Application of CaFtsH8 metalloproteinase gene of capsicum in leaf development in seedling stage of capsicum

Abstract

The invention belongs to the field of plant genetic engineering, and discloses application of a CaFtsH8 metalloproteinase gene of pepper in leaf development in the seedling stage of pepper. The full-length CDS sequence of the capsicum CaFtsH8 gene is as shown in SEQ ID NO: 1, and a high-specificity segment selected from gene silencing VIGS is as shown in SEQ ID NO: 2. After the CaFtsH8 gene is silenced in a pepper inbred line material Z14, a silenced single plant has an obvious euphylla whitening phenotype, and chloroplast development and photosynthesis are obviously blocked, which indicates that the gene is very important for normal development of pepper in a seedling stage, so that the gene can be applied to molecular design breeding of pepper and has a wide application prospect. Normal growth and development of the pepper in the seedling stage are guaranteed through genotype selection.

Description

Technical Field

[0001] The present invention relates to the field of plant genetic engineering, and specifically to the application of the Capsicum annuum CaFtsH8 metalloprotease gene in the leaf development of Capsicum annuum seedlings. Background Art

[0002] Pepper is the vegetable with the largest cultivation area in China. It can be eaten fresh, processed into food and condiments, and can also be used as raw materials in aspects such as medicine, chemical industry, and military industry. It has a wide range of uses and great development potential, and is one of the economic crops with good development prospects in the world. According to statistics, China is the world's largest producer and consumer of peppers (including sweet peppers), with a sown area accounting for about 40% of the world's pepper sown area, a planting area exceeding 32 million mu, accounting for about 12% of the vegetable planting area. Chloroplasts, as the nutritional source for plant autotrophic growth, are also important factors affecting crop organic matter accumulation and yield composition. The excavation of genes related to pepper seedling leaf development helps to further understand the pepper chloroplast development mechanism and photosynthetic regulation network, and lay a foundation for the improvement of photosynthetic efficiency and high photosynthetic efficiency breeding.

[0003] The light reaction stage of plant photosynthesis is mainly completed on the thylakoid membrane, and there are mainly four complexes on the thylakoid membrane: PS I, ATP synthase, PS II, and cytochrome b6 / f. PS II is mainly composed of the light-harvesting complex (LHC II), D1 (PsbA), D2 (PsbD), CP43 (PsbC), CP47 (PsbB), and other subunits. Light energy is absorbed at the reaction center of the PS II complex, but at the same time, it will cause inevitable photodamage to the PSII complex. The main target of this photodamage is the D1 protein in PSII. Therefore, photosynthetic organisms have gradually formed an effective mechanism for the PSII repair cycle to selectively and rapidly degrade the damaged D1, synthesize and assemble new D1 proteins. This process is essential for the photosynthetic system and normal growth and development of higher plants. Among them, Deg and FtsH proteases jointly complete the selective degradation of the photodamaged D1 protein, and the FtsH protease plays a core role in this process, and it can even complete the degradation process of D1 alone.

[0004] FtsH proteases are widely present in both eukaryotes and prokaryotes and are key enzymes for degrading damaged D1 proteins under light and temperature stress. The hydrolysis of D1 protein by FtsH protease also undergoes a series of processes: FtsH is anchored to the cell membrane under the action of the N-terminal transmembrane domain, and its ATP-binding module faces the cell membrane. FtsH protease pulls the substrate out of the membrane in an ATP-dependent manner and degrades it into small peptides in the proteolytic chamber. The substrate enters the degradation chamber through a narrow pore, and the opening and closing of the pore are achieved through the conformational rearrangement of the FtsH protein. The whole process is powered by the chemical energy of ATP. There are multiple FtsH proteins in plants and they degrade substrates in the form of heterohexameric complexes. Previous studies have shown that the simultaneous inactivation of FtsH8 and FtsH2 proteins in Arabidopsis thaliana will affect the composition of the heterohexameric complex and produce a lethal phenotype.

[0005] The applicant has completed the identification of members of the pepper FtsH gene family. There are 18 members in this gene family in pepper, and 12 of them have hydrolytic activity and a conserved HEXXH motif. Phylogenetic tree analysis found that there is no homologous gene of FtsH2 in Solanaceae species, and the only existing FtsH8 gene is crucial for the survival of Solanaceae plants. After silencing the CaFtsH8 gene in the pepper inbred line Z14 using the VIGS technique, the seedlings of the silenced plants showed the phenotype of albino true leaves, and chloroplast development and photosynthesis were severely blocked. At present, the related function of this gene in pepper leaf development has not been reported, and it can be used as a functional gene in pepper molecular design breeding to improve the survival rate of pepper seedlings through genotype selection. Summary of the Invention

[0006] The main object of the present invention is to provide the application of the pepper CaFtsH8 metalloprotease gene in the leaf development of pepper seedlings. The CDS sequence of the pepper CaFtsH8 gene is shown as SEQ ID NO.1, and the gene of the present invention can be used for pepper. Through experiments such as transient transformation of pepper material Z14 and transmission electron microscopy, it is confirmed that CaFtsH8 is mainly involved in maintaining chloroplast function and photosynthesis and directly affects the normal development of pepper seedling leaves.

[0007] The present invention belongs to the field of plant genetic engineering and discloses the application of the pepper CaFtsH8 metalloprotease gene in the leaf development of pepper seedlings. The full-length CDS sequence of the pepper CaFtsH8 gene is shown as SEQ ID NO:1, and the highly specific fragment selected for gene silencing VIGS is shown as SEQ ID NO:2. After silencing the CaFtsH8 gene in the pepper inbred line material Z14, it is found that the silenced plants show obvious leaf albino phenotypes and chloroplast development and photosynthesis are significantly blocked, indicating that this gene is very important for the leaf development of pepper seedlings. Therefore, the present invention has potential application prospects in pepper molecular design breeding and high photosynthetic efficiency breeding.

[0008] To achieve the above object, the present invention adopts the following technical measures:

[0009] Application of the pepper CaFtsH8 gene in maintaining the development of pepper chloroplasts, leaf morphology and normal survival, including using conventional methods in the art to insert the pepper CaFtsH8 fragment into a recombinant virus to inhibit the expression of the endogenous CaFtsH8 gene in the pepper material Z14, thereby obtaining silenced single plants with albino leaves, only containing a very small number of abnormally developed chloroplasts and blocked photosynthesis. Therefore, this gene can be used for molecular design breeding of peppers to ensure the normal growth and development of peppers through genotype selection. The CDS sequence of the said gene is shown as SEQ ID NO.1.

[0010] Compared with the prior art, the present invention has the following advantages:

[0011] The present invention discloses for the first time the application of the pepper CaFtsH8 gene in maintaining the development of pepper chloroplasts, leaf morphology and normal survival. The VIGS silencing results in peppers confirm that the gene silencing of CaFtsH8 directly leads to albino leaves and a significant reduction or even disappearance of the number of chloroplasts. The experimental results of the present invention show that the expression level of the CaFtsH8 gene is closely related to the leaf morphology and chloroplast development of peppers, and can be applied to molecular design breeding of peppers to ensure the normal growth and development of seedlings. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following will briefly introduce the drawings required for the description of the embodiments.

[0013] Figure 1 For the phenotypic determination results of the CaFtsH8 gene VIGS silenced single plants and the control;

[0014] Figure 2 For the transmission electron microscopy and expression level results of the CaFtsH8 gene VIGS silenced single plants and the control;

[0015] Figures (A) and (B) are the transmission electron microscopy results of the CaFtsH8 gene VIGS silenced single plants and the control. S represents starch grains, CP represents chloroplasts, TM represents thylakoid membranes, scale bar: (A) 60um, (B) 6um. Figure (C) is the detection result of the relative expression level of the CaFtsH8 gene in the silenced single plants and the negative control. The data are the mean ± SD of at least 3 biological replicates, and ** indicates a significant difference at the <0.01 level. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0016] The technical solutions of the present invention will be clearly and completely described below in conjunction with the accompanying drawings of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without making creative efforts fall within the scope of protection of the present invention.

[0017] Example 1: Cloning of Chili Gene Fragment

[0018] Using the genomic cDNA of Capsicum annuum L. Z14 as a template, a 250-bp fragment of the CaFtsH8 gene was amplified by PCR. The forward primer was CaFstH8-VIGS-2F:

[0019] 5’-ctagatgaggagaagagcccATGGCTACTTCATCAGTATGC-3’, and the reverse primer was CaFstH8-VIGS-2R: 5’-tgtgctcgacgacaagacccCTTTTCCATTACCTAACAAAGC-3’. Finally, the nucleotide sequence shown in SEQ ID NO:2 was obtained.

[0020] In the above scheme, in order to achieve ligation with the vector, SmaⅠ single-enzyme digestion sites and corresponding protection bases were added to the 5’ ends of the forward and reverse primers respectively.

[0021] Example 2: Construction of Recombinant Vector

[0022] After single-enzyme digestion of the plasmid expression vector pTRV2-C2b, the PCR product of the cloned chili CaFtsH8 gene was integrated into the pTRV2-C2b vector by recombination.

[0023] The vector plasmid was linearized with a fast restriction enzyme. The system was as follows: Fastdigestion buffer, 5 μL; SmaⅠ Restriction Enzyme, 4 μL; plasmid, 15 μL; ddH2O, 26 μL; total 50 μL. Program: 30 °C, 120 min.

[0024] Then, the single-enzyme digested plasmid and the PCR amplification product were purified and recovered using a kit according to the instructions, and the recovery results were detected for their concentrations using 1% agarose gel. The recombination and transformation of the target gene and the expression plasmid vector were carried out as follows:

[0025] a. Prepare a recombination reaction system (20 μL)

[0026] 5×CEⅠⅠ Buffer, 4 μL; ExnaseⅠⅠ, 2 μL; linearized vector, X μL; inserted fragment, Y μL; ddH2O to 20 μL.

[0027] Dosage of linearized vector: 0.02 × number of base pairs (bp) of the vector in ng

[0028] Dosage of inserted fragment: 0.04 × number of base pairs (bp) of the inserted fragment in ng

[0029] b. Incubate in a 37°C incubator for more than 30 min;

[0030] c. Add all of the above recombinant products to 100 μL of DH5α competent cells and place on ice for 25 min;

[0031] d. After heat shock at 42°C for 45 s, place in an ice-water bath for 3 min;

[0032] e. Add 400 μL of LB liquid medium, and incubate with shaking at 37°C and 150 rpm / min for 60 min;

[0033] f. Culture overnight on an LB solid medium containing kanamycin (Kan+, 50 mg / L);

[0034] g. Pick a single colony and culture it on a streaked LB solid medium (Kan+, 50 mg / L) for about 12 h, and simultaneously detect positive clones by PCR colony detection.

[0035] Example 3: Transformation of Agrobacterium tumefaciens GV3101

[0036] The plasmid was extracted using a plasmid extraction kit and operated according to the instructions. Further, the sequence accuracy of the target fragment recombined into the vector was confirmed by first-generation sequencing. Subsequently, the above recombinant plasmid was transformed into Agrobacterium tumefaciens GV3101, and the method steps are as follows:

[0037] (1) Add 1 μL of purified plasmid to 100 μL of Agrobacterium tumefaciens competent GV3101 and gently mix by shaking;

[0038] (2) Place on ice for 5 min and immediately place in liquid nitrogen for 5 min;

[0039] (3) Incubate in a 37°C water bath for 5 min and then in an ice bath for 5 min;

[0040] (4) Add 700 μL of LB medium and incubate with shaking at 28°C and 200 rpm / min for 1 h;

[0041] (5) Centrifuge to remove most of the supernatant, and resuspend the pellet by gently pipetting up and down. Take 100 μL of the bacterial solution and spread it on an LB plate containing 50 mg / L kanamycin and 25 mg / L rifampicin;

[0042] (6) Incubate at 28°C for 48 h, and resistant colonies can be seen growing. Pick a single colony and inoculate it into 400 μL of LB medium (containing kanamycin and rifampicin), and culture it overnight with shaking at 28°C;

[0043] (7) Identify positive colonies by PCR.

[0044] Example 4: Virus-induced gene silencing in pepper

[0045] 1) Pick positive Agrobacterium monoclonal colonies (pTRV1, pTRV2-C2b, pTRV2-C2b-CaFtsH8) into liquid LB medium containing 50 mg / mL kanamycin (Kan) and 10 mg / mL rifampicin (Rif). Culture them on a constant temperature shaker at 28°C with a rotation speed of 220 rpm / min until the bacterial liquid is saturated.

[0046] 2) Add the saturated bacterial liquid to liquid LB medium (50 mL of LB medium) containing 50 mg / mL Kan, 10 mg / mL Rif, 10 μM 2-(N-morpholino)ethanesulfonic acid (MES) with a pH of 5.6, and 40 μM acetosyringone (AS) at a ratio of 1:40, and culture it on a constant temperature shaker at 28°C with a rotation speed of 220 rpm / min for 16 h.

[0047] 50 mL LB + 10 μL of 100 μM AS + 1 mL of 0.5 mol / L MES

[0048] Preparation of 0.2 M AS: 0.3924 g -> 10 mL of dimethyl sulfoxide (DMSO), aliquot and store for later use

[0049] Preparation of 0.5 M MES: 4.88 g -> 50 mL of H2O, pH: 5.2 - 5.6 (adjust pH with NaOH), filter sterilize, aliquot and store for later use

[0050] 3) Collect Agrobacterium at a rotation speed of 5000 rpm / min, pour off the supernatant, and resuspend Agrobacterium with ddH2O containing 200 mM magnesium chloride (MgCl2) and 150 μM AS (i.e., 1 mL of the prepared resuspension + 50 mL of water). Adjust the concentration of the bacterial liquid to an appropriate concentration (OD600 = 0.1), then wrap it with tin foil, and let it stand at room temperature for 2 - 3 h before injection and infection.

[0051] The prepared resuspension -> 1 mL of 0.5 M MgCl2 + 37.5 μL AS, make up to 50 mL

[0052] 4) Mix equal amounts of pTRV1 and pTRV2 respectively. Before injection, adjust the OD value. Dilute with the resuspension solution, mix the two bacterial solutions, and the injection concentration after mixing is OD = 0.004. When injecting, infiltrate the leaf with the bacterial solution through a 1 mL syringe on the back of the cotyledon or true leaf.

[0053] 5) The injected pepper seedlings are at the cotyledon stage, and the two cotyledons are just fully unfolded. The injected pepper plants are placed in the dark at 16 °C for 56 h, and then transferred to normal growth conditions (temperature 25 °C, 16 h / 8 h light-dark cycle)

[0054] Example 5: Detection of gene expression by real-time fluorescence quantitative PCR

[0055] Select the leaves of the silenced single plants and negative controls in Example 4 for RNA extraction, reverse transcription and real-time fluorescence quantitative PCR to detect the expression of this gene.

[0056] The pepper UBI3 gene is used as an internal reference gene, and the primer sequences are as follows.

[0057] Ca-UBI-3F: TGTCCATCTGCTCTCTGTTG,

[0058] Ca-UBI-3R: CACCCCAAGCACAATAAGAC.

[0059] The forward primer of the CaFtsH8 gene is 5’–CCCTGAACCAACTATTGACGG-3’, and the reverse primer is 5’–GATCTCTGTTCTTCCCTTGA-3’.

[0060] RNA extraction from pepper leaves, reverse transcription of the first strand of cDNA, and fluorescence quantitative PCR are all carried out using the kit with reference to the instructions. The results are as Figure 2 shown in C. The expression level of the CaFtsH8 gene in the silenced single plants is significantly lower than that of the control.

[0061] Example 6: Transmission electron microscopy observation of the leaves of silenced single plants and negative controls

[0062] Select the true leaves of the silenced single plants and negative controls, cut them into small pieces, and fix them with 2.5% glutaraldehyde (25% glutaraldehyde is diluted to 2.5% with 0.2 mol / L phosphate buffer at pH 7.2). Evacuate until the leaves all sink to the bottom of the tube and incubate overnight at 4°C. Rinse the tissues fixed with glutaraldehyde three times with 0.1 M phosphate buffer (pH 7.4), 15 minutes each time, and then fix them with 1% osmium tetroxide in 0.1 M phosphate buffer (pH 7.4) at room temperature (20°C) for 2 h (the fixation time can be appropriately adjusted according to different samples); then rinse them three times with 0.1 M phosphate buffer (pH 7.2), 15 min each time. Dehydrate the tissues (or cells) stepwise in an ascending gradient of 30%, 50%, 70%, 80%, 85%, 90%, 100% (twice) ethanol, 15 - 20 min each time (for samples with more water content and thicker cell membranes, the dehydration time can be appropriately extended). The infiltrants are in turn acetone:epoxy resin (2:1), acetone:epoxy resin (1:1), epoxy resin, and incubate in a 37°C incubator for 8 - 12 h each time. Put the infiltrated samples into embedding molds, add the embedding agent epoxy resin, and polymerize in a 60°C incubator for 48 h. Prepare ultra-thin sections using a Leica UC7 microtome, with a thickness of 80 - 100 nm, and double stain with uranium and lead (saturated aqueous solution of 2% uranyl acetate, lead citrate, stain at room temperature for 15 min, dry the sections overnight at room temperature), and examine and photograph the stained samples using a Tecnai G220 TWIN transmission electron microscope.

[0063] Sequence Listing

[0064] Institute of Industrial Crops, Hubei Academy of Agricultural Sciences, Yangtze University

[0065] Application of Capsicum annuum L. CaFtsH8 Metalloprotease Gene in the Development of Seedling Leaves of Capsicum

[0066] DNA

[0067] Capsicum annuum L.

[0068] >SEQ ID NO:1

[0069]

[0070] >SEQ ID NO:2

[0071] ATGGCTACTTCATCAGTATGCATAGCAGGAAATGGTTTGTCTACACATAAAACACAGAAAGTCTTTAAGAAGGATGTTTATGGAAGGAAAATTTTATATTCCTCAAATCTTCCATCGTCTGGTAAAACATCAAGAGTAGTTGTAAAAGCATCTCTTCAGCAAAGGCCGGATGAAGGAAGAAGAGGCTTTCTTAAATTATTGCTTGGAAATGTTGGGCTTGGAGCGCCTGCTTTGTTAGGTAATGGAAAAG

[0072] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. Application of pepper CaFtsH8 metalloproteinase gene in pepper leaf development at seedling stage, characterized by: The CDS sequence of the pepper CaFtsH8 gene is shown in SEQ ID NO.

1.

2. Application of pepper CaFtsH8 metalloproteinase gene in pepper leaf development at seedling stage, characterized by: The highly specific fragment selected by gene silencing VIGS is shown in SEQ ID NO:2.

Images