An engineered probiotic and uses thereof
By overexpressing the MVA, GPPS2, and Pt1 genes in the probiotic Nissle 1917, an engineered probiotic that produces α-pinene was constructed, solving the problems of high cost and environmental pollution associated with chemical extraction of pinene and achieving efficient and safe production of α-pinene.
Patent Information
- Application Number
- CN202510247272.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-04
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-03-04
AI Technical Summary
Existing technologies for extracting pinene through chemical means are costly, complex, and polluting to the environment, making it difficult to meet the requirements of green and sustainable development.
Using the engineered probiotic Nissle 1917 as the chassis cell, an engineered probiotic that produces α-pinene was constructed by overexpressing the MVA, GPPS2, and Pt1 genes through genetic engineering, thereby increasing the yield of α-pinene through genetic engineering.
It reduces production costs, improves product safety, avoids waste of natural resources and environmental pollution, and meets the requirements of green and sustainable production.
Smart Images

Figure CN120082496B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedicine, specifically relating to an engineered probiotic and its application. Background Technology
[0002] Pinene is a naturally occurring terpene compound with the molecular formula C6H2O. 10 H 16 In nature, there are two structural isomers of pinene: α-pinene and β-pinene. α-Pinene belongs to the terpene class of compounds and is widely distributed in nature, mainly found in the peels of citrus fruits and the resins of pine trees. It has multiple uses and is widely applied in the fragrance industry, pharmaceuticals, and fine chemicals. Furthermore, due to its unique structure, it also holds promise as a raw material for high-density renewable fuels. Currently, the main method for industrially extracting pinene is to extract turpentine oil from coniferous plants, and then extract pinene from the turpentine oil through methods such as distillation and vacuum distillation. Although my country has a rich variety and wide distribution of coniferous and cypress plant resources, extracting pinene through chemical means is expensive, complex, wasteful of resources, and causes significant environmental pollution, failing to meet the requirements of today's green and sustainable development. With the development of microbial engineering and metabolic engineering, the production of pinene through biosynthesis is expected to become an alternative to chemical synthesis in the future. Summary of the Invention
[0003] To overcome the shortcomings of existing technologies, this invention provides an engineered probiotic and its application.
[0004] To achieve the above objectives, the present invention adopts the following technical solution:
[0005] The first aspect of the present invention provides an engineered probiotic that produces α-pinene, which is deposited at the China General Microbiological Culture Collection Center with accession number CGMCC No. 33170.
[0006] A second aspect of the invention provides a culture comprising the engineered probiotics described in the first aspect of the invention.
[0007] A third aspect of the present invention provides a product comprising the engineered probiotics described in the first aspect of the present invention or the cultures described in the second aspect of the present invention.
[0008] A fourth aspect of the present invention provides a method for constructing an engineered probiotic that produces α-pinene, the method comprising using Escherichia coli as a chassis cell and overexpressing the MVA gene, GPPS2 gene and Pt1 gene in the Escherichia coli cell.
[0009] Furthermore, the GPPS2 gene is obtained by truncating the GPPS2 protein and then optimizing its codons.
[0010] Furthermore, the truncation refers to truncating the first 84 amino acids at the N-terminus of the GPPS2 protein.
[0011] Furthermore, the sequence of the GPPS2 gene is shown in SEQ ID NO:1.
[0012] Furthermore, the Pt1 gene is obtained by truncating and mutating the Pt1 protein and then optimizing its codons.
[0013] Furthermore, the truncation refers to truncating the first 48 amino acids from the N-terminus of the Pt1 protein.
[0014] Furthermore, the mutation involves replacing the 457th amino acid in the Pt1 protein, glutamine, with leucine.
[0015] Furthermore, the plasmid used for overexpressing the GPPS2 and Pt1 genes was pUC57.
[0016] Furthermore, the plasmid used for overexpressing the MVA gene was pJBEI-6410.
[0017] Furthermore, the sequence of the Pt1 gene is shown in SEQ ID NO:2.
[0018] Furthermore, the Escherichia coli is Escherichia coli Nissle 1917.
[0019] Furthermore, the method also includes transforming plasmids overexpressing the MVA gene, GPPS2 gene, and Pt1 gene into Escherichia coli competent cells.
[0020] Furthermore, the Escherichia coli competent cells are EcNΔpMUT1 competent cells.
[0021] Furthermore, the conversion method is electrical shock conversion.
[0022] The fifth aspect of the invention provides the application of the method described in the fourth aspect of the invention in the construction of engineered probiotics that produce α-pinene.
[0023] The sixth aspect of the present invention provides a method for producing α-pinene, the method comprising culturing the engineered probiotics described in the first aspect of the present invention, the culture described in the second aspect of the present invention, the product described in the third aspect of the present invention, or the engineered probiotics prepared by the method described in the fourth aspect of the present invention.
[0024] Furthermore, the culture medium used for cultivation includes glucose and glycerol.
[0025] Furthermore, the culture medium components also include tryptone, yeast extract, dipotassium hydrogen phosphate, and potassium dihydrogen phosphate.
[0026] The seventh aspect of the present invention provides the application of the engineered probiotics described in the first aspect of the present invention, the culture described in the second aspect of the present invention, the product described in the third aspect of the present invention, or the engineered probiotics prepared by the method described in the fourth aspect of the present invention in the production of α-pinene.
[0027] Preservation information of biological materials:
[0028] Suggested classification and nomenclature: Escherichia coli
[0029] Preservation Institution: China General Microbiological Culture Collection Center (CGMCC)
[0030] Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing Date of Deposit: December 23, 2024
[0031] Accession number: CGMCC No. 33170
[0032] Advantages and beneficial effects of the present invention:
[0033] This application is the first to synthesize α-pinene using the probiotic Nissle 1917 (ECN) as a chassis cell, and improves the yield of α-pinene through genetic engineering and other means, providing more feasible and high-yield chassis cells for α-pinene synthesis. Furthermore, compared with industrial preparation of α-pinene, the use of probiotic Nissle 1917 (ECN) to synthesize α-pinene reduces production costs, improves product safety, avoids waste of natural resources and environmental pollution, and meets the current requirements of green and sustainable production, thus possessing broad application prospects. Attached Figure Description
[0034] Figure 1 This is a diagram of the pJBEI-6410-MVA plasmid;
[0035] Figure 2 It is pUCP20-tac-trAgGPPS-PtPS1 Q457L Plasmid mapping;
[0036] Figure 3 This is a diagram showing the results of pgi gene knockout;
[0037] Figure 4 It is a pMUT1-tac-edd-eda graph;
[0038] Figure 5 This is a graph showing the qualitative analysis results of α-pinene standard by GC-MS.
[0039] Figure 6 This is a graph showing the qualitative analysis results of the sample using GC-MS.
[0040] Figure 7 This is a graph showing the yield results of α-pinene. Detailed Implementation
[0041] The following provides definitions for some of the terms used in this specification. Unless otherwise stated, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.
[0042] This invention provides an engineered probiotic that produces α-pinene, which is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 33170.
[0043] In some embodiments, engineered probiotics are probiotics that have been modified through artificial gene recombination or other technical means to improve characteristics such as tolerance, bioactivity, and strain specificity. This application uses the probiotic Nissle 1917 (ECN) as a chassis cell to synthesize α-pinene and increases the yield of α-pinene through genetic engineering and other means.
[0044] The present invention provides a culture comprising the above-described engineered probiotics.
[0045] In some embodiments, the culture is preferably an isolated or substantially purified culture. An isolated or substantially purified culture refers to a culture of the engineered probiotics of this application that does not contain significant amounts of other substances typically found in the natural habitats from which the engineered probiotics grow and / or are typically obtained. Therefore, such isolated or substantially purified cultures are at least 60% free, preferably at least 75% free, more preferably at least 90% free, even more preferably at least 95% free, and most preferably at least 99% free of other substances typically found in the natural habitats from which the engineered probiotics grow and / or are typically obtained. Such isolated or substantially purified cultures generally do not contain any other probiotics in amounts sufficient to interfere with the replication of the engineered probiotics of this application.
[0046] This invention provides a method for constructing an engineered probiotic that produces α-pinene, the method comprising using Escherichia coli as a chassis cell and overexpressing the MVA gene, GPPS2 gene and Pt1 gene in Escherichia coli cells.
[0047] In some embodiments, the plasmids used for overexpressing the MVA gene, GPPS2 gene, and Pt1 gene can be any suitable plasmid known in the art, including but not limited to pUC57, pJBEI-6410, pcDNA3.1+ / -, pcDNA4 / HisMax B, pSecTag2 A, pVAX1, pBudCE4.1, pTracer CMV2, pcDNA3.1(-) / myc-HisA, pcDNA6-Myc / His B, pCEP4, pIRES, pIRESneo, pIRES hyg3, pCMV-myc, pCMV-HA, pIRES-puro3, pIRES-neo3, pCAGGS, pSilencer1.0, pSilencer2.1-U6 hygro, pSilencer3.1-H1hygro, pSilencer3.1-H1neo, and pSilencer4.1-CMV neo.
[0048] In a specific implementation, the plasmid used for overexpressing the GPPS2 and Pt1 genes is pUC57; the plasmid used for overexpressing the MVA gene is pJBEI-6410.
[0049] The method also includes transforming plasmids overexpressing the MVA gene, GPPS2 gene, and Pt1 gene into competent E. coli cells.
[0050] In some implementations, the methods used to transform plasmids into competent E. coli cells include, but are not limited to, electroporation, heat shock (CaCl2 method), and RbCl (KCl method).
[0051] In a specific implementation, the method used to transform the plasmid into competent E. coli cells is selected from electroporation transformation.
[0052] The competent E. coli cells were EcNΔpMUT1 competent cells.
[0053] In some embodiments, the EcNΔpMUT1 competent cell is a genetically engineered Escherichia coli Nissle 1917 (EcN) strain, where ΔpMUT1 indicates that the strain lacks the pMUT1 plasmid or related gene fragment.
[0054] The invention is further illustrated below with reference to specific embodiments. It should be understood that the specific embodiments described herein are by way of example and are not intended to limit the invention. The main features of the invention can be used in various embodiments without departing from the scope of the invention.
[0055] Example 1
[0056] 1. Experimental materials
[0057] pJBEI-6410 plasmid: purchased from Addgene, Inc., USA, catalog number: 47049.
[0058] pUCP20-tac(Gm R Plasmid: preserved in this laboratory.
[0059] EcNΔpMUT1 engineered strain: prepared using the method described in Anton K, Ilia G, Sivaram E, et al. Plasmid Vectors for in Vivo Selection-Free Use with the Probiotic E.coli Nissle 1917.[J].ACSsynthetic biology, 2020, 10, and preserved in our laboratory.
[0060] 2. Experimental Methods and Results
[0061] 1.1 Cloning of exogenous genes and construction of heterologous synthesis pathways
[0062] 1.1.1 Cloning of exogenous genes
[0063] The geranium diphosphate synthase GPPS2 (GenBank No. AF513112.1) from North American fir (Abies grandis) was truncated by shortening the first 84 amino acids from the N-terminus, and its truncated sequence was codon-optimized (trAgGPPS). The pinene synthase Pt1 (GenBank No. AF543527.1) from slash pine (Pinus taeda) was truncated by shortening the first 48 amino acids from the N-terminus, and the 457th amino acid, glutamine, was mutated to leucine. Its gene sequence was then codon-optimized (PtPS1). Q457L ). Optimized GPP synthase gene (trAgGPPS) and pinene synthase gene (PtPS1) Q457L The samples were synthesized at the Nanjing Gene Synthesis Base of Qingke Biotechnology and ligated into the vector pUC57 to form pUC57-trAgGPPS and pUC57-PtPS1, respectively. Q457L Vector. The nucleotide sequence of the truncated and optimized GPP synthase gene trGPPS is shown in SEQ ID NO:1, and the truncated and optimized pinene synthase gene PtPS1 is also shown. Q457L The nucleotide sequence is shown in SEQ ID NO:2.
[0064] atggaatttgacttcaacaaatacatggactccaaagcgatgacggtaaatgaagcactgaacaaagcgatccctctgcgttatccgcagaaaatctacgaaagcatgcgttacagcctgctggcaggcggcaagcgtgttcgtccggttctgtgtattgccgcatgtgaactggtaggtggtaccgaagaactggcgatcccgaccgcgtgcgcaattgaaatgatccacacgatgtccctgatgcacgatgatctgccgtgtatcgacaacgacgatctgcgtcgcggtaaaccgactaaccacaaaattttcggtgaggataccgcagtgactgctggtaacgcactgcactcttacgccttcgagcatatcgcggtttctacttctaaaaccgttggtgctgaccgcatcctgcgtatggtgtccgagctgggtcgtgctactggctctgaaggtgttatgggtggtcagatggtagacatcgcatccgaaggcgatccgtctatcgacctgcagaccctggaatggattcacatccacaaaaccgcaatgctgctggaatgctccgttgtttgcggtgcaatcattggcggtgccagcgaaatcgtaatcgaacgtgcccgtcgctacgcccgctgtgttggtctgctgttccaggtagttgatgacattctggacgtaactaaaagcagcgacgaactgggtaagactgcgggcaaggacctgatctctgataaagccacctacccaaagctgatgggtctggaaaaggccaaggagttctccgatgaactgctgaaccgtgcgaagggtgaactgtcctgcttcgacccagttaaagccgctccgctgctgggcctggcagactacgtggcatttcgtcagaattaa(SEQ ID NO:1)。
[0065]
[0066] 1.1.2 Construction of Heterogeneous MVA Synthesis Pathway
[0067] 1.1.2.1 Construction of the pJBEI-6410-MVA vector
[0068] The location located at pUCP20-tac(Gm) R A sequence containing restriction enzyme sites (including BamHI and XbalI) on the pUCP20 gene was synthesized using primers (sequences: pUCP20-tac-short-F: 5'-CGGGGATCCTCTAGAGTCGA-3', SEQ ID NO: 3; pUCP20-tac-short-R: 5'-TCGATCGACTCTAGAGGATCCCCGGTAC-3', SEQ ID NO: 4). The synthesized product was phosphorylated and annealed. The plasmid pJBEI-6410 (purchased from Addgene, USA) was double-digested with KpnI and XhoI, respectively. The vector and the phosphorylated / annealed product were then ligated at a molar ratio of 1:3 at 22°C for 4 hours or overnight at 16°C. The ligation product was transformed into commercially available competent E. coli DH5α cells, and after recovery at 37°C for 1 hour, it was plated onto a substrate containing 100 μg / mL of [resource name missing]. -1 Carbenicillin was used to screen positive clones using LB agar plates. Recombinant plasmid pJBEI-6410-MVA was extracted from the positive clones and then identified by restriction enzyme digestion and sequencing. The diagram of the constructed vector is shown below. Figure 1 As shown.
[0069] 1.1.2.2pUCP20-tac-trAgGPPS-PtPS1 Q457L Carrier construction
[0070] trAgGPPS and PtPS1 were amplified by PCR. Q457L Two exogenous fragments were obtained and then ligated using overlap PCR amplification. The vector pUCP20-tac(Gm) was used. R ) and exogenous fragment trAgGPPS-PtPS1 Q457L Double digestion with EcoRI and SalI was performed, with the vector and exogenous fragment in a molar ratio of 1:3. Ligation was carried out at 22°C for 4 hours or at 16°C overnight. The ligation product was transformed into commercially available competent E. coli DH5α cells, and after recovery at 37°C for 1 hour, it was plated on a substrate containing 10 μg / mL of enzyme. -1 Gentamicin LB agar plates were used for PCR screening of positive clones, and recombinant plasmids were extracted from the positive clones.
[0071] pUCP20-tac-trAgGPPS-PtPS1Q457L Then, it is identified by restriction enzyme digestion and sequencing. The map of the constructed vector is shown below. Figure 2 As shown.
[0072] Primer sequence for amplifying the trGPPS gene 5' (SEQ ID NO:5): 5'-ATTGAATTCATGGAATTTGACTTCAAC-3'.
[0073] Primer sequence for amplifying the trGPPS gene 3' (SEQ ID NO:6): 5'-CATGCTGGCCATGTATATCTCCTTCTTAAAAGATCCTTAATTCTGACG-3'.
[0074] Amplification of PtPS1 Q457L Gene 5' primer sequence (SEQ ID NO:7): 5'-CGTCAGAATTAAGGATCTTTTAAGAAGGAGATATACATGGCCAGCATG-3'.
[0075] Amplification of PtPS1 Q457L 3' primer sequence (SEQ ID NO:8): 5'-ATTGTCGACTCAAAGGGTCACC-3'.
[0076] 1.2 Construction of recombinant strains
[0077] The above pJBEI-6410-MVA and pUCP20-tac-trAgGPPS-PtPS1 Q457L The two recombinant plasmids were co-transformed into EcNΔpMUT1 competent cells prepared by the glycerol method and plated on cells treated with 100 μg / mL solution. -1 Carbenicillin and 10 μg·mL -1 LB agar plates containing gentamicin were used to screen positive clones by PCR, thereby obtaining clones containing pJBEI-6410-MVA and pUCP20-tac-trAgGPPS-PtPS1. Q457L The engineered strain ET-1 with two recombinant plasmids.
[0078] Example 2
[0079] 1. Experimental materials
[0080] pMUT1-tac plasmid: preserved in our laboratory.
[0081] EcNΔpMUT1 engineered strain: prepared using the method described in Anton K, Ilia G, Sivaram E, et al. Plasmid Vectors for in Vivo Selection-Free Use with the Probiotic E.coli Nissle 1917.[J].ACSsynthetic biology, 2020, 10, and preserved in our laboratory.
[0082] 2. Experimental Methods and Results
[0083] 2.1 Construction of knockout strains
[0084] The knockout strain EcNΔpMUT1Δpgi was constructed using λ-Red homologous recombination technology.
[0085] 2.1.1 Obtaining the Knockout Fragment
[0086] Add homologous arms of approximately 40 bp each upstream and downstream of the target gene CDS to both ends of a universal primer. Using pKD3 plasmid as a template, amplify the sequence by PCR, which consists of the upstream homologous arm + reverse enzyme recognition site FRT + resistance gene expression element + reverse enzyme recognition site FRT + lower homologous arm. Then, add another approximately 40 bp homologous arms to both sides of the above sequence and amplify again. The amplified fragment must be of high purity and free of impurities.
[0087] Universal primer P1 sequence (SEQ ID NO:9): 5'-GTGTAGGCTGGAGCTGCT-3'.
[0088] Universal primer P2 sequence (SEQ ID NO:10): 5'-ATGGGAATTAGCCATGGT-3'.
[0089] Taking the target gene pgi as an example, the specific primer design is as follows:
[0090] EcN-λred-pgi-F1:
[0091] 5'-TGCGGCGTGAACGCCTTATCCGGCCTACATATCGACAATGAGTGTAGGCT GGAGCTGCT-3' (SEQ ID NO: 11).
[0092] EcN-λred-pgi-R1:
[0093] 5'-CTTCCAAAGTCACAATTCTCAAAATCAGAAGAGTATTGCTAATGGGAATT AGCCATGGT-3' (SEQ ID NO: 12).
[0094] EcN-λred-pgi-F2:
[0095] 5'-GATAAGACCGCGACCGCGTCGCATCAGGCATCGGTTGCCGGATGCGGCGTGAACGCCTTA-3' (SEQ ID NO: 13).
[0096] EcN-λred-pgi-R2:
[0097] 5'-GCACTAAAACCATCACATTTTCTGTGACTGGCGCTACAATCTTCCAAAGTCACAATTC-3' (SEQ ID NO: 14).
[0098] 2.1.2 Obtaining the knockout strain containing the pKD46 plasmid
[0099] EcNΔpMUT1 competent cells were prepared using the glycerol method. The pKD46 plasmid was electroporated into EcNΔpMUT1 competent cells, and the cells were incubated at 30°C for 1 h. The cells were then plated onto 100 μg / mL... -1 The pKD46 plasmid-containing strain can be obtained by incubating carbenicillin on LB solid plates overnight at 30°C.
[0100] 2.1.3 Transferring the amplified fragment
[0101] EcNΔpMUT1 / pKD46 competent cells were prepared using the glycerol method. The amplified knockout fragment was transformed into EcNΔpMUT1 / pKD46 competent cells by electroporation. Immediately after electroporation, 500 μL of LB liquid medium containing 0.2%–0.5% arabinose was added, and the cells were incubated overnight at 30°C. 100–200 μL of the culture was then spread onto a 25 μg / mL plate. -1 Chloramphenicol was cultured overnight at 37°C on LB agar plates. Positive clones were screened by PCR, with the EcN genome serving as a control, and the size of the PCR products from the knockout strains was compared. The knockout results are shown in the figure below. Figure 3 (M: DNA marker; ck: control group, pgi gene band not knocked out; 1-4: pgi gene band knocked out).
[0102] 2.1.4 Eliminating resistance
[0103] Knockout competent cells were prepared using the glycerol method. The pCP20 plasmid was electroporated into knockout competent cells, and the cells were incubated at 30°C for 1-2 hours before being plated on 100 μg / mL plasmid. -1 Carbenicillin was cultured overnight at 30°C on LB agar plates, purified, and then cultured again overnight at 30°C. Single colonies were then picked and transferred to LB agar plates, followed by overnight culture at 42°C to eliminate the pCP20 plasmid. Single colonies were picked on plates containing 100 μg / mL of carbenicillin. -1 Carbenicillin resistance plates, with 25 μg / mL added. -1 The pCP20 plasmid and whether resistance was eliminated were verified on chloramphenicol resistance plates and LB non-resistance plates.
[0104] 2.2 Construction of overexpression vectors
[0105] Using the EcN genome as a template, the edd and eda gene fragments were simultaneously amplified by PCR. Then, the vector pMUT1-tac and the edd-eda fragment were double-digested with EcoRI and BamHI, respectively, at a molar ratio of 1:3. Ligation was performed at 22°C for 4 hours or at 16°C overnight. The ligation products were transformed into commercially available competent E. coli DH5α cells, and after recovery at 37°C for 1 hour, plated onto substrates containing 50 μg / mL of [resource name missing]. -1 Kanamycin was used to screen positive clones using PCR on LB agar plates. The recombinant plasmid pMUT1-tac-edd-eda was extracted from the positive clones and then identified by restriction enzyme digestion and sequencing. The nucleotide sequence of the constructed vector is shown in SEQ ID NO:15, and the chromatogram is shown below. Figure 4 As shown.
[0106] Amplification of the edd-eda gene 5' primer sequence (SEQ ID NO:16): 5'-ATTGAATTCATGAATCCACAATTGTTA-3'.
[0107] Primer sequence for amplifying the edd-eda gene 3' (SEQ ID NO:17): 5'-ATTGGATCCTTACAGCTTAGCGCCTTC-3'.
[0108] 2.3 Construction of recombinant strains
[0109] The pJBEI-6410-MVA and pUCP20-tac-trAgGPPS-PtPS1 from Experiment 1 were used. Q457L EcNΔpMUT1Δpgi competent cells prepared by electroporation transformation of two recombinant plasmids with glycerol were plated on cells containing 100 μg / mL of glycerol. -1 Carbenicillin and 10 μg·mL -1LB agar plates containing gentamicin were used to screen positive clones by PCR, thereby obtaining clones containing pJBEI-6410-MVA and pUCP20-tac-trAgGPPS-PtPS1. Q457L The engineered strain ET-2 with two recombinant plasmids.
[0110] The above pMUT1-tac-edd-eda recombinant plasmid was electroporated into competent cells of the engineered strain ET-2 prepared by the glycerol method, and then plated onto cells containing 100 μg / mL of the plasmid. -1 Carbenicillin, 10 μg / mL -1 Gentamicin and 50 μg·mL -1 LB agar plates containing kanamycin were used to screen for positive clones by PCR, thereby obtaining clones containing pJBEI-6410-MVA and pUCP20-tac-trAgGPPS-PtPS1. Q457L And the engineered strain ET-3 with the three recombinant plasmids pMUT1-tac-edd-eda.
[0111] Example 3
[0112] 1. Experimental materials
[0113] Fermentation medium (1L): glucose 20g, glycerol 20ml, tryptone 12g, yeast extract 24g, dipotassium hydrogen phosphate 9.4g, potassium dihydrogen phosphate 2.2g.
[0114] α-Pinene standard: purchased from Chengdu Dester Biotechnology Co., Ltd., item number: DP0022-0100.
[0115] 2. Experimental Methods and Results
[0116] 3.1 Cultivation of engineered strains
[0117] The engineered strain, cultured overnight at 37°C, was transferred 1:100 to fermentation medium containing an appropriate amount of antibiotics and cultured with shaking at 37°C and 220 rpm. When OD... 600nm When the concentration is 0.8-1.0, add the inducing agent IPTG to a final concentration of 1 mmol·L⁻¹. -1 The culture medium was coated with 2% (v / v) dodecane and then cultured at 30°C and 220 rpm for 72 h with shaking. The culture medium was transferred to a 50 mL centrifuge tube and centrifuged at 8000 rpm for 5 min. The upper organic phase was transferred to a new 2 mL centrifuge tube and centrifuged at 12,000 rpm for 2 min. 500 μL of the upper organic phase was then transferred to a new 2 mL centrifuge tube, and 500 μL of ethyl acetate was added. The mixture was then vortexed at high speed to mix. The tube was sealed with sealing film and temporarily stored at 4°C. Qualitative and quantitative analysis was performed using GC-MS.
[0118] 3.2 Qualitative Detection by GC-MS
[0119] The Shimadzu GC-MS-TQ8040 system was used for detection, with a SH-Rxi-5Sil MS column (30m × 0.25mm × 0.25μm). GC-MS conditions: splitless injection, injection volume 1μL, carrier gas flow rate 1.2mL / min. Temperature program: injection port temperature 60℃, hold for 2 min; increase to 150℃ at 6℃ / min, hold for 4 min; then increase to 230℃ at 20℃ / min, run for 1 min. Injection port temperature and ion source temperature were both 230℃. Q3 scan acquisition mode, solvent delay time 3 min. GC-MS qualitative results are as follows: Figure 5 (The top image is the TIC chromatogram, with a retention time of 5.57 min for the standard; the bottom image is the standard chromatogram.) Figure 6 (The top image is the TIC chromatogram, with a sample retention time of 5.61 min; the bottom image is the sample mass spectrum.)
[0120] 3.3 GC-MS Quantitative Detection
[0121] The chromatographic analysis was performed using a Shimadzu GC-MS-TQ8040 system with an SH-Rxi-5Sil MS column (30m × 0.25mm × 0.25μm). GC-MS determination conditions were the same as above, with SIM acquisition mode and a solvent delay time of 3 min. The pinene content in the sample was calculated based on a standard curve plotted using the concentration gradient of α-pinene standards. The quantitative analysis results are shown in the figure below. Figure 7 As shown, strain ET-1 had the highest pinene production, at 888.51 mg / L.
[0122] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.
Claims
1. An engineered probiotic that produces α-pinene, characterized in that, It is deposited at the China General Microbiological Culture Collection Center, with accession number CGMCC No. 33170.
2. A method for producing α-pinene, characterized in that, The method includes culturing the engineered probiotics as described in claim 1.
3. The method according to claim 2, characterized in that, The culture medium used for cultivation includes glucose and glycerol.
4. The method according to claim 3, characterized in that, The culture medium also includes tryptone, yeast extract, dipotassium hydrogen phosphate, and potassium dihydrogen phosphate.
5. The application of the engineered probiotics according to claim 1 in the production of α-pinene.