Effective tool for regulating chicken sex differentiation based on endoplasmic reticulum stress pathway and screening and verification method thereof

Abstract

The invention discloses an effective tool for regulating chicken sex differentiation based on an endoplasmic reticulum stress pathway and a screening and verification method thereof, the effective tool comprises a GRP78 overexpression vector and a CHOP overexpression vector, the GRP78 overexpression vector plays a role in chicken male differentiation, and the CHOP overexpression vector plays a role in chicken female differentiation. The key genes (CHOP and GRP78) of an IRE1a and CHOP pathway and a PERK-GRP78 pathway are regulated and controlled, the action mechanism of the key genes on gonad sex determining genes (such as DMRT1 and FOXL2) is discussed, and a new technical scheme is provided for poultry sex control and sex differentiation abnormity research.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and particularly relates to an effective tool for regulating chicken sex differentiation based on the endoplasmic reticulum stress pathway and a screening and verification method thereof. Background Art

[0002] Chicken sex differentiation is an important process that determines the sex ratio and production efficiency of poultry. Its mechanism involves the sex determination gene network (such as DMRT1, FOXL2) and endogenous signal regulation. The endoplasmic reticulum stress pathway plays an important role in cell function maintenance and embryonic development. The IRE1 and PERK pathways regulate apoptosis, proliferation, and gene expression by regulating downstream genes (such as CHOP, GRP78). However, the role of the endoplasmic reticulum stress pathway in chicken embryo sex differentiation has not been clarified. The present invention combines gene expression regulation technology to construct gene manipulation tools and explore the mechanism of the endoplasmic reticulum stress pathway regulating chicken sex differentiation. Summary of the Invention

[0003] Technical problems to be solved: Aiming at the above technical problems, the present invention provides an effective tool for regulating chicken sex differentiation based on the endoplasmic reticulum stress pathway and a screening and verification method thereof. By regulating the key genes (CHOP and GRP78) of the IRE1a-CHOP pathway and the PERK-GRP78 pathway, the mechanism of their action on gonadal sex determination genes (such as DMRT1 and FOXL2) is explored, providing a new technical solution for poultry sex control and research on abnormal sex differentiation.

[0004] Technical solution: In the first aspect, the present invention provides an effective tool for regulating chicken sex differentiation based on the endoplasmic reticulum stress pathway, including a GRP78 overexpression vector and a CHOP overexpression vector, wherein the GRP78 overexpression vector plays a role in chicken male differentiation, and the CHOP overexpression vector plays a role in chicken female differentiation.

[0005] Preferably, the nucleotide sequence of GRP78 is as shown in SEQ ID NO.1, the nucleotide sequence of CHOP is as shown in SEQ ID NO.2, and the overexpression vector backbone is PLVX. Specifically:

[0006] SEQ ID NO.1:

[0007] gggtgttcagcggcagttggagacgcgacgagcggcgagcgggcggcatgaggcacctcctgttggcgctgctgctgctgggcggcgcg

[0008] cgggcggacgatgaggagaaaaaggaggacgtgggcacggtggtgggcatcgacctcggtaccacctattcttgtgtgggtgtattcaaga

[0009] acggccgcgtggaaatcattgccaatgaccaggggaaccgcatcacgccatcctacgtggcgttcacgcctgagggggagcgcctgattg

[0010] gggatgcagccaagaaccagctgacatccaaccctgagaacactgtgtttgatgccaagcggctcataggccgcacctggaatgacccctct

[0011] gtacagcaggacatcaagtatctgcccttcaaggttgttgaaaagaaggccaagccacatattcaggtcgatgttggtggtggacaaacaaaa

[0012] acatttgctcctgaagaaatttctgccatggtcctgacaaagatgaaagaaactgcagaggcttatctgggcaagaaagttactcatgctgttgtt

[0013] actgtgccagcctacttcaatgatgctcagcgtcaggccacaaaagatgctggtaccattgctgggttgaacgtgatgcgcattattaatgagcc

[0014] aactgctgctgcaattgcatacggattggacaagagagagggtgaaaagaacatccttgtatttgacctgggtggtggaacttttgatgtctccc

[0015] tcctgacaattgacaacggagtctttgaagttgtggctacaaatggtgacacacacctgggtggagaagactttgaccagcgtgttatggagca

[0016] cttcatcaaactctacaagaagaaaacaggaaaagatgtcaggaaggataacagagctgtacagaaactaagacgggaagtagagaaagc

[0017] gaagcgggccctgtcatcccagcaccaagctagaattgaaatagaatccttttttgaaggagaggatttctctgagacgcttactcgtgccaaat

[0018] ttgaagaactgaatatggatctgttccgttctacgatgaagcctgttcagaaagttctggaagactctgacctaaagaagtctgatattgatgagat

[0019] tgttcttgttggtggttctactcgcatccccaaaatacaacaacttgttaaagagttcttcaatgggaaagagccttctcgtggcattaatccagatg

[0020] aagctgtagcctatggtgcagctgttcaggctggtgttctctctggggaccaagacacaggtgacctggtgttgcttgatgtgtgtcctctgaca

[0021] cttggcattgagacagttggaggtgtaatgactaaactgatcccaagaaatactgttgttcctaccaagaagtctcagatcttttccacagcttctg

[0022] acaatcagcccactgtgaccattaaggtctatgaaggtgaacgtcccctcaccaaggacaatcatcttctgggaacttttgatctgactggaatc

[0023] cctcctgctcctcgtggtgtcccacagattgaagttacctttgaaatagatgtgaatggaatccttcgtgtcacagctgaagacaaaggcactgg

[0024] gaacaaaaacaagatcacaattacaaatgatcagaatcggctaacaccagaggagattgagaggatggttaatgatgctgagaagtttgctga

[0025] ggaagacaaaaagcttaaagaacgcattgatgcccggaatgagctggagagctatgcgtattctttgaagaatcaaattggggacaaagaga

[0026] agctgggtggcaagctgtcatctgaagacaaagaaacaatagaaaaggcagtagaggaaaagatagagtggcttgaaagccatcaggatg

[0027] cagacattgaagacttcaaatcaaagaagaaggagctggaggaagttgttcaaccaattgttagcaagctctatggaagtgcaggcccccctc

[0028] ccactggtgaagaagaagcagcagagaaggatgagttgtagatactggcatctctgaatgttgtgtgtatatattggactcaggaacacttgtta

[0029] aaatattgaactcttaatttggaatgtaactttgaatcttcacttgtgagtggagctggaaatgctagcccgaagtggctgtttactgcttttcgttag

[0030] cagttgcttgatgtctggggagggaagggtagcaggggtgggactgtacatgagaaatgggtttagaaatattggccatggaagcattctatttaacagcttggtcatgtgaatttggtgtagaacttttctacctgaagtgaccacaataaatttgttatttacactgga;

[0031] SEQ ID NO.2:

[0032] ggcgcagatcggctgaacagcggagggcgatgcaacggagaatgagcggagcgcaccgggtgtggctgggctgcggggagccggga

[0033] ccgggcaggaaggcatccagaaggaagagcgtccttgtagggcagcacacgtgagagctgcaggtagcgggggggggcacagcccatt

[0034] tctgtttctccccccccattgctgtctcaacgtccccgggcgtccccttcaccgatggcggccgccggggagccgccctccgatgagctgccc

[0035] acgtggttcctggagctgcaggagctgctgatggcagcggagcccctcgagccccccgcccccgggggtgcacagcaggaagaagagct

[0036] ggccccactgtggggtgcaggggggcagccagtgtgctgtgagctggatgagacactgaatgcagagctgctgcagctcctggacccaga

[0037] cagcacggcgagcacagcaccagagcccccccagccccacgggagaccccccccacaggcagaggggcagcccgtggggcagagg

[0038] acaaagcggaagcgtgcaggcggggagcagcagagtgagcagcgcctgcggcagctgagtgcacacaacgagcggctccgggctgag

[0039] gtcgggcgactgagcgcagaggtgcagcacgcgcgggcagcgctcatcgagcgcgtcctcagcctccgccgtgcttagcagaatgggat

[0040] ggcacacccacggcacttggggggcagccccatggcatggactgatggcttccagcaccactgtacagcatttgttttattacatgtgtcagcgtggca。

[0041] In a second aspect, the present invention provides a method for screening and verifying the effective tool described in the first aspect, comprising the following steps:

[0042] S1. Detecting transcriptional differences at the critical developmental stage of bisexual chicken embryos;

[0043] S2. Detecting gene differences in the endoplasmic reticulum pathway of bisexual chicken embryos by RT-PCR;

[0044] S3. Detecting protein differences in the endoplasmic reticulum signaling pathway of the gonads of bisexual chicken embryos by Western blot;

[0045] S4. Construction and verification of GRP78 overexpression vector and CHOP overexpression vector;

[0046] S5. Injecting chicken embryos into blood vessels;

[0047] S6. HE section test: Sexual reversal occurs in the gonad tissues of both the GRP78 overexpression group and the CHOP overexpression group.

[0048] Preferably, the specific process of step S1 includes the following steps:

[0049] S1-1. Sample screening: All eggs are taken from Rugao yellow chickens. The eggs are incubated at 37 °C and 75% relative humidity for 18.5 d, and then the chicken embryos are separated, and the genital ridges or gonads are obtained as samples;

[0050] S1-2. Extracting sample DNA and RNA;

[0051] S1-3. Transcriptome sample sequencing and analysis: The extracted DNA and RNA are sequenced, and the obtained data are subjected to bioinformatics analysis. The differential gene expression levels are obtained through high-throughput whole-genome sequencing, and the data are shown in the attached table counts: the number of reads mapped to each gene or transcript on the genome or transcriptome and the number of fragments per kilobase of transcript per million mapped reads fpkm;

[0052] S1-4. Data analysis: By clustering differential genes, the endoplasmic reticulum stress signaling pathway is enriched.

[0053] Preferably, the specific process of step S2 includes the following steps:

[0054] S2-1. Quantitative detection: Collect samples to extract RNA. After reverse transcribing the RNA into cDNA using a reverse transcription kit, detect the expression levels of relevant genes using a quantitative detection kit.

[0055] S2-2. Data analysis: Analyze the PCR products by fluorescence quantitative PCR method, compare the expression levels of target genes in chicken embryos of different genders, calculate the fold change, and perform statistical analysis to determine whether the differences are statistically significant.

[0056] Furthermore, the amplification primers for GRP78 in fluorescence quantitative PCR are shown as SEQ ID NO.3 - SEQ ID NO.4, and the amplification primers for CHOP are shown as SEQ ID NO.5 - SEQ ID NO.6. Specifically:

[0057] SEQ ID NO.3 (GRP78-F): GAACCAGCTGACACCAACC;

[0058] SEQ ID NO.4 (GRP78-R): ACCACCAACATCGACCTGAA;

[0059] SEQ ID NO.5 (CHOP-F): CTCCGATGAGCTGCCCAC;

[0060] SEQ ID NO.6 (CHOP-R): CTCCGATGAGCTGCCCAC.

[0061] Preferably, the specific process of step S3 is to extract sample proteins, perform Western blot detection, and analyze the differences in GRP78 and CHOP proteins in the gonads of chicken embryos of both genders.

[0062] Preferably, the specific process of step S4 includes the following steps:

[0063] S4-1. Primer design for target genes GRP78 and CHOP;

[0064] S4-2. Amplification and purification of sample DNA;

[0065] S4-3. Ligate the digested products with the vector backbone, ligate the two target genes with the PLVX vector backbone to obtain the GRP78 overexpression vector and the CHOP overexpression vector;

[0066] S4-4. Transform competent cells, ligate the digested products with competent cells (brand: Tsingke; catalog number: TSC-C01);

[0067] S4-5. Uniformly smear the ligation product on the LB solid medium containing 0.1% ampicillin resistance, pick a single independent white colony and place it in a 1.5 mL centrifuge tube containing liquid medium, and send it to the company for sequencing.

[0068] Preferably, the specific process of step S5 includes the following steps:

[0069] S5-1. Transform competent cells and ligate the digested product with competent cells;

[0070] S5-2. Uniformly smear the ligation product on the LB solid medium containing 0.1% ampicillin resistance, pick a single independent white colony and place it in a 1.5 mL centrifuge tube containing liquid medium, and send it to the sequencing company for sequencing, and screen out the correctly sequenced plasmid vector for standby;

[0071] S5-3. Cell transfection: Uniformly seed the commercial DF-1 cells at a density of 2×10 5 in a 24-well plate and incubate overnight. Add the GRP78 and CHOP overexpression plasmids, transfection reagent FUGENE, and opti-DMEM medium to the cells, take pictures after 48 h of transfection. If the proportion of red fluorescent cells is not less than 80%, the cell transfection is successful;

[0072] S5-4. Collect the RNA of DF-1 cells after transfection, and detect the gene expression levels of the GRP78 and CHOP overexpression groups. If the expression level of the target gene is up-regulated, the function of the overexpression vector is verified.

[0073] Preferably, in step S6, the ovarian tissue cortex of the GRP78 overexpression group is shrunken, thinned, the structure is damaged, there is no follicular cavity structure, and the testicular tissue structure is damaged, and there is no seminiferous tubule segment structure; in the CHOP overexpression group, the ovarian cortex is shrunken, thinned, there is sex reversal, the male cortex is thickened, there are irregular follicular cavity structures, and there is sex reversal.

[0074] Beneficial effects: By the method of the present invention, sex reversal can be achieved at the early stage of chicken embryo development, and the sex reversal of chickens can be realized more conveniently and effectively, and a new technical solution for chicken sex reversal is provided. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 is a bright-field image of the gonads of E18.5d chicken embryos in the present invention (under a stereomicroscope). The position circled by the black dotted line is the incompletely developed gonad, and the lower left horizontal line is the scale bar;

[0076] Figures 2 - 3 is the result graph of transcriptome analysis in the present invention. Among them, Figure 2 A is the principal component analysis (PCA analysis) graph using the gene expression levels; Figure 2B is a correlation coefficient graph between sequencing samples obtained based on gene expression. The vertical axis represents the corresponding sample names, and the colors represent the magnitudes of the correlation coefficients. Figure 2 C is a result graph of standardizing the counts of genes in each sample using the DESeq[6] software. Figure 2 D is a statistical result graph of differentially expressed genes. The horizontal axis is the sample names, the vertical axis is the gene expression levels, the red represents highly expressed genes, and the blue represents lowly expressed genes. Figure 3 A is a statistical bar graph of differentially expressed genes. Among them, the horizontal axis is each comparison group, and the vertical axis is the number of differential genes in the comparison group, showing the number of differential genes under different signaling pathways. Figure 3 B is a signaling pathway graph of differential gene enrichment. Figure 3 C is a result graph of GSEA analysis.

[0077] Figure 4 This is a bar graph of the expression levels of related genes in the E18.5d gonads for quantitative detection of the present invention. Among them, Figure 4 A shows the differential expression of genes related to the endoplasmic reticulum stress signaling pathway in the gonads of male and female chicken embryos. Figure 4 B shows the differential expression of genes related to sex differentiation in the gonads of male and female chicken embryos.

[0078] Figure 5 Westren blot was used to detect the differential expression of proteins related to the endoplasmic reticulum stress signaling pathway in the E18.5d gonads of male and female chicken embryos.

[0079] Figure 6 This is a verification graph showing that there are no multiple binding sites after the selected primers are inserted into the genomic sequence.

[0080] Figures 7 - 9 This is the construction and verification results of the overexpression vectors of GRP78 and CHOP. Among them, Figure 7 A is the vector map constructed. Figure 7 B is the PCR graph of the uncut vector and the double-digested vector. Figure 8 This is the sequencing result of the picked clone colonies. Figure 9 A is the red fluorescence graph and bright field graph after cell transfection. Figure 9 B is to collect samples from the transfected cells and detect the expression levels of the overexpressed target genes.

[0081] Figure 10 This is a schematic diagram of chicken embryo vascular injection.

[0082] Figure 11 This is a graph showing the gonads collected from chicken embryos injected with the overexpression vector at E18.5d and observing the gonad development status by HE section. Detailed implementation methods

[0083] The present invention is described in detail below in conjunction with the accompanying drawings and specific embodiments:

[0084] Example

[0085] 1. Detection of transcript differences during the critical development period of male and female chicken embryos

[0086] 1. Sample extraction: All eggs were taken from Rugao yellow chickens (Poultry Research Institute, Chinese Academy of Agricultural Sciences), and the eggs were incubated at 37°C and 75% relative humidity for 18.5 days. Figure 1 As shown in the figure, 18.5-day-old chicken embryos were isolated from incubated eggs: the embryos were exposed by knocking and opening the eggshell with a blunt tip, taken out and placed in a culture dish containing PBS; then, the genital ridges or gonads were obtained by peeling off the embryonic membrane and tearing the ventral skin with forceps. The genital ridges were closely attached to both sides of the mesonephros, and the males were symmetrical in size, while the female ovaries were smaller in development due to the final degeneration of the right ovary.

[0087] 2. Tissue sample DNA and RNA extraction kits are as follows:

[0088] Blood / cell / tissue genomic DNA extraction kit (DP304);

[0089] RNAsimple Total RNA Isolation Kit (DP419).

[0090] 3. Transcriptome sample testing: DNA and RNA of 3 gonadal tissue samples from males and females were sent to OuYiyun Company for high-throughput sequencing.

[0091] 4. Data analysis: Through principal component analysis, the results are as follows Figure 2 As shown in A: There are significant differences between F (1, 2, 3) and M (1, 2, 3), that is, between males and females. In addition, the gene expression distribution of the six samples was statistically analyzed, as shown in Figure 2 As shown in B: The closer the correlation coefficients of F1, F2, F3 and M1, M2, M3 replicates are to 1, the higher the similarity of expression patterns between samples is, indicating that the results are statistically significant. The DESeq2 package with |log2FC|≥1 and P adjustment <0.05 was used as the screening criteria for cluster analysis. The results are shown in Figure 2 C- Figure 2 D shows: The heat map of differentially expressed genes was determined. It is worth noting that samples in the same group were clustered together, which further verified the accuracy of the sequencing results. At the same time, the DESeq[6] software was used to standardize the number of gene counts in each sample (using the basemean value to estimate the expression level), calculate the difference fold, and use NB (negative binomial distribution test) to perform a significant difference test on the number of reads. The results are shown in Figure 2. Figure 3As shown in A: 2499 differential genes were successfully screened out. At the same time, the Cytoscape software was used to visualize the DEGs related to male and female differentiation in the GO and KEGG pathways( Figure 3 B). The results of the GSEA analysis are as Figure 3 shown in C: The gene set related to the endoplasmic reticulum stress signaling pathway was significantly upregulated in Female and significantly downregulated in Male. In summary, the endoplasmic reticulum stress signaling pathway plays a crucial role in the process of male and female differentiation.

[0092] II. Detection of differences in endoplasmic reticulum pathway genes in male and female chicken embryos by RT-PCR

[0093] 1. Quantitative detection: Samples (Rugao Yellow Chickens) were collected, RNA was extracted, and after reverse-transcribing the RNA into cDNA using a reverse transcription kit, the expression of related genes GRP78 and CHOP was detected using a quantitative detection kit. The quantitative detection results are shown in Figure 4 : Among them Figure 4 A shows the differential expression of genes related to the endoplasmic reticulum stress signaling pathway in the gonads of male and female chicken embryos, Figure 4 and B shows the differential expression of genes related to sex differentiation in the gonads of male and female chicken embryos. The results show that at E18.5d of chicken embryo development, there are significant differences in the GRP78 and CHOP genes between male and female gonads.

[0094] 2. Data analysis

[0095] The PCR products were analyzed by methods such as fluorescence quantitative PCR. The expression levels of the target genes in chicken embryos of different sexes were compared, the fold differences were calculated, and statistical analysis was performed to determine whether the differences were statistically significant. When performing RT-PCR detection, the following points need to be noted: Ensure the quality and integrity of RNA to avoid RNA degradation. Optimize primer design to ensure the specificity and amplification efficiency of the primers. The RNA samples collected were the gonads of E18.5d male and female embryos, with GAPDH as the housekeeping gene and set as the internal reference, and genes related to sex differentiation as the accuracy reference to detect the expression differences of endoplasmic reticulum-related genes between the two. The primer sequences used are shown in Table 1 below:

[0096] Table 1 Amplification primers corresponding to each gene

[0097] Sequence number Name Sequence SEQ ID NO.7 cAMH - F CCCCTCTGTCCCTCATGGA SEQ ID NO.8 cAMH - R CGTCATCCTGGTGAAACACTTC SEQ ID NO.9 cWNT4 - 2F GAGCTGGACAAGTGTGGATG SEQ ID NO.10 cWNT4 - 2R TCTGTTGGAAGATGCCCCTT SEQ ID NO.11 cCYP19A1 - 3F GAATTCTTCCCAAAACCGAATGAG SEQ ID NO.12 cCYP19A1 - 3R GCACCGTCTCAGAAGAGTCACCAG SEQ ID NO.13 cFOXL2 - 1F AGTACCTGCAGTCCACCTTC SEQ ID NO.14 cFOXL2 - 1R TAGGAGTTCACCATGCCAGG SEQ ID NO.15 SOX9 - RT - F AGTACCCGCATCTGCACAA SEQ ID NO.16 SOX9 - RT - R CCTCCTGCGTGGTTGGTA SEQ ID NO.17 cDMRT1 - 1F GCCTCCCAGCAACATACATG SEQ ID NO.18 cDMRT1 - 1R TCCCTTTCATCTGCCACTGT SEQ ID NO.19 cPERK - 1F GCTGCGAGTCAGTAATGGGTATAA SEQ ID NO.20 cPERK - 1R CTGCCAGGAAACTTGCCACA SEQ ID NO.21 cIRE1α - F CGGGAGAACATCACTGTCCC SEQ ID NO.22 cIRE1α - R CCCGGTAGTGGTGCTTCTTA SEQ ID NO.23 cATF6 - 1F AGCCCGACTCATTTCAGGAA SEQ ID NO.24 cATF6 - 1R CTGAACAAGTTGAAGGCGCT SEQ ID NO.25 cCYP11A1 - 2F GGTTGGCTCAACCTGTACCA SEQ ID NO.26 cCYP11A1 - 2R CCCTGTAGATGGGCCCAAAG SEQ ID NO.27 cCalnexin - 2F TTCTGCTGCTCTGGGAAGAA SEQ ID NO.28 cCalnexin - 2R TGCATGTTTCCTGTCCTCCT SEQ ID NO.29 cCYP17A1-1F CTGCTCCGCCACCTCAAC SEQ ID NO.30 cCYP17A1-1R CCCGGTAAACGTTTGGATACA SEQ ID NO.31 GAPDH-1F TGGGAAGCTGTGGAGAGAGATG SEQ ID NO.32 GAPDH-1R GCAGGTCAGGTCAACAACAG

[0098] Quantitative detection of differential genes related to endoplasmic reticulum stress and sex differentiation in the gonads of E18.5d embryos showed significant differences in the GRP78 and CHOP genes, with obvious original differences.

[0099] III. Detection of differences in endoplasmic reticulum signaling pathway proteins in the gonads of male and female chicken embryos by Western blot

[0100] 1. Sample extraction: All eggs were obtained from Rugao Yellow Chickens (Poultry Research Institute, Chinese Academy of Agricultural Sciences). The eggs were incubated at 37 °C and 75% relative humidity for 18.5 days. Chicken embryos at 18.5 days were isolated from the hatched eggs: The embryos were exposed by tapping and opening the blunt end of the eggshell, removed and placed in a Petri dish containing PBS. Then, the genital ridges or gonads were obtained by peeling the embryonic membrane and tearing the ventral skin with forceps.

[0101] Protein extraction: The separated gonads were ground into pieces, pre-cooled RIPA lysis buffer containing protease inhibitor was added, and gently shaken and mixed to allow the lysis buffer to fully contact the cells. Lysis was carried out on ice for 5 minutes. The lysate and cell debris were transferred to a 1.5 mL centrifuge tube using a pre-cooled cell scraper and pipette, placed on ice for 30 minutes, and shaken every 10 minutes for 1 minute each time. Centrifugation was carried out at 4 °C and 14000 rpm for 15 minutes, and the supernatant after centrifugation was the total protein.

[0102] 2. Protein concentration determination:

[0103] (1) The BCA standard product formula is shown in Table 2 below.

[0104] Table 2 BCA standard product formula

[0105]

[0106] (2) Preparation of BCA working solution

[0107] Using the microplate detection method, 200 μL of the working solution was injected into each well. The working solution was prepared by mixing BCA standard product Solution A and Solution B in a volume ratio of 50:1. After thorough mixing, it showed a turquoise color and needed to be prepared and used immediately.

[0108] (3) Quantitative detection of protein concentration

[0109] 25 μL each of the prepared standard solution and the sample to be tested were placed into the corresponding wells of a 96-well plate, and 200 μL of the BCA working solution was added to each well for mixing. After thorough mixing, the plate was incubated at 37 °C for 30 minutes, and after incubation, it was allowed to cool to room temperature. Subsequently, the absorbance of the sample was measured using a spectrophotometer at a wavelength of 562 nm, and a standard curve was established based on the concentration and absorbance of the standard product (confidence interval R2 ≥ 99%). Finally, the total protein concentration in each sample to be tested was calculated based on this standard curve.

[0110] 3. Calculate the sample loading amount: Cell samples were treated with RIPA lysis buffer to obtain proteins, and the protein concentration was measured according to the above method to ensure that the protein loading amount of all samples was 20 μg.

[0111] 4. Protein denaturation treatment: Mix the protein sample with SDS loading buffer and heat it in a water bath at 100 °C for 10 min to achieve denaturation.

[0112] 5. Protein electrophoresis and transfer: Separate proteins by electrophoresis using an 8% SDS-PAGE gel, and then transfer them to a membrane using a semi-dry transfer system. The transfer parameters are set as follows: All proteins are transferred at a voltage of 11 V for 23 min, and then continue to transfer at a voltage of 20 V for 27 min.

[0113] 6. Blocking: Block the membrane with a TBST solution containing 5% skim milk powder at room temperature for 2 h, and then wash it three times with 1×TBST buffer on a shaker at room temperature for 10 min each time.

[0114] 7. Antibody incubation and development: After washing, incubate the membrane with the primary antibody overnight at 4 °C; the next day, remove the primary antibody, wash the membrane again, and then incubate the membrane with the corresponding secondary antibody for 2 h, and develop using the ECL chemiluminescence method to record the imaging results.

[0115] 8. Data analysis: As Figure 5 shown: Western blot was used to detect the differences in GRP78 and CHOP proteins in the gonads of bisexual chicken embryos. The results showed differences between male and female samples, and the expression levels of GRP78 and CHOP proteins were higher in female samples.

[0116] IV. Construction of GRP78 overexpression vector and CHOP overexpression vector

[0117] 1. Amplification of target genes

[0118] (1) Through the Gene option of NCBI, query the full-length genes of the target genes GRP78 and CHOP, as shown in SEQ ID NO.1-2;

[0119] (2) Copy them into Primer 6 software, design amplification primers, and select the primer sequences with the highest scores, as follows:

[0120] GRP78-F: GAACCAGCTGACATCCAACC;

[0121] GRP78-R: ACCACCAACATCGACCTGAA;

[0122] CHOP-F: CTCCGATGAGCTGCCCAC;

[0123] CHOP-R: CTCCGATGAGCTGCCCAC;

[0124] (3) Screen whether the primers selected by BLAST alignment on NCBI have multiple binding sites and mismatches. Figure 6 They are the full gene sequences of GRP78 and CHOP from chickens searched on NCBI. The primers bind to the gene sequences, and each primer has only one binding site. Write the primer sequences into Snapgene, and select the primer sequences with a single binding site for each;

[0125] (4) Send the designed amplification primers to the company for synthesis.

[0126] 2. DNA extraction refers to the operation steps of the Blood / Cell / Tissue Genomic DNA Extraction Kit (TIANGENG, DP304).

[0127] 3. PCR amplification of the target gene fragment:

[0128] (1) The reaction system is shown in Table 3 below:

[0129] Table 3 PCR reaction system

[0130]

[0131] (2) Reaction program: 95°C for 3 min, (95°C - 15 sec, 60°C - 15 sec, 72°C - sec) for 40 cycles, 72°C for 5 min.

[0132] 4. DNA product purification refers to the operation steps of the Ordinary DNA Product Purification Kit (Tiangen, DP204).

[0133] 5. Enzyme digestion experiment:

[0134] Reaction system: 10 units of restriction endonuclease: 1 μL; DNA: 1 μg; 10×NEBuffer: 5 μL (1×); total reaction system 50 μL. Incubation time: 1 hour; obtain linear target gene fragments and linear vectors.

[0135] 6. Vector ligation:

[0136] Ligate the linear target gene fragment with the vector backbone PLVx through T4 ligase. The specific steps are as follows:

[0137] a. Components: 2 μL of T4 DNA Ligase Buffer (10×), 50 ng (0.020 pmol) of vector DNA (4 kb), 37.5 ng (0.060 pmol) of target fragment DNA (1 kb), 1 μL of T4 DNA ligase, add water (Nuclease-free water) to 20 μL;

[0138] b. Blow and beat up and down and centrifuge briefly, gently mix the reaction solution;

[0139] c. Incubate overnight at 16 °C;

[0140] d. For blunt ends or single-base overhangs, incubate overnight at 16 °C;

[0141] e. Inactivate by heating at 65 °C for 10 minutes;

[0142] The obtained plasmid map is as shown in A in Figure 7 and the electrophoresis result is as shown in B in Figure 7 .

[0143] 7. Transformation of competent cells

[0144] (1) Take 5 μL of the ligation product and mix it with 50 μL of competent cells, incubate on ice for 25 min;

[0145] (2) Heat shock at 42 °C for 45 - 60 sec, quickly incubate on ice for 2 min.

[0146] 8. Picking positive clones

[0147] (1) Prepare solid LB medium: Prepare 500 μL of medium: peptone: 5 g, yeast extract: 2.5 g, salt: 5 g, agar: 7.5 g, after autoclaving, add 500 μL of ampicillin resistance (concentration 0.1%), pour it into a large molecular dish and cool;

[0148] (2) Take 50 μL of the transformed competent cells in step 7 and spread them evenly on the LB plate, place it in a constant temperature incubator at 37.5 °C for one hour, then invert the plate and continue to incubate overnight;

[0149] (3) Pick a single white colony and place it in 500 μL of LB liquid medium, take 200 μL for sequencing, and the sequencing result is as shown in Figure 8 . The overexpression vector of GRP78 gene and CHOP gene was successfully constructed and the vector was verified in DF-1 cells. Since the overexpression vector carried the Mcherry red fluorescent element, the result showed that it was successfully transferred into DF-1 cells; the overexpression efficiency was quantitatively verified and it was found that the expression level of the target gene in the overexpression group of cells increased.

[0150] 9. Shaking bacteria

[0151] After successful sequencing, take 50 μL of the remaining medium containing colonies in step 8 and add it to 50 mL of LB liquid medium for shaking bacteria. After 12 - 16 h, perform large-scale plasmid extraction.

[0152] 10. Plasmid extraction refers to the operation steps of the endotoxin-free plasmid mini extraction kit (Tiangen, DP123).

[0153] 11. Cell Transfection

[0154] (1) Select DF-1 cells in good growth state, count the cells, seed them into a 12-well plate, and culture overnight;

[0155] (2) Add the plasmid to be transfected and the transfection reagent into the cell culture medium according to the ratio, take pictures and samples after culturing for 48 hours. The transfection effect is judged by the cell fluorescence rate. As shown in A below: The proportion of red fluorescent cells accounts for 80% of the total cell amount, indicating successful cell transfection. Figure 9 as shown in A: The proportion of red fluorescent cells accounts for 80% of the total cell amount, indicating successful cell transfection.

[0156] 12. Quantitative Detection

[0157] (1) Extract RNA from the collected cells and reverse transcribe the RNA into cDNA using a reverse transcription kit;

[0158] (2) Detect the expression of related genes through a quantitative detection kit. The quantitative detection results are as shown in B below: Compared with the experimental group, CHOP and GRP78 both decreased in the overexpression group, indicating that the interference group successfully interfered with the expression of the target gene. Figure 9 as shown in B: Compared with the experimental group, CHOP and GRP78 both decreased in the overexpression group, indicating that the interference group successfully interfered with the expression of the target gene.

[0159] V. Chicken Embryo Vascular Injection, as shown in Figure 10 shown below:

[0160] 1. Preparation of Exogenous Substances:

[0161] a. Vector Preparation: The transfection vector and liposome are used in combination. The plasmid needs to be de-endotoxin treated;

[0162] b. Mixing Ratio: Mix the transfection plasmid (by mass) and liposome (by volume) at a ratio of 1:3;

[0163] c. Incubation: Incubate the mixed transfection complex in an incubator at 37°C for 20 minutes for later use.

[0164] 2. Chicken Embryo Preparation:

[0165] a. Incubation: Take fresh fertilized eggs and place them in an incubator for incubation until 48 - 58 hours (13 - 17 HH);

[0166] b. Disinfection: Soak and clean the eggshell with 0.1% bromogeramine solution, and then wipe the surface of the eggshell with 75% alcohol;

[0167] c. Opening: Gently tap the top of the embryo egg with surgical forceps to open a round hole with a diameter not greater than 1 cm.

[0168] 3. Searching for Chicken Embryo Blood Vessels:

[0169] a. Locate the embryo: Locate the position of the embryo under a stereomicroscope;

[0170] b. Expose the blood vessels: Gently pick open the outer shell membrane with ophthalmic forceps to expose the embryonic blood vessels.

[0171] 4. Chicken embryo blood vessel injection:

[0172] a. Fill the syringe: Slowly aspirate the exogenous substance with a micropipette and fill it into the glass needle, avoiding air bubbles from flushing in;

[0173] b. Adjust the air pressure: Adjust the air pressure of the syringe according to the injection volume;

[0174] c. Injection: Under a stereomicroscope, slowly insert the injection needle along the direction of the embryonic dorsal aorta blood vessel and inject the exogenous substance.

[0175] 5. Post-injection treatment:

[0176] a. Antibiotic treatment: Add 200 μL of penicillin-streptomycin to the injection site after injection;

[0177] b. Sealing: Seal with medical tape;

[0178] c. Continue incubation: Put the treated chicken embryos back into the incubator, keep the incubation temperature at 38 °C and the humidity at 80%, and process according to the requirements of subsequent experiments.

[0179] VI. HE section test:

[0180] 1. Sample acquisition and fixation

[0181] a. Specimen collection: Take out the gonadal tissue from chicken embryos hatched to E18.5;

[0182] b. Fixation: Quickly put the taken-out gonadal tissue into the pre-prepared fixing solution, such as 10% neutral buffered formaldehyde fixing solution, and the fixation time is usually 24 hours to maintain the morphological structure of the tissue.

[0183] 2. Tissue processing

[0184] a. Dehydration: Put the fixed tissue into ethanol with different concentrations in turn for dehydration, usually from low concentration to high concentration. The specific dehydration steps are as follows:

[0185] 30% or 50% alcohol: 1 - 2 hours; 70% alcohol: 1 - 2 hours; 85% alcohol: 1 - 2 hours; 95% alcohol: 1 - 2 hours; absolute ethanol: 1 - 2 hours; absolute ethanol: 1 - 2 hours;

[0186] b. Clearing: After dehydration, put the tissue into xylene for clearing treatment, usually need to soak for 1 - 2 hours to make the tissue transparent;

[0187] c. Wax infiltration: Place the clarified tissue into the melted paraffin for wax infiltration, which usually takes 1 - 2 hours of soaking.

[0188] 3. Tissue embedding: Put the wax-infiltrated tissue block into an embedding cassette with the cut surface facing down, pour in liquid paraffin, and after the paraffin solidifies, the tissue block is embedded.

[0189] 4. Slide preparation

[0190] a. Slicing: Fix the embedded wax block on a microtome, adjust the slice thickness to 4 - 5 microns, and make continuous sections.

[0191] b. Spreading: Place the cut thin slices into heated water to flatten them, and then use forceps to attach the flattened sections to the glass slides.

[0192] c. Baking: Place the glass slides with the attached sections on a baking oven at 65°C for 1 hour, and then put them into an oven for baking for 2 hours to firmly attach the sections to the glass slides.

[0193] 5. Staining

[0194] a. Dewaxing: Immerse the sections in xylene for 10 minutes to remove the paraffin.

[0195] b. Hydration: Immerse the dewaxed sections successively in absolute ethanol, 95% ethanol, 80% ethanol, and 70% ethanol for hydration, soaking in each concentration of ethanol for a certain period of time.

[0196] c. Hematoxylin staining: Immerse the hydrated sections in hematoxylin staining solution for 10 - 20 minutes.

[0197] d. Differentiation and bluing: Differentiate the sections with 1% hydrochloric acid ethanol to remove the excessive stain in the cell nuclei and the redundant stain in the cytoplasm. Then use a weakly alkaline bluing solution to make the cell nuclei stained blue.

[0198] e. Eosin staining: Immerse the sections in eosin staining solution for 2 - 3 minutes.

[0199] 6. Dehydration and coverslipping

[0200] a. Dehydration: Immerse the stained sections successively in 80%, 95%, and absolute ethanol for dehydration.

[0201] b. Clearing: Immerse the dehydrated sections in xylene for clearing.

[0202] c. Coverslipping: Drop an appropriate amount of coverslipping medium (such as Canada balsam) on the sections, then cover with a coverslip and gently press to evenly distribute the coverslipping medium.

[0203] 7. Result observation

[0204] Microscopic observation: Place the section after mounting on the microscope for observation. The cell nuclei appear blue, while the cytoplasm, muscle fibers, collagen fibers, and red blood cells appear red with varying shades.

[0205] The results are as Figure 11 shown: In the normal group, PBS solution was injected as the normal group. In the overexpression GRP78 group, the ovarian cortical tissue was shrunk, thinned, and the structure was damaged, without follicular cavity structure; while in the testicular tissue, the structure was damaged, without seminiferous tubule node structure. In the overexpression CHOP group, the ovarian cortex was shrunk, thinned, with sex reversal phenomenon; the male cortex was thickened, with irregular follicular cavity structure and sex reversal phenomenon.

[0206] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An effective tool for regulating chicken sex differentiation based on the endoplasmic reticulum stress pathway, characterized by: The invention comprises a GRP78 overexpression vector and a CHOP overexpression vector, wherein the GRP78 overexpression vector plays a role in chicken male differentiation, and the CHOP overexpression vector plays a role in chicken female differentiation.

2. The effective tool according to claim 1, characterized in that: The nucleotide sequence of GRP78 is shown in SEQ ID NO.1, the nucleotide sequence of CHOP is shown in SEQ ID NO.2, and the overexpression vector backbone is PLVX.

3. A method for screening and verifying effective tools according to claim 1 or 2, characterized in that: The following steps are involved: S1. Detection of transcript differences during the critical development period of male and female chicken embryos; S2, RT-PCR detection of endoplasmic reticulum pathway gene differences between male and female chicken embryos; S3, Western blot detection of the difference in endoplasmic reticulum signaling pathway proteins in gonads of male and female chicken embryos; S4, construction and verification of GRP78 overexpression vector and CHOP overexpression vector; S5, chick embryo vascular injection; S6. HE section test: The gonadal tissues of both the GRP78 overexpression group and the CHOP overexpression group showed sex reversal.

4. The screening and verification method according to claim 3, characterized in that: The specific process of step S1 includes the following steps: S1-1. Sample screening: All eggs were taken from Rugao yellow chickens. The eggs were incubated at 37°C and 75% relative humidity for 18.5 days, the chicken embryos were separated, and then the genital ridges or gonads were obtained as samples; S1-2, sample DNA and RNA extraction; S1-3. Transcriptome sample sequencing and analysis: The extracted DNA and RNA were sequenced, and the obtained data were analyzed by bioinformatics. The differential gene expression was obtained by high-throughput whole-genome sequencing. The data are shown in the attached table counts: the number of reads mapped to each gene or transcript on the genome or transcriptome and the number of fragments per million mapped reads per kilobase of transcription fpkm; S1-4. Data analysis: By clustering the differentially expressed genes, they were enriched in the endoplasmic reticulum stress signaling pathway.

5. The screening and verification method according to claim 3, characterized in that: The specific process of step S2 includes the following steps: S2-1, quantitative detection: Collect samples to extract RNA, use a reverse transcription kit to reverse the RNA into cDNA, and then use a quantitative detection kit to detect the expression of related genes; S2-2. Data analysis: The PCR products were analyzed by fluorescent quantitative PCR method, the expression levels of target genes in chicken embryos of different sexes were compared, the difference multiples were calculated, and statistical analysis was performed to determine whether the differences were statistically significant.

6. The screening and verification method according to claim 5, characterized in that: In the fluorescent quantitative PCR, the amplification primers of GRP78 are shown as SEQ ID NO.3-SEQ ID NO.4, and the amplification primers of CHOP are shown as SEQ ID NO.5-SEQ ID NO.

6.

7. The screening and verification method according to claim 3, characterized in that: The specific process of step S3 is to extract sample protein, perform Western blot detection, and analyze the differences in GRP78 and CHOP proteins in the gonads of male and female chicken embryos.

8. The screening and verification method according to claim 3, characterized in that: The specific process of step S4 includes the following steps: S4-1, primer design of target genes GRP78 and CHOP; S4-2, amplification and purification of sample DNA; S4-3, the enzyme digestion product was connected to the vector backbone, and the two target genes were connected to the PLVX vector backbone to obtain the GRP78 overexpression vector and the CHOP overexpression vector; S4-4, transform competent cells and connect the enzyme digestion products with competent cells; S4-5. Spread the ligation product evenly on LB solid culture medium containing 0.1% ampicillin resistance, select a single independent white colony and place it in a 1.5 mL centrifuge tube containing liquid culture medium, and send it to the company for sequencing.

9. The screening and verification method according to claim 3, characterized in that: The specific process of step S5 includes the following steps: S5-1, transform competent cells and connect the digestion product with competent cells; S5-2. Spread the ligation product evenly on LB solid medium containing 0.1% ampicillin resistance, select a single independent white colony and place it in a 1.5 mL centrifuge tube containing liquid medium, send it to a sequencing company for sequencing, and select the plasmid vector with correct sequencing for use; S5-3. Cell transfection: Commercial DF-1 cells were transfected at 2×10 5 The cells were evenly plated in a 24-well plate at a density of 100 μg / ml and kept overnight for later use. GRP78 and CHOP overexpression plasmids, transfection reagent FUGENE, and opti-DMEM culture medium were added to the cells. After 48 h of transfection, photos were taken. If the proportion of red fluorescent cells was not less than 80%, the cells were successfully transfected. S5-4. Collect RNA from transfected DF-1 cells and detect gene expression levels in the GRP78 and CHOP overexpression groups. If the expression level of the target gene is upregulated, the function of the overexpression vector is verified.

10. The screening and verification method according to claim 3, characterized in that: In step S6, the ovarian tissue cortex of the GRP78 overexpression group was shrunk, thinned, and its structure was destroyed, without follicular cavity structure, while the testicular tissue structure was destroyed, without seminiferous tubule segment structure; the ovarian cortex of the CHOP overexpression group was shrunk, thinned, and had sex reversal phenomenon, while the male cortex was thickened, with irregular follicular cavity structure and sex reversal phenomenon.

Images