Application of OsP2K1 gene in regulation and control of broad-spectrum disease resistance and / or yield of rice

Abstract

The invention belongs to the technical field of biological genetic engineering, and particularly relates to application of an OsP2K1 gene in regulation and control of broad-spectrum disease resistance and / or yield of rice. The nucleotide sequence of the OsP2K1 gene is shown as SEQ ID NO.2. After the OsP2K1 gene is over-expressed in rice, the disease resistance of rice plants to rice blast, rice sheath blight disease and rice bacterial leaf blight is improved, the yield of the rice is also improved, the OsP2K1 gene can be used for creating new rice germplasm with broad-spectrum disease resistance and high yield, and the OsP2K1 gene can be used for preparing new rice germplasm with broad-spectrum disease resistance and high yield. The invention provides a new thought for preventing and treating rice diseases.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological genetic engineering, and particularly relates to the application of the OsP2K1 gene in regulating broad-spectrum disease resistance and / or yield of rice. Background Art

[0002] Rice is one of the main food crops. During the planting process of rice, it is easily affected by many diseases. Among them, rice sheath blight caused by Rhizoctonia solani Kühn, rice blast caused by Magnaporthe oryzae, and bacterial blight caused by Xanthomonas oryzae pv. oryzae are the three diseases with the widest distribution range and the highest damage degree in rice diseases. They have become the main diseases restricting rice yield and show an increasing trend year by year.

[0003] Currently, exploring and breeding disease-resistant varieties is one of the ways to control rice diseases. However, due to global climate change and the simplification of rice planting varieties, pathogens can quickly adapt to host resistance in a short period. Therefore, the control effect of disease-resistant rice on the three major rice diseases is not ideal. Therefore, exploring and breeding resistant varieties with broad-spectrum resistance and not affecting rice yield is an effective measure for the sustainable development of green prevention and control of crop diseases.

[0004] Extracellular adenosine 5'-triphosphate (eATP) widely exists in organisms. It is not only the main energy source in organisms but also a very important signal molecule. As a strongly charged signal molecule, eATP cannot freely diffuse across the cytoplasmic membrane. Therefore, it can be recognized and bound by eATP receptors present on the plasma membrane, thereby activating the expression of downstream signal genes. Arabidopsis thaliana L-type lectin receptor kinase (AtP2K1) is the first discovered eATP receptor in plants, responsible for sensing ATP or ADP and participating in the growth, development, and stress response of plants. However, the function of eATP receptors in rice and the research on purine signal transduction in rice are still unknown.

[0005] Therefore, further exploring the physiological and biochemical functions of rice eATP receptors and screening out a gene that can regulate broad-spectrum disease resistance of rice to achieve green prevention and control of rice diseases have become urgent problems to be solved in this field. Summary of the Invention

[0006] To solve the problem of the lack of rice with broad-spectrum disease resistance in the prior art, the present invention provides the application of the OsP2K1 gene in regulating the broad-spectrum disease resistance and / or yield of rice, specifically including the following technical solutions:

[0007] The application of the OsP2K1 gene in regulating the broad-spectrum disease resistance and / or yield of rice, wherein the amino acid sequence of the protein encoded by the OsP2K1 gene is as shown in SEQ ID NO.1.

[0008] Preferably, the broad-spectrum disease resistance of the rice includes any one or more of rice blast resistance, sheath blight resistance, and bacterial blight resistance of rice.

[0009] Preferably, the regulation includes positively regulating the OsP2K1 gene to improve the broad-spectrum disease resistance and / or yield of rice, or negatively regulating the OsP2K1 gene to reduce the broad-spectrum disease resistance and / or yield of rice.

[0010] The present invention also provides a biological material, which includes a biological material for positively regulating the OsP2K1 gene as described above and / or a biological material for negatively regulating the OsP2K1 gene as described above.

[0011] Preferably, the biological material for positively regulating the OsP2K1 gene includes one or more of a primer set for amplifying the OsP2K1 gene, a recombinant expression vector containing the OsP2K1 gene, and a recombinant microorganism containing the OsP2K1 gene.

[0012] Preferably, the biological material for negatively regulating the OsP2K1 gene includes a biological material for silencing the OsP2K1 gene and / or a biological material for knocking out the OsP2K1 gene;

[0013] The biological material for silencing the OsP2K1 gene includes a recombinant silencing expression vector obtained by inserting the target sequence shown in SEQ ID NO.3 into a silencing expression vector and / or a recombinant microorganism containing the above recombinant silencing expression vector.

[0014] The application of the biological material as described in any one of the above in improving rice germplasm or creating new germplasm;

[0015] The improvement of the rice germplasm includes regulating the broad-spectrum disease resistance and / or yield of rice;

[0016] The creation of new germplasm includes any one or more of the following:

[0017] Creating rice with high broad-spectrum disease resistance, creating high-yield rice, creating a susceptible rice model, and creating a low-yield rice model.

[0018] The present invention also provides a method for creating rice with broad-spectrum disease resistance and / or high yield, comprising the following steps:

[0019] Increase the expression level of the OsP2K1 gene in the target rice as described above to obtain the rice with broad-spectrum disease resistance and / or high yield.

[0020] Preferably, the step of increasing the expression level of the OsP2K1 gene in the target rice comprises: transforming the plant overexpression vector of the OsP2K1 gene into the target rice by means of genetic transformation.

[0021] The present invention also provides a method for creating a rice model with disease susceptibility and / or low yield, comprising the following steps:

[0022] Reduce the expression level of the OsP2K1 gene in the target rice as described above to obtain the rice model with disease susceptibility and / or low yield.

[0023] The beneficial effects of the present invention are as follows:

[0024] The present invention provides the application of the OsP2K1 gene in regulating the broad-spectrum disease resistance and yield of rice. The amino acid sequence of the protein encoded by the OsP2K1 gene is shown as SEQ ID NO.1. In the examples of the present invention, the OsP2K1 gene was overexpressed in rice by overexpression transgenic technology to obtain the OsP2K1 overexpression transgenic plant OsP2K1 OE. After inoculating the pathogens of the three major rice diseases, namely rice blast, rice sheath blight, and rice bacterial blight, in the OsP2K1 OE plants, it was found that the OsP2K1 OE plants were more disease-resistant compared with the wild-type rice. It was confirmed that OsP2K1 OE was related to the disease resistance of the three major rice diseases. In addition, compared with the wild-type at the mature stage, the seed setting rate of OsP2K1 OE at the mature stage was higher. The present invention confirmed that the OsP2K1 gene was also related to the increase in rice yield. The present invention provides a new idea for creating new germplasms with broad-spectrum disease resistance and yield increase in rice. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments.

[0026] Figure 1 It is an analysis diagram of the OsP2K1 RNAi and OsP2K1 OE transgenic lines in Example 1 and Example 2;

[0027] Among them, Nip represents the wild-type Nipponbare rice; the OsP2K1 gene was overexpressed or silenced using the wild-type Nip rice as the background. OsP2K1 OE1 and OsP2K1 OE2 represent different lines with overexpression of the OsP2K1 gene; OsP2K1Ri1 and OsP2K1 Ri2 represent different lines with silencing of the OsP2K1 gene.

[0028] Figure 2 They are the phenotypes of the OsP2K1 RNAi and OsP2K1 OE transgenic rice plants after inoculation with Magnaporthe oryzae in Example 3.

[0029] Figure 3 They are the phenotypes of the OsP2K1 RNAi and OsP2K1 OE transgenic rice plants after inoculation with Rhizoctonia solani in Example 3.

[0030] Figure 4 They are the phenotypes of the OsP2K1 RNAi and OsP2K1 OE transgenic rice plants after inoculation with Xanthomonas oryzae pv. oryzae in Example 3.

[0031] Figure 5 They are the statistical charts of the agronomic traits such as the yield of the OsP2K1 RNAi and OsP2K1 OE transgenic rice plants in Example 4.

[0032] Figures 2 to 5 In it, Nip represents the wild-type Nip rice, OsP2K1 OE represents the transgenic rice plants with overexpression of the OsP2K1 gene using the wild-type Nip rice as the background. #1, #2, OsP2K1 OE1, and Os P2K1 OE2 all represent different lines of OsP2K1 overexpressing rice; OsP2K1 Ri represents the transgenic rice plants with silencing of the OsP2K1 gene using the wild-type Nip rice as the background. #1, #2, OsP2K1 Ri1, and OsP2K1 Ri2 all represent different lines of OsP2K1 silenced plants.

[0033] Figures 1 to 5 In it, *, **, *** represent different difference levels among the rice traits. Detailed implementation manners

[0034] The present invention provides an application of the OsP2K1 gene in regulating the broad-spectrum disease resistance and / or yield of rice. The amino acid sequence of the protein encoded by the OsP2K1 gene is as shown in SEQ ID NO.1.

[0035] The amino acid sequence of the protein encoded by the OsP2K1 gene of the present invention is as shown in SEQ ID NO.1;

[0036] SEQ ID NO.1: MPHTTSKPGIMVGVRCSCIDSNSESSVQTFDAMTRIAVTTHHMPCANCNSQTEANLPMGNHRLLLLLLLLLAVVGSDHGGVLAADEFTYNGFGGANLTLDGMAAVAPNGLLVLSNGTNQMAGHAFHPTPIRLRGGAAGGAVQSFSAAFVFAIVSNFTVLSDNGMAFVVAPSTRLSTFNAGQYLGILNVTDNGNADNNIFAVELDTMLNPEFQDMNSNHIGVDINSMKSVQNHSAGYYDEATGAFNNLSLISRQPMQVWVDYDGATTVLNVTMAPLDVPKPSKPLISAPVNLSSVVTDTAYVGFSAATGVIYTRHYVLGWSFSQNGAAPSLHTSSLPALPRFGPKPRSKVLEIVLPIATAAFVLALVIAAFLFVRRRVRYAEVREDWEVEFGPHRFSYKELYQATKGFKNKQLLGTGGFGRVYKGVLAKSNLEIAVKRVSHDSKQGMKEFIAEVVSIGHLRHRNLVQLLGYCRRKGELLLVYDYMSNGSLDKYLYDKTKPVLDWGQRFQIIKGVASGLLYLHEDWEQVVIHRDIKASNVLLDGEMNGRLGDFGLARLYDHGVDPQTTHVVGTMGYLAPELVRTGKATPVTDVFAFGVFVLEVTCGRRPLGCIAPDDQNVLLDWVQEHERRHAALDTVDARLCGKYDADEARLALKLGLMCAHPLPDARPTMRQVTQYLDGDAPMPEVAPTMVSYTMLALMQNDGFDSFAMSFPSTVTSTASPMSADVSAVSGLSGGR;

[0037] As an embodiment, the present invention also provides the full nucleotide sequence of the OsP2K1 gene, as shown in SEQ ID NO.2;

[0038] CACGTCGACCGCCAGCCCCATGTCCGCCGACGTCTCGGCCGTGTCCGGCCTCTCCGGT GGAAGGTGA

[0039] -3'. Among them, in SEQ ID NO.2, the underlined part is the dsRNA sequence, and the dsRNA sequence is SEQ ID NO.3. In SEQ ID NO.2, the bold part and the bold and underlined part are both UTR regions, and the sequence part outside the UTR region is the coding region.

[0040] As an embodiment, the broad-spectrum disease resistance of the rice described in the present invention includes any one or more of rice blast resistance, sheath blight resistance, and bacterial blight resistance of rice. As an embodiment, in the rice blast resistance of the rice, the pathogen of the rice blast is Magnaporthe oryzae Guy11 strain. As an embodiment, in the sheath blight resistance of the rice, the pathogen of the sheath blight is Rhizoctonia solani AG1-IA strain. As an embodiment, in the bacterial blight resistance of the rice, the pathogens of the bacterial blight are Xanthomonas oryzae pv. oryzae PXO99A strain and / or Xanthomonas oryzae pv. oryzae PXO86A strain.

[0041] As an embodiment, the regulation described in the present invention includes positively regulating the OsP2K1 gene to improve the broad-spectrum disease resistance and / or yield of rice, or negatively regulating the OsP2K1 gene to reduce the broad-spectrum disease resistance and / or yield of rice. As an embodiment, the positive regulation includes overexpressing the OsP2K1 gene. As an embodiment, the negative regulation includes silencing or knocking out the OsP2K1 gene.

[0042] The present invention also provides a biological material, and the biological material includes a biological material for positively regulating the OsP2K1 gene as described above and / or a biological material for negatively regulating the OsP2K1 gene as described above.

[0043] As an implementation mode, the biological materials for positively regulating the OsP2K1 gene in the present invention include one or more of a primer set for amplifying the OsP2K1 gene, a recombinant expression vector containing the OsP2K1 gene, and a recombinant microorganism containing the OsP2K1 gene. As an implementation mode, the primer set for amplifying the OsP2K1 gene includes a forward primer as shown in SEQ ID NO.10 and a reverse primer as shown in SEQ ID NO.11. As an implementation mode, the recombinant expression vector containing the OsP2K1 gene includes inserting the OsP2K1 gene into the pCambia1381-Ubi vector to obtain P ubi -OsP2K1 overexpression vector. As an implementation mode, the recombinant microorganism containing the OsP2K1 gene includes Agrobacterium EHA101 containing the OsP2K1 gene.

[0044] As an implementation mode, the biological materials for negatively regulating the OsP2K1 gene in the present invention include biological materials for silencing the OsP2K1 gene and / or biological materials for knocking out the OsP2K1 gene. As an implementation mode, the biological materials for silencing the OsP2K1 gene include a recombinant silencing expression vector obtained by inserting the target sequence as shown in SEQ ID NO.3 into a silencing expression vector and / or a recombinant microorganism containing the above recombinant silencing expression vector. As an implementation mode, the silencing expression vector is a pH7GWIWG2(Ⅱ) silencing expression vector, and the recombinant microorganism includes Agrobacterium EHA101 containing the recombinant silencing expression vector.

[0045] The present invention also provides the application of the above-mentioned biological materials in improving rice germplasm or creating new germplasm. As an implementation mode, the improvement of rice germplasm includes regulating the broad-spectrum disease resistance and / or yield of rice. As an implementation mode, the creation of new germplasm includes any one or more of the following: creating rice with high broad-spectrum disease resistance, creating high-yield rice, creating a susceptible rice model, and creating a low-yield rice model.

[0046] The present invention also provides a method for creating rice with broad-spectrum disease resistance and / or high yield, including the following steps:

[0047] Increasing the expression level of the OsP2K1 gene in the target rice to obtain the rice with broad-spectrum disease resistance and / or high yield.

[0048] As an implementation mode, the method for increasing the expression level of the OsP2K1 gene in the target rice in the present invention includes: using genetic transformation to transform the plant overexpression vector of the OsP2K1 gene into the target rice. In a specific embodiment, the present invention uses P ubiAfter the overexpression vector of -OsP2K1 is transferred into Agrobacterium tumefaciens strain EHA101, the overexpression vector is transformed into the target rice plants by the Agrobacterium-mediated transgenic method to obtain rice with broad-spectrum disease resistance and / or high-yield performance.

[0049] The present invention also provides a method for creating a rice model with disease susceptibility and / or low yield, including the following steps: reducing the expression level of the OsP2K1 gene in the target rice to obtain the rice model with disease susceptibility and / or low yield. As an implementation manner, reducing the expression level of the OsP2K1 gene in the target rice includes the following operations: after the gene silencing expression vector pH7GWIWG2(Ⅱ)-OsP2K1 is transferred into Agrobacterium tumefaciens strain EHA101, the overexpression vector is transformed into the target rice plants by the Agrobacterium-mediated transgenic method to obtain a rice model with disease susceptibility and / or low-yield traits.

[0050] To further illustrate the present invention, the application of the OsP2K1 gene provided by the present invention in regulating broad-spectrum disease resistance and / or yield of rice will be described in detail below in conjunction with the drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0051] Example 1 Obtaining of RNAi gene interference transgenic rice plants OsP2K1 RNAi

[0052] 1) Obtaining of the silencing expression vector

[0053] Rice OsP2K1 is a homologous protein of Arabidopsis AtP2K1 (eATP receptor). By comparing the sequences with the AtP2K1 gene, the target site sequence of the OsP2K1 gene is designed.

[0054] According to the gene silencing expression vector pH7GWIWG2(Ⅱ) vector, primers are designed. The sequences of the primers are shown in SEQ ID NO.4 and SEQ ID NO.5 respectively. The 5' ends of the forward primer and the reverse primer both carry a 31bp (or 30bp) sequence necessary for homologous recombination with the backbone vector. The 31bp (or 30bp) sequence is shown as the lowercase letters in the sequences of SEQ ID NO.4 and SEQ ID NO.5.

[0055] Forward primer (SEQ ID NO.4): 5'-ggggacaagtttgtacaaaaaagcaggctgcCTCCAATCCGGTAACCAA-3';

[0056] Reverse primer (SEQ ID NO.5): 5'-ggggaccactttgtacaagaaagctgggtgTTGGTTACCGGATTGGAG-3'.

[0057] Using the cDNA of the wild-type rice variety Nipponbare (Nip) as a template, the OsP2K1 target sequence was amplified using the following PCR program:

[0058] The PCR reaction system was as follows: 1 μL of cDNA, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 25 μL of 2×PCR mix, and 22 μL of ddH 2 O.

[0059] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 minutes; 15 seconds at 95°C, 15 seconds at 58°C, 1.5 minutes at 72°C, for 33 cycles; final extension at 72°C for 10 minutes. After agarose gel electrophoresis, the gel was cut to recover the fragment, and the amplified fragment size was 266 bp.

[0060] Using the following Gateway reaction system, the recovered OsP2K1 nucleotide sequence product and the pH7GWIWG2(Ⅱ) vector were homologously recombined using the Gateway ligation system to obtain the OsP2K1 silencing expression vector pH7GWIWG2(Ⅱ)-OsP2K1, and the Escherichia coli DH5α strain was transformed using the heat shock method.

[0061] Gateway reaction system: 0.5 μL of Mix, 1 μL of insert, 1 μL of vector.

[0062] Positive clones were selected for PCR verification, and the positive clones were further verified by sequencing. The plasmids that were correctly aligned were transferred into the Agrobacterium EHA101 strain.

[0063] 2) Obtaining of OsP2K1 gene-silenced transgenic rice

[0064] Using the Agrobacterium-mediated transgenic method, the obtained pH7GWIWG2(Ⅱ)-OsP2K1 silencing expression vector was transformed into Nip rice, and the T 0 generation of OsP2K1 RNAi transgenic rice was screened, which was the OsP2K1 silenced transgenic line, named OsP2K1 RNAi. The specific operation was completed by Hubei Boyuan Biotechnology Co., Ltd.

[0065] 3) Identification of transgenic rice

[0066] Molecular identification was performed on the obtained T 0 generation of OsP2K1 RNAi transgenic rice and wild-type Nip rice (WT): Total RNA was extracted from the roots of transgenic rice and wild-type rice respectively. After reverse transcription, RT-qPCR method was used for identification with the following primers. Two T 0The identification results of the generation of OsP2K1 RNAi transgenic rice are shown and named OsP2K1 Ri1 and OsP2K1 Ri2 respectively; since there is no gene difference in wild-type rice, the identification result of a randomly selected wild-type rice is shown, and the results are as Figure 1 shown:

[0067] The sequencing primer information is as follows:

[0068] OsP2K1-F1 (SEQ ID NO.6): 5’-CATGTCCTTCCCTTCCACCGT-3’;

[0069] OsP2K1-R1 (SEQ ID NO.7): 5’-AGTGAGTGTGCAAAGCTTCGA-3’.

[0070] The internal reference primer information is as follows:

[0071] F (SEQ ID NO.8): 5’-GACGGACGCACCCTGGCTGA-3’;

[0072] R (SEQ ID NO.9): 5’-TGCTGCCAATTACCATATACC-3’.

[0073] As can be seen from Figure 1 it, in OsP2K1 Ri1 transgenic rice (i.e., OsP2K1 RNAi transgenic rice line 1) and OsP2K1 Ri2 transgenic rice (i.e., OsP2K1 RNAi transgenic rice line 2), the expression level of OsP2K1 is significantly lower than that of the wild type. Thus, it can be seen that silencing the OsP2K1 gene in rice can effectively inhibit the expression of the OsP2K1 gene.

[0074] Example 2 Obtaining of OsP2K1 Overexpression Transgenic Rice Plants

[0075] 1) Construction of the OsP2K1 Gene Overexpression Recombinant Vector

[0076] The genomic nucleotide sequence of the OsP2K1 gene is as shown in SEQ ID NO.2, and the protein encoded by the OsP2K1 gene is OsP2K1, and the amino acid sequence of this protein is as shown in SEQ ID NO.1.

[0077] Primers for amplifying the OsP2K1 nucleotide sequence are designed according to the restriction enzyme sites of the pCambia1381-Ubi backbone vector, and the primer sequences are as shown below. The lowercase letters in the primer sequences represent the restriction enzyme sites.

[0078] Forward primer (SEQ ID NO.10): 5’-aagcttATGCCACACACAACCAGTAA-3’;

[0079] Reverse primer (SEQ ID NO.11): 5’-gtacccatggCCTTCCACCGGAGAGGCCGG-3’.

[0080] Using the cDNA of rice variety Nip as a template, the nucleotide sequence of OsP2K1 was amplified by the following PCR program.

[0081] The PCR reaction system was: 1 μL of cDNA, 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 25 μL of 2×PCR mix, ddH 2 O 22 μL.

[0082] The PCR amplification program was: pre-denaturation at 95°C for 3 minutes; 15 seconds at 95°C, 15 seconds at 58°C, 1.5 minutes at 72°C, for 33 cycles; final extension at 72°C for 10 minutes. After agarose gel electrophoresis, the gel was cut to recover the fragment, and the size of the amplified fragment was 2211 bp.

[0083] The pCambia1381-Ubi vector was digested with restriction enzymes HindⅢ and KpnⅠ, and the linearized vector was purified and recovered after agarose gel electrophoresis.

[0084] Using the following Infusion ligation system, the recovered OsP2K1 nucleotide sequence product and the linearized pCambia1381-Ubi vector were ligated to obtain the overexpression vector P ubi -OsP2K1:

[0085] Infusion system: 3 μL of insert, 1 μL of vector, 2 μL of Buffer, ddH 2 O 3 μL, 1 μL of Infusion mix. After mixing the above system, the reaction was carried out at 37°C for 30 min.

[0086] The Escherichia coli DH5α strain was transformed by the heat shock method. Positive clones were selected for PCR verification, and the positive clones were further verified by sequencing. After comparison, the correct plasmid was transferred into the Agrobacterium tumefaciens EHA101 strain.

[0087] 2) Obtaining of transgenic rice overexpressing the OsP2K1 gene

[0088] Using the Agrobacterium-mediated transgenic method, the obtained P ubi -OsP2K1 overexpression vector was transformed into Nip rice, and T was obtained by screening with glufosinate0 The first-generation transgenic rice, namely the OsP2K1 overexpression transgenic line, is named OsP2K1 OE. The specific operation was completed by Hubei Boyuan Biotechnology Co., Ltd.

[0089] 3) Molecular identification of OsP2K1 OE transgenic rice plants

[0090] For the T 0 generation of OsP2K1 OE transgenic rice and wild-type Nip rice (WT), molecular identification was carried out. After extracting the total RNA of the roots of various rices and reverse transcription, RT-qPCR method was used for identification with the following primers. Randomly select two T 0 generation of OsP2K1 OE transgenic rice for identification results display, named OsP2K1 OE1 and OsP2K1 OE2 respectively; the results are as Figure 1 shown:

[0091] The sequencing primer information is as follows:

[0092] OsP2K1-F1 (SEQ ID NO.6): 5’-CATGTCCTTCCCTTCCACCGT-3’;

[0093] OsP2K1-R1 (SEQ ID NO.7): 5’-AGTGAGTGTGCAAAGCTTCGA-3’.

[0094] The internal reference primer information is as follows:

[0095] F (SEQ ID NO.8): 5’-GACGGACGCACCCTGGCTGA-3’;

[0096] R (SEQ ID NO.9): 5’-TGCTGCCAATTACCATATACC-3’.

[0097] As Figure 1 can be seen, in OsP2K1 OE1 transgenic rice and OsP2K1 Ri2 transgenic rice, the expression level of OsP2K1 is significantly higher than that of the wild type. Thus, it can be seen that overexpressing the OsP2K1 gene in rice according to the method described in the present invention can effectively promote the expression of the OsP2K1 gene in rice.

[0098] Example 3 Determination of disease resistance of transgenic rice

[0099] Use the OsP2K1 RNAi transgenic rice prepared in Example 1, the OsP2K1 OE transgenic rice prepared in Example 2, and wild-type Nip rice for the determination of rice disease resistance.

[0100] 1) Determination of the disease resistance of transgenic rice to rice blast

[0101] Preparation of Magnaporthe oryzae strain: Under low light conditions, the Magnaporthe oryzae Guy11 strain provided by the Plant Protection Institute of Liaoning Academy of Agricultural Sciences was activated on PDA medium. After the mycelium covered the PDA medium, the mycelium was transferred to tomato oatmeal medium and cultured for about two weeks, and then the mycelium was scratched to produce spores for standby.

[0102] In vitro inoculation: The rice seedlings of OsP2K1 RNAi transgenic rice, OsP2K1 OE transgenic rice and wild-type Nip rice were respectively cultured in an artificial climate chamber under the same culture conditions for four weeks, and then the above-mentioned rice was sprayed with ammonium sulfate at a concentration of 0.2% respectively and continued to be cultured for 2-3 days; The spores of Magnaporthe oryzae that had produced spores in advance were washed off with sterile water containing 0.28% Tween-20, and the concentration of the spore suspension was adjusted to 1.5-2×10 5 spores / ml with a hemocytometer. The rice leaves at the same position of different groups were taken, and the in vitro leaves were used for determination. The leaves were uniformly cut into small segments about 5 cm long, and the front of the leaves was vertically pricked with a 10 μL pipette tip for scratching treatment, and then the spore suspension of Magnaporthe oryzae was dropped at the scratched part of the rice, and cultured for 24 h in the dark. After the culture was completed, the temperature was kept unchanged and the light conditions were restored to normal, and the culture was continued under the condition of L / D = 12 h / 12 h. Seven days after inoculating the spore suspension of Magnaporthe oryzae on the rice leaves, the occurrence of rice blast disease was investigated to evaluate the lesion length. During the experiment, each leaf was treated in parallel 3 times, and 3 repeated experiments were carried out, and then two groups of picture data of one of the experiments were randomly selected for display, and the results were as Figure 2 shown in Table 1.

[0103] Table 1 Lesion lengths (cm) of transgenic rice after inoculating Magnaporthe oryzae

[0104] Nip OsP2K1OE1 OsP2K1OE2 OsP2K1Ri1 OsP2K1Ri2 0.68 0.30 0.42 1.05 0.81 0.71 0.39 0.29 0.83 1.19 0.52 0.21 0.38 1.13 1.03

[0105] From Figure 2 the results in Table 1, it can be seen that after in vitro inoculation of Magnaporthe oryzae on the leaves of OsP2K1 OE transgenic rice, the lesion length range on the rice leaves was 0.21-0.42 cm, which was less than the lesion length range of 0.52-0.71 cm of the wild type. There was a significant difference between the results of the two treatments, and the rice overexpressing the OsP2K1 gene showed more disease resistance. After in vitro inoculation of Magnaporthe oryzae on the leaves of OsP2K1 RNAi transgenic rice, the lesion length on the rice leaves was greater than that of the wild type, and the rice with the OsP2K1 gene silenced showed more susceptibility to the bacteria.

[0106] 2) Determination of the disease resistance of transgenic rice to sheath blight of rice

[0107] The rice seedlings of OsP2K1 RNAi transgenic rice, OsP2K1 OE transgenic rice and wild-type Nip rice were respectively cultured in an artificial climate chamber under the same culture conditions until the tillering stage of rice, and the resistance was identified by the method of inoculating Rhizoctonia solani on the living leaf sheath.

[0108] Preparation of Rhizoctonia solani: The Rhizoctonia solani AG1-IA provided by Professor Wei Songhong of the College of Plant Protection, Shenyang Agricultural University was stored at 4°C. Before the experiment started, the Rhizoctonia solani stored at 4°C was taken out. A mycelial cake of the Rhizoctonia solani stored at 4°C was picked with a punch and inoculated on a new PDA medium, and then incubated upside down for 1-2 days. When the medium was covered with grayish-white mycelia, the peripheral mycelial cake on the PDA medium at this time was picked and transferred to the leaves of young rice seedlings, so that the Rhizoctonia solani could infect the rice leaves and be activated. When the rice leaves were infected by the Rhizoctonia solani until sclerotia were produced by the Rhizoctonia solani, the sclerotia of the Rhizoctonia solani were placed on another new PDA medium and cultured until the mycelia covered the culture dish. At this time, the mycelia growing on the PDA medium were the activated Rhizoctonia solani of rice sheath blight (reserved for later use).

[0109] Preparation before inoculation: A mycelial cake was punched out with a punch or a pipette tip on the PDA culture dish covered with the mycelia of the Rhizoctonia solani of rice sheath blight after activation. The side of the punched mycelial cake with mycelia was placed face down on a new PDA medium, and small pieces of wood with a size of 0.3 cm × 0.7 cm were laid around the mycelial cake near the edge of the culture dish. After the mycelia climbed onto the wood pieces and covered them, the wood pieces covered with mycelia were taken out and reserved.

[0110] Inoculation in vivo: The wood pieces covered with mycelia were respectively inserted into the leaf sheaths of the tillering-stage rice in different groups, sprayed with water and the inoculation sites were wrapped with plastic wrap. After the plants became diseased, the disease conditions were observed every day after inoculating the pathogenic bacteria, and the disease conditions were statistically analyzed after 7 days. Each experiment was repeated 3 times, and each experiment was repeated on three stems of one rice plant. For the OsP2K1 RNAi transgenic rice group and the OsP2K1 OE transgenic rice group, two stems of two rice plants were randomly selected for display, and for the wild-type rice, two stems of one rice plant were randomly selected for display. The results are as Figure 3 and Table 2 show.

[0111] Table 2 Lesion lengths (cm) of transgenic rice after inoculation with Rhizoctonia solani

[0112] Nip OsP2K1OE1 OsP2K1OE2 OsP2K1Ri1 OsP2K1Ri2 1.80 1.05 1.02 5.00 4.88 2.57 1.52 1.33 5.22 5.75 3.10 1.31 0.85 3.88 4.12

[0113] By Figure 3As shown in Table 2, after inoculation with the pathogen of rice sheath blight, the lesions of OsP2K1 OE rice plants were smaller than those of the wild type, and there were significant differences between the results, indicating that rice was more resistant to disease after overexpressing the OsP2K1 gene. The lesion length of OsP2K1 RNAi transgenic rice plants was longer than that of the wild type, and there were significant differences between the results, indicating that rice plants were more susceptible to Rhizoctonia solani after silencing the OsP2K1 gene.

[0114] 3) Determination of disease resistance of transgenic rice to rice bacterial blight

[0115] OsP2K1 RNAi transgenic rice seedlings, OsP2K1 OE transgenic rice seedlings and wild-type Nip rice seedlings were cultured in an artificial climate chamber under the same culture conditions until the tillering stage of rice, and the disease resistance of rice was identified by the method of inoculating Xanthomonas oryzae pv. oryzae using the method of cutting leaves in vivo.

[0116] Preparation of Xanthomonas oryzae pv. oryzae: The Xanthomonas oryzae pv. oryzae PXO99A and PXO86A were provided by Lecturer Mei Qiong of the College of Plant Protection, Shenyang Agricultural University, and the pathogens were stored at -80 °C; before the experiment, the Xanthomonas oryzae pv. oryzae races PXO99A and PXO86A strains stored at -80 °C were taken out, and the PXO99A and PXO86A strains were streaked and activated on the XB solid medium respectively. After smooth colonies grew on the medium, the bacteria in the smooth colonies were respectively picked and added to the XB liquid medium, and then cultured with shaking at 28 °C and 220 rpm for 14 h until the OD 600 value of the bacterial liquid was 0.8 measured by a spectrophotometer, and the PXO99A bacterial liquid and PXO86A bacterial liquid could be used for inoculation.

[0117] Inoculation in vivo: The PXO99A bacterial liquid and PXO86A were inoculated according to the following treatments respectively: Use a sterilized scissors to dip in the bacterial liquid, and then cut off the leaf tips of rice at the tillering stage. The length of the cut leaf tips was 1 cm, and the scissors were re-dipped in the bacterial liquid after cutting off each leaf tip. After inoculation, the remaining Xanthomonas oryzae pv. oryzae bacterial liquid was added with an appropriate amount of distilled water and poured into a spray bottle and mixed evenly, and then evenly sprayed on the wounds of rice. Observe the disease situation of rice regularly every day, and count the disease situation after 14 d. Each treatment was repeated 3 times, and each experiment was repeated on three leaves of one rice plant. For the OsP2K1 RNAi transgenic rice group and the OsP2K1 OE transgenic rice group, two leaves of two rice plants were randomly selected for display, and for the wild-type rice, two leaves of one rice plant were randomly selected for display. The results are as Figure 4 shown in Table 3.

[0118] Table 3 Lesion length (cm) of transgenic rice after inoculation with Xanthomonas oryzae pv. oryzae

[0119] Nip OsP2K1OE1 OsP2K1OE2 OsP2K1Ri1 OsP2K1Ri2 1.23 0.64 0.83 2.31 1.70 1.32 0.61 0.65 1.72 1.55 0.98 0.85 0.92 1.75 1.93

[0120] As shown by Figure 4 Table 3, for both the group inoculated with the PXO99A strain and the group inoculated with the PXO86A strain of the OsP2K1 OE transgenic rice plants, the lesion length of the rice was less than that of the wild type, and there were significant differences between the results, indicating that the rice overexpressing the OsP2K1 gene was more resistant to disease. For both the group inoculated with the PXO99A strain and the group inoculated with the PXO86A strain of the OsP2K1 RNAi transgenic rice plants, the lesion length of the rice was longer than that of the wild type, and there were significant differences between the results, indicating that the rice with the OsP2K1 gene silenced was more susceptible to Xanthomonas oryzae pv. oryzae.

[0121] Example 4 Determination of the Yield of Transgenic Rice

[0122] After the OsP2K1 RNAi transgenic rice obtained in Example 1, the OsP2K1 OE transgenic rice obtained in Example 2, and the wild-type Nip rice grew to the mature stage, they were harvested respectively, air-dried, and the agronomic traits such as rice plant height, effective tiller number, seed setting rate, 1000-grain weight, number of grains per plant, and yield per plant were counted. Each treatment had 10 replicates. For the OsP2K1 RNAi transgenic rice and OsP2K1 OE transgenic rice treatments, the test result data of randomly selecting two plants for each treatment were shown, and the test result data of randomly selecting one plant from the wild group were shown. The statistical results were as Figure 5 shown in Table 4.

[0123] Table 4 Determination Results of the Production Traits of Transgenic Rice

[0124]

[0125] As shown by Figure 5 Table 4, there were no significant differences in the plant height and effective tiller number of the OsP2K1 OE transgenic rice plants compared with the wild-type rice, but the seed setting rate, number of grains per plant, and yield per plant of the OsP2K1 OE plants were significantly higher than those of the wild type, and there were significant differences between the results. It can be seen that overexpressing the OsP2K1 gene can increase the rice yield by increasing the seed setting rate of rice. For the OsP2K1 RNAi transgenic rice plants, there were also no significant differences in the plant height and effective tiller number compared with the wild-type rice, but the seed setting rate, number of grains per plant, and yield per plant of the OsP2K1 RNAi plants were lower than those of the wild type, indicating that the seed setting rate of rice decreased after silencing the OsP2K1 gene, thereby further reducing the rice yield.

[0126] In summary, the present invention provides an application of the OsP2K1 gene in regulating broad-spectrum disease resistance and / or yield of rice. After overexpression of the OsP2K1 gene provided in the present invention in rice, it can effectively improve the broad-spectrum disease resistance of rice, and has good disease resistance effects on rice sheath blight, rice blast and rice bacterial blight, and can also increase the yield of crops. The present invention provides a new idea for rice disease control and the creation of new germplasms with broad-spectrum disease resistance and high yield in rice.

[0127] Although the above embodiments have made a detailed description of the present invention, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments without creative efforts as in this embodiment, and these embodiments all belong to the protection scope of the present invention.

Claims

1. Application of OsP2K1 gene in regulating broad-spectrum disease resistance and / or yield of rice, characterized in that: The amino acid sequence of the protein encoded by the OsP2K1 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that The broad-spectrum disease resistance of rice includes any one or more of rice blast resistance, rice sheath blight resistance and rice bacterial leaf blight resistance.

3. The use according to claim 1, characterized in that The regulation includes positively regulating the OsP2K1 gene to improve the broad-spectrum disease resistance and / or yield of rice, or negatively regulating the OsP2K1 gene to reduce the broad-spectrum disease resistance and / or yield of rice.

4. A biomaterial, characterized in that: The biological material includes a biological material that positively regulates the OsP2K1 gene of claim 1 and / or a biological material that negatively regulates the OsP2K1 gene of claim 1.

5. The biomaterial according to claim 4, characterized in that The biological material that positively regulates the OsP2K1 gene includes one or more of a primer set for amplifying the OsP2K1 gene, a recombinant expression vector containing the OsP2K1 gene, and a recombinant microorganism containing the OsP2K1 gene.

6. The biomaterial according to claim 4, characterized in that The biological material for negatively regulating the OsP2K1 gene includes a biological material for silencing the OsP2K1 gene and / or a biological material for knocking out the OsP2K1 gene; The biological material for silencing the OsP2K1 gene includes a recombinant silencing expression vector obtained by inserting the target sequence shown in SEQ ID NO. 3 into a silencing expression vector and / or a recombinant microorganism containing the recombinant silencing expression vector.

7. Use of the biological material according to any one of claims 4 to 6 in improving rice germplasm or creating new germplasm; The rice germplasm improvement includes regulating rice broad-spectrum disease resistance and / or yield; The creation of new germplasm includes any one or more of the following: Create rice with high and broad-spectrum disease resistance, create high-yield rice, create disease-susceptible rice models and create low-yield rice models.

8. A method for producing rice with broad-spectrum disease resistance and / or high yield, characterized in that: The steps include: The expression level of the OsP2K1 gene according to claim 1 in the target rice is increased to obtain the rice having broad-spectrum disease resistance and / or high yield.

9. The method according to claim 8, characterized in that The step of increasing the expression level of the OsP2K1 gene in the target rice comprises: transforming the plant overexpression vector of the OsP2K1 gene into the target rice by using a genetic transformation method.

10. A method for creating a rice model with disease susceptibility and / or low yield, characterized in that: The steps include: The expression level of the OsP2K1 gene according to claim 1 is reduced in the target rice to obtain the disease susceptible and / or low yield rice model.

Images