the bacterial cells reaches 0.6, IPTG is added for induction, and then the cultivation continues. After harvesting the cultivated recombinant microorganisms, they are used for whole - cell catalysis to produce hexamethylenediamine. The substrates for whole - cell catalysis include 6 - aminocaproic acid and glucose.

[0010] When the present invention uses adipic acid to ferment and produce hexamethylenediamine, the recombinant microorganisms expressing adipic acid transporters DcaK and DcaP, acyl - CoA transferases DcaI and DcaJ, acylating succinic semialdehyde dehydrogenase sucD, 4 - aminobutyrate aminotransferase gabT, carboxylic acid reductase CAR variants, CAR activating enzyme sfp, and putrescine aminotransferase patA are inoculated into a fermentation medium (with glucose as the carbon source) for cultivation. When the OD of the bacterial cells reaches 0.6, IPTG is added for induction, and then the fermentation continues to achieve the production of hexamethylenediamine.

[0011] In the recombinant microorganism of the present invention, the NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl-CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the 4-aminobutyrate aminotransferase gabT is WP_010984019.1.

[0012] In the recombinant microorganism of the present invention, the coding nucleic acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO.8; the coding nucleic acid sequence of the CAR activating enzyme sfp is as shown in SEQ ID NO.1; the coding nucleic acid sequence of the putrescine aminotransferase patA is as shown in SEQ ID NO.9; the coding nucleic acid sequences of the adipic acid transporters DcaK and DcaP are as shown in SEQ ID NOs.2-3 respectively; the coding nucleic acid sequences of the acyl-CoA transferases DcaI and DcaJ are as shown in SEQ ID NOs.4-5 respectively; the coding nucleic acid sequence of the acylated succinic semialdehyde dehydrogenase sucD is as shown in SEQ ID NO.6; the coding nucleic acid sequence of the 4-aminobutyrate aminotransferase gabT is as shown in SEQ ID NO.7.

[0013] In the recombinant microorganism of the present invention, the starting strain is Escherichia coli.

[0014] The present invention also provides the use of the above-mentioned recombinant microorganism in the fermentation production of hexamethylenediamine or in the microbial genetic breeding for the production of hexamethylenediamine.

[0015] The present invention also provides the use of the above-mentioned recombinant microorganism in increasing the yield of hexamethylenediamine by biological synthesis.

[0016] The present invention also provides a method for fermentatively producing hexamethylenediamine, which comprises the step of culturing the above-mentioned recombinant microorganism.

[0017] The present invention also provides a method for constructing a recombinant microorganism for producing hexamethylenediamine, which comprises the step of expressing a carboxylic acid reductase CAR variant, a CAR activating enzyme sfp and a putrescine aminotransferase patA in a starting strain; the amino acid sequence of the carboxylic acid reductase CAR variant is as shown in SEQ ID NO.28; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1; the NCBI accession number of the putrescine aminotransferase patA is WP_001520281.1.

[0018] Preferably, it further includes the steps of making the starting strain express adipic acid transporters DcaK and DcaP, acyl-CoA transferases DcaI and DcaJ, acylated succinic semialdehyde dehydrogenase sucD, and 4-aminobutyrate aminotransferase gabT; the NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and that of DcaP is WP_004926597.1; the NCBI accession number of the acyl-CoA transferase DcaI is WP_004926591.1, and that of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the 4-aminobutyrate aminotransferase gabT is WP_010984019.1; the starting strain is Escherichia coli.

[0019] The present invention also provides a carboxylic acid reductase CAR variant, the amino acid sequence of which is shown in SEQ ID NO.28.

[0020] The present invention also provides a DNA molecule encoding the above-mentioned carboxylic acid reductase CAR variant. Preferably, the nucleotide sequence is shown in SEQ ID NO.8.

[0021] The present invention also provides a biological material containing the above DNA molecule, and the biological material is an expression cassette, a vector or a host cell.

[0022] The present invention also provides the application of the above-mentioned carboxylic acid reductase CAR variant, or DNA molecule, or biological material in constructing a recombinant microorganism for producing hexamethylenediamine.

[0023] The beneficial effects of the present invention are at least as follows: The present invention provides a new recombinant microorganism, which can efficiently bioconvert 6-aminocaproic acid / adipic acid into hexamethylenediamine by fermentation. The production process is green, safe and simple, and has good market application prospects. Description of the Drawings

[0024] Figure 1 It is a schematic diagram of the metabolic process of the recombinant microorganism of the present invention for fermenting adipic acid to produce hexamethylenediamine. Detailed Embodiments

[0025] The preferred embodiments of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial sources or prepared by conventional methods in the art.

[0027] Example 1 Construction of the 6-Aminocaproic Acid to 1,6-Hexanediamine Synthesis Module The present invention uses a carboxylic acid reductase CAR variant derived from Mycobacteroides abscessus and a putrescine transaminase patA derived from Salmonella typhimurium to achieve the conversion of 6-aminocaproic acid into 1,6-hexanediamine.

[0028] According to the amino acid sequence of the carboxylic acid reductase CAR variant of Mycobacteroides abscessus (SEQ ID NO.28), an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown in SEQ ID NO.8). Using this gene fragment as a template and primers CAR-F (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.10) and CAR-R (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.11) as primers, PCR was performed to obtain a CAR fragment of approximately 3.6 kb and the PCR product was purified.

[0029] The activating enzyme gene sfp of the carboxylic acid reductase was artificially synthesized (NCBI accession number WP_003234549.1, the gene sequence is shown in SEQ ID NO.1). Using this gene fragment as a template and primers sfp-F (TTTGTTTAACTTTAAGAAGGAGATATACCATGACGGAAACTATTTCCACAGCTG, SEQ ID NO.12) and sfp-R (CTTAAGCATTATGCGGCCGCTCAAAGTAACTCCTCGTAGGAGACCATC, SEQ ID NO.13) as primers, PCR was performed to obtain an sfp fragment of approximately 0.7 kb and the PCR product was purified.

[0030] Based on the amino acid sequence of putrescine transaminase patA of Salmonella typhimurium (NCBI accession number WP_001520281.1), an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown as SEQ ID NO.9). Using this gene fragment as a template, primers patA-F (ATTAGTTAAGTATAAGAAGGAGATATACATATGAACCGCCTTCCTTCTTCAGC, SEQ ID NO.14) and patA-R (CGGCCGATATCCAATTGAGTCACACCTCTTCCACACTGACTT, SEQ ID NO.15) were used for PCR to obtain a patA fragment of approximately 1.4 kb and perform PCR purification.

[0031] Using the Gibson Assembly kit (NEB), the above-mentioned purified CAR fragment, sfp fragment, and patA fragment were ligated into pETDuet-1 in one step (the CAR and sfp fragments were linked after the first T7 promoter with RBS (AAGAAGGAGATATAC), and the patA fragment was linked after the second T7 promoter). The obtained recombinant plasmid was named pET-CAR-patA.

[0032] pET-CAR-patA was transformed into Escherichia coli BL21 (DE3) by heat transformation method, and recombinant bacteria were screened on an LB plate containing 100 mg / L ampicillin and named E.c / pET-CAR-patA. At the same time, the pETDuet-1 empty plasmid was also transformed into Escherichia coli BL21 (DE3) to obtain the control strain E.c / pET. The strains E.c / pET-CAR-patA and the control strain E.c / pET were inoculated into TB medium, and the medium components included: 12 g / L tryptone, 24 g / L yeast extract, 4 mL glycerol, 2.31 g / L KH 2 PO 4 and 12.54 g / L K 2 HPO 4 . The cells were cultured at 37°C and 200 rpm until OD 600Reached 0.6, at which point 0.5 mM IPTG was added to induce protein expression. Subsequently, the temperature was adjusted to 30 °C and the cells were cultured for an additional 10 hours. The harvested cells were collected by centrifugation, washed, and resuspended in phosphate buffer (PBS) for whole-cell catalysis. The whole-cell catalysis reaction was carried out in 10 mM PBS buffer (pH 7.2 - 7.4) at 30 °C and 200 rpm. The reaction system was supplemented with 3 g / L 6-aminocaproic acid, 10 g / L glucose, 50 mM glutamic acid, and 0.1 mM pyridoxal phosphate (PLP).

[0033] After catalysis for 24 hours, the products of the strain were detected using high-performance liquid chromatography (HPLC) and ultraviolet liquid chromatography (UV-HPLC). Strain E.c / pET-CAR-patA could produce 0.22 g / L of hexamethylenediamine, while the control strain did not produce hexamethylenediamine. This indicates that the introduced artificial pathway could successfully achieve the conversion of 6-aminocaproic acid to hexamethylenediamine.

[0034] Example 2 Construction of the adipic acid to hexamethylenediamine synthesis module Based on the amino acid sequence of the adipic acid transporter DcaK from Acinetobacter baylyi (NCBI accession number ENV54224.1), the gene nucleic acid sequence was artificially designed and optimized (the gene sequence is shown in SEQ ID NO.2). Using this gene fragment as a template, primers DcaK-F (TTTAACTTTAATAAGGAGATATACCATGCATATCCTTTCGGAAGATATTGATATGACG, SEQ ID NO.16) and DcaK-R (GAATCAATTTCTTCATGTATATCTCCTTCTTTTAGTCAGCCTTCTGGGGGTTATACA, SEQ ID NO.17) were used for PCR to obtain a DcaK fragment of approximately 1.3 kb, which was then purified by PCR.

[0035] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of adipic acid transporter DcaP of Acinetobacter baylyi (NCBI accession number: WP_004926597.1) (the gene sequence is shown in SEQ ID NO.3). Using this gene fragment as a template and primers DcaP-F (GCTGACTAAAAGAAGGAGATATACATGAAGAAATTGATTCTGGCGGTTGC, SEQ ID NO.18) and DcaP-R (CCGAGCTCGAATTTTAGAACTTGTACATTGAAACAAAGTTGATTCTCGAG, SEQ ID NO.19), PCR was performed to obtain a DcaP fragment of approximately 1.3 kb and the PCR product was purified.

[0036] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of acyl-CoA transferase DcaI of Acinetobacter baylyi (NCBI accession number: WP_004926591.1) (the gene sequence is shown in SEQ ID NO.4). Using this gene fragment as a template and primers DcaI-F (TAAGTATAAGAAGGAGATATACATATGATCAACAAAATTATTAATGACATCGAACCTATACTTAAATCG, SEQ ID NO.20) and DcaI-R (ATTGTCATGTATATCTCCTTCTTTTACTTAATATCCCCTAATCTTACCACGTGTTGA, SEQ ID NO.21), PCR was performed to obtain a DcaI fragment of approximately 0.7 kb and the PCR product was purified.

[0037] An optimized gene nucleic acid sequence was artificially designed based on the amino acid sequence of acyl-CoA transferase DcaJ of Acinetobacter baylyi (NCBI accession number: WP_004926593.1) (the gene sequence is shown in SEQ ID NO.5). Using this gene fragment as a template and primers DcaJ-F (TAGGGGATATTAAGTAAAAGAAGGAGATATACATGACAATTCAAAAGCGGTCAAGAGAG, SEQ ID NO.22) and DcaJ-R (GCCGATATCCAATTTTAGCGAAGTTGAATAAGGGATGAATATGTGC, SEQ ID NO.23), PCR was performed to obtain a DcaJ fragment of approximately 0.7 kb and the PCR product was purified.

[0038] The above-obtained DcaK fragment, DcaP fragment, DcaI fragment, and DcaJ fragment were ligated into pRSFDuet-1 in one step using the Gibson Assembly kit (NEB) (the DcaK and DcaP fragments were linked with RBS (AAGAAGGAGATATAC) after the first T7 promoter, while the DcaI and DcaJ fragments were linked with RBS (AAGAAGGAGATATAC) after the second T7 promoter), and the obtained recombinant plasmid was named pRSF-DcaKPIJ.

[0039] According to the amino acid sequence of acylated succinic semialdehyde dehydrogenase sucD of Clostridium kluyveri (NCBI accession number: WP_012103358.1), an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown in SEQ ID NO.6). Using this gene fragment as a template and primers sucD-F (TTGTTTAACTTTAATAAGGAGATATACCATGTCTAATGAGGTTTCCATAAAGGAGTTGATT, SEQ ID NO.24) and sucD-R (TGGTGATGGCTGCTTTAACCCCATATTTCCTCATAAGAAGGAACTTTTG, SEQ ID NO.25) as primers, PCR was performed to obtain a sucD fragment of approximately 1.4 kb and purified by PCR.

[0040] According to the amino acid sequence of 4-aminobutyrate aminotransferase gabT of Streptomyces avermitilis (NCBI accession number: WP_010984019.1), an optimized gene nucleic acid sequence was artificially designed (the gene sequence is shown in SEQ ID NO.7). Using this gene fragment as a template and primers gabT-F (ATCTTAGTATATTAGTTAAGTATAAGAAGGAGATATACATATGAGCGCACTTCCGCAG, SEQ ID NO.26) and gabT-R (CGGCCGATATCCAATTGAGTTAGATACGGGAGAACGCCTGC, SEQ ID NO.27) as primers, PCR was performed to obtain a gabT fragment of approximately 1.3 kb and purified by PCR.

[0041] The purified sucD fragment and gabT fragment obtained above were ligated into pCDFDuet-1 in one step using the Gibson Assembly kit (NEB) (the sucD fragment was ligated after the first T7 promoter, and the gabT fragment was ligated after the second T7 promoter), and the resulting recombinant plasmid was named pCDF-sucD-gabT.

[0042] pRSF-DcaKPIJ and pCDF-sucD-gabT were transformed into E.c / pET-CAR-patA step by step by electroporation, and recombinant bacteria were screened on LB plates containing 100 mg / L ampicillin, 100 mg / L spectinomycin, and 50 mg / L kanamycin, and named E.c / pET-CAR-patA / pRSF-DcaKPIJ / pCDF-sucD-gabT. At the same time, the empty plasmids pRSFDuet-1 and pCDFDuet-1 were also transformed into E.c / pET to obtain the control strain E.c / pET / pRSF / pCDF.

[0043] E.c / pET-CAR-patA / pRSF-DcaKPIJ / pCDF-sucD-gabT and the control strain E.c / pET / pRSF / pCDF were inoculated into the fermentation medium for cultivation. The fermentation temperature was 30 °C, and the rotation speed was 250 rpm. When the OD of the bacteria reached 0.6, 0.5 mM IPTG was added for induction, and fermentation continued for 48 h.

[0044] The fermentation medium formula was (g / L): glucose 10, ammonium dihydrogen phosphate ((NH 4 ) 2 HPO 4 ) 4, potassium dihydrogen phosphate (KH 2 PO 4 ) 6.7, magnesium sulfate heptahydrate (MgSO 4 ·7H 2 O) 0.8, yeast extract 2.5, citric acid 0.8, and 5 mL of trace metal solution. The composition of the trace metal solution included (g / L): ferrous sulfate heptahydrate (FeSO 4 ·7H 2 O) 10, calcium chloride dihydrate (CaCl 2 ·2H 2 O) 2, zinc sulfate heptahydrate (ZnSO 4 ·7H 2 O) 2.2, manganese sulfate tetrahydrate (MnSO 4 ·4H 2 O) 0.5, copper sulfate pentahydrate (CuSO 4 ·5H2 O) 1. Ammonium molybdate tetrahydrate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) 0.1 and borax (Na 2 B 4 O 7 ·10H 2 O) 0.02, adipic acid 3, glutamic acid 3.

[0045] After 48 hours of fermentation, the products of the strain were detected by high performance liquid chromatography (HPLC). The recombinant strain produced 0.56 g / L of hexamethylenediamine, and its corresponding conversion rate was 0.287 mol / mol. The control strain did not accumulate hexamethylenediamine. The specific results are shown in Table 1. It can be seen that the direct fermentation process developed by the present invention can produce hexamethylenediamine simply and efficiently, and has important industrial application prospects.

[0046] Table 1 Metabolite conditions (g / L) during the fermentation of adipic acid to produce hexamethylenediamine Although the present invention has been described in detail above with general descriptions and specific embodiments, on the basis of the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection of the present invention.

Claims

1. A recombinant microorganism, characterized in that Compared with the starting strain, the recombinant microorganism expresses a carboxylic acid reductase CAR variant, a CAR activating enzyme sfp and a putrescine transaminase patA; the amino acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.28; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1; and the NCBI accession number of the putrescine transaminase patA is WP_001520281.

1.

2. The recombinant microorganism according to claim 1, characterized in that Compared with the starting strain, the recombinant microorganism further expresses adipic acid transporters DcaK and DcaP, acyl CoA transferases DcaI and DcaJ, acylated succinic semialdehyde dehydrogenase sucD and 4-aminobutyric acid transaminase gabT; the NCBI accession number of the adipic acid transporter DcaK is ENV54224.1, and the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinic semialdehyde dehydrogenase sucD is WP_012103358.1; and the NCBI accession number of the 4-aminobutyric acid transaminase gabT is WP_010984019.

1.

3. The recombinant microorganism according to claim 2, characterized in that The encoding nucleic acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.8; the encoding nucleic acid sequence of the CAR activating enzyme sfp is shown in SEQ ID NO.1; the encoding nucleic acid sequence of the putrescine aminotransferase patA is shown in SEQ ID NO.9; the encoding nucleic acid sequences of the adipic acid transporters DcaK and DcaP are shown in SEQ ID NO.2-3, respectively; the encoding nucleic acid sequences of the acyl CoA transferases DcaI and DcaJ are shown in SEQ ID NO.4-5, respectively; the encoding nucleic acid sequence of the acylated succinic semialdehyde dehydrogenase sucD is shown in SEQ ID NO.6; the encoding nucleic acid sequence of the 4-aminobutyrate aminotransferase gabT is shown in SEQ ID NO.7; And / or, the starting strain is Escherichia coli.

4. Use of the recombinant microorganism according to any one of claims 1 to 3 in fermentation production of hexamethylenediamine, genetic breeding of microorganisms for producing hexamethylenediamine, or improving the yield of biosynthesized hexamethylenediamine.

5. A method for producing hexamethylenediamine by fermentation, characterized in that: The method comprises the step of culturing the recombinant microorganism according to any one of claims 1 to 3.

6. A method for constructing a recombinant microorganism for producing hexamethylenediamine, characterized in that: The method comprises the steps of causing the starting strain to express a carboxylic acid reductase CAR variant, a CAR activating enzyme sfp and a putrescine aminotransferase patA; the amino acid sequence of the carboxylic acid reductase CAR variant is shown in SEQ ID NO.28; the NCBI accession number of the CAR activating enzyme sfp is WP_003234549.1; the NCBI accession number of the putrescine aminotransferase patA is WP_001520281.1; preferably, the method further comprises the steps of causing the starting strain to express adipic acid transporters DcaK and DcaP, acyl CoA transferases DcaI and DcaJ, acylated succinic semialdehyde dehydrogenase sucD and 4-aminobutyric acid aminotransferase gabT; the NCBI accession number of the adipic acid transporter DcaK is ENV5422. 4.1, the NCBI accession number of DcaP is WP_004926597.1; the NCBI accession number of the acyl-CoA transferase DcaI is WP_004926591.1, and the NCBI accession number of DcaJ is WP_004926593.1; the NCBI accession number of the acylated succinate semialdehyde dehydrogenase sucD is WP_012103358.1; the NCBI accession number of the 4-aminobutyrate aminotransferase gabT is WP_010984019.1; and the starting strain is Escherichia coli.

7. A carboxylic acid reductase CAR variant, characterized in that The amino acid sequence is shown in SEQ ID NO.

28.

8. A DNA molecule encoding the carboxylic acid reductase CAR variant according to claim 7, preferably, the nucleotide sequence is as shown in SEQ ID NO.

8.

9. A biological material comprising the DNA molecule of claim 8, wherein the biological material is an expression cassette, a vector or a host cell.

10. Use of the carboxylic acid reductase CAR variant according to claim 7, or the DNA molecule according to claim 8, or the biomaterial according to claim 9 in constructing a recombinant microorganism that produces hexamethylenediamine.

Citation Information

Patent Citations

  • High impact-proof concrete-fiber composite material protective structure

    CN2618965Y

Cited By

  • Acinetobacter bainite and application thereof

    CN121825843A