Application of vitellogenin gene in regulation and control of lipid metabolism and crawling behavior of bees

Micro-injection of mixed siRNA significantly inhibits the expression of yolkin protein genes in bees' brains, solves the problems of lipid metabolism and crawling behavior regulation, achieves efficient and precise regulation of bees' behavior, and is friendly to bees without affecting its survival rate.

CN120092756AActive Publication Date: 2025-06-06INST OF QUALITY STANDARD & TESTING TECH FOR AGRO PROD OF CAAS
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510197301.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-21
Publication Date
2025-06-06
Estimated Expiration
2045-02-21

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate the lipid metabolism and crawling behavior of bees, and the knockdown effect of a single siRNA is poor and the screening work is complicated.

Method used

Mixed siRNA by microinjection, specifically, injecting siRNA mixtures of specific sequences such as Vg_3408, Vg_2276, Vg_2641 into the brain of bees, significantly inhibiting the expression of yolkenin genes, thereby regulating bees' lipid metabolism and crawling behavior.

Benefits of technology

It significantly inhibited bees' crawling behavior, including a significant slowdown in crawling speed and distance, and regulated bees' lipid metabolism, significantly altered the significantly increased lipid levels of 13 lipids and significantly decreased 11 lipid levels in the bee brain. At the same time, this method is friendly to bees and does not affect the survival rate of bees.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120092756A_ABST
    Figure CN120092756A_ABST
Patent Text Reader

Abstract

The invention discloses an application of a vitellogenin gene in regulating and controlling lipid metabolism and crawling behaviors of bees. The invention relates to a novel technology for regulating and controlling lipid metabolism and crawling behaviors of bees by knocking down vitellogenin gene expression, in particular to a method for inhibiting vitellogenin (Vg) gene expression by microinjection of mixed siRNA of three specific sequences into the brains of bees. Therefore, the possible effect of the compound in regulation and control of lipid metabolism and crawling behaviors of bees is explored. Results show that Vg gene expression of bee brains is significantly inhibited after microinjection of mixed siRNA, lipid metabolism of bees is significantly regulated and controlled, and crawling behaviors of bees are inhibited. Meanwhile, the behavior regulation and control technology involved in the invention is friendly to bees.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of vitellogenin gene in regulating honey bee lipid metabolism and crawling behavior. Background Art

[0002] As an important pollinating insect, bees play an indispensable role in agricultural production. As social insects, the various behaviors of bees are the key to the high degree of organization of bee colonies. In a bee colony, bees have behaviors such as crawling, flying, nesting, feeding, and collecting. The special behaviors of bees are closely related to the expression levels of specific genes in the brain.

[0003] With the development of molecular biology technology, gene knockdown technology has provided a new idea for regulating bee behavior. Small interfering RNA (siRNA) is about 22nt in length and silences the expression of target genes by hybridizing with complementary mRNA molecules. This interference triggers mRNA degradation and inhibits the gene expression of specific genes. siRNA is highly efficient and simple in silencing genes, but single siRNA often has problems such as poor stability of knockdown effect and complex screening; mixing multiple siRNAs can reduce the screening workload and improve the stability of the knockdown effect. Summary of the invention

[0004] The present invention relates to the application of vitellogenin gene in regulating the lipid metabolism and / or crawling behavior of honey bees.

[0005] Preferably, the preparation for regulating the expression amount of vitellogenin gene is used in the preparation of a preparation for regulating the crawling speed of honey bees.

[0006] Preferably, the honey bee is Apis mellifera.

[0007] Preferably, the agent for regulating the expression amount of the vitellogenin gene is an overexpression agent of the vitellogenin gene or an inhibitor of the vitellogenin gene.

[0008] Preferably, the inhibitor of the vitellogenin gene is siRNA, which is Vg_3408, Vg_2276 or Vg_2641 or a mixture thereof, wherein the 5'→3' sequence sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdT dT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT; the 5'→3' sequence sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT; the 5'→3' sequence sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUC CUUCdTdT.

[0009] The second object of the present invention is to provide a preparation for regulating the crawling speed of honey bees, comprising a preparation for regulating the expression amount of vitellogenin gene.

[0010] Preferably, the honey bee is Apis mellifera.

[0011] Preferably, the agent for regulating the vitellogenin gene is an overexpression agent of the vitellogenin gene or an inhibitor of the vitellogenin gene.

[0012] Preferably, the regulation of honey bee lipid metabolism is to significantly increase the levels of 13 lipids including PE P-18:3_16:0, PC O-18:5_22:6, PC 20:0_18:3, TG 18:2_18:2_19:3; O, Cer 14:1; O2 / 18:0, SM 14:1; O2 / 21:0, SM 16:1; O2 / 24:1, PCO-16:0_14:0, SM 16:1; O2 / 20:0, TG 16:0_20:3_18:3; O3, PC O-18:3_18:0, SM 21:0; O2 / 21:1, PC 20:0_20:0; and PC 18:1_18:3, PC 16:1_18:2, PC The levels of 11 lipids, including PC 18:0_18:3, PC 18:0_18:1, PC O-18:0_18:3, PC 18:1_18:1, PC 16:0_18:3, NAE 20:1, SM 14:0; O2 / 20:0, SM 14:1; O2 / 20:0, PC 16:0_18:1, were significantly reduced.

[0013] Preferably, the inhibitor of the vitellogenin gene is siRNA.

[0014] The present invention also provides a method for inhibiting the crawling speed of honey bees, which is to inject an inhibitor of the vitellogenin gene into the brain of the honey bee. Preferably, the inhibitor of the vitellogenin gene is siRNA of the vitellogenin gene.

[0015] The present invention regulates the crawling behavior of honeybees by microinjecting mixed siRNA into the honeybee brain to knock down the expression of vitellogenin gene, aiming to provide a more efficient and accurate honeybee behavior regulation strategy.

[0016] The present invention is a new technology for regulating the crawling behavior of honey bees by knocking down the expression of the vitellogenin gene, specifically using three specific sequences of mixed siRNA to be microinjected into the honey bee brain to inhibit the expression of the vitellogenin (Vg) gene. This is to explore its possible role in regulating the crawling behavior of honey bees. The results showed that microinjection of mixed siRNA significantly inhibited the expression of the Vg gene in the honey bee brain, significantly regulated the lipid metabolism of the honey bees, and inhibited the crawling behavior of the honey bees. At the same time, the behavior regulation technology involved in the present invention is friendly to honey bees.

[0017] The beneficial effects of the present invention are as follows:

[0018] (1) Microinjection of mixed siRNA into honey bee brain significantly inhibited the expression of Vg gene.

[0019] (2) Microinjection of mixed siRNA into bee brain regulated the lipid metabolism of honey bees (the levels of 24 lipids in the experimental group changed significantly, and 3 lipid metabolic pathways were significantly enriched).

[0020] (3) Microinjection of mixed siRNA into bee brain effectively inhibited the crawling behavior of bees (the crawling trajectory of the experimental group was disordered, the crawling speed was significantly slowed down, and the crawling distance was significantly shortened).

[0021] (4) Microinjection of mixed siRNA is a bee-friendly behavior regulation technology (does not affect the survival rate of bees). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 It is the expression level of bee brain Vg gene. After microinjection of mixed siRNA, the expression level of bee brain Vg gene was significantly lower than that of negative control group, control group and blank group (p=0.031<0.05).

[0023] Figure 2 It is a PCA model of bee brain lipids, with quality control aggregation and stable and reliable data collection. The lipid composition of bee brain after microinjection of mixed siRNA is significantly different from that of the control group.

[0024] Figure 3This is a heat map of the content levels of significantly different lipids in bee brain. After microinjection of mixed siRNA, there were 24 significantly different lipids in the bee brain and the control group, among which 13 lipid levels increased significantly and 11 lipid levels decreased significantly (p<0.05).

[0025] Figure 4 It is the KEGG enrichment pathway of 24 significantly differential lipids in bee brain. After microinjection of mixed siRNA, the significantly differential lipids in bee brain were significantly enriched in sphingolipid metabolism: comprehensive pathway, sphingolipid pathway and Kennedy pathway of sphingolipids (p<0.05).

[0026] Figure 5 This is a schematic diagram of the experimental device for the crawling behavior of honey bees.

[0027] Figure 6 This is the crawling track of the bees. After microinjection of mixed siRNA, the crawling track of the bees is more disordered than that of the control group.

[0028] Figure 7 is the crawling distance of bees. Microinjection of mixed siRNA significantly inhibited the crawling distance of bees.

[0029] Figure 8 It is the crawling speed of bees. Microinjection of mixed siRNA significantly inhibited the crawling speed of bees.

[0030] Fig. 9 This is the survival curve of honey bees. There is no significant difference in the survival curve of honey bees among the microinjected mixed siRNA, control group and blank group. DETAILED DESCRIPTION

[0031] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0032] Embodiment 1:

[0033] 1. Knockdown of Vg gene expression in bee brain by microinjection of mixed siRNA

[0034] 1.1 Experimental Materials

[0035] 1.1.1 Samples: Honey bees were from the experimental apiary of the Institute of Bee Research, Chinese Academy of Agricultural Sciences, and the species was Apis mellifera. The honey bees were collected when they buried their heads in the honeycomb with larvae for at least 10 seconds.

[0036] 1.1.2 Reagents: Three siRNA preparations targeting Vg gene were synthesized by Yaoyuan Biotechnology (Shanghai) Co., Ltd. (Shanghai, China), including Vg_3408, Vg_2276, and Vg_2641, as well as nonsense RNA (negative control), internal reference gene (B-Action), and Vg gene. The 5'→3' sequence of Vg_3408 has a sense strand of GCAGAAAGAUCCUGUGAUAdTdT, and an antisense strand of UAUCACAGGAUCUUUCUGCdTdT. The 5'→3' sequence of Vg_2276 has a sense strand of GGAAAGAUCUCGCGAAGAAdTdT, and an antisense strand of UUCUUCGCGAGAUCUUUCCdTdT. The 5'→3' sequence of Vg_2641 has a sense strand of GAAGGAAACUUGAUGAUAAdTdT, and an antisense strand of UUAUCAUCAAGUUUCCUUCdTdT. The nonsense RNA 5'→3' sequence F-primer is UUCUCCGAACGUGUCACGUTT, and the R-primer is ACGUGACACGUUCGGAGAATT. The reference gene 5'→3' sequence F-primer is TGCCAACACTGTCCTTTCTG, and the R-primer is AGAATTGACCCACCAATCCA. The Vg gene (GeneID: 406088) 5'→3' sequence F-primer is CTTCGAGACCAACATGCAGA, and the R-primer is TCGATCCATTCCTTGATGGT. PBS reagent was purchased from Shanghai Biotime Biotechnology Co., Ltd. (Shanghai, China).

[0037] 1.2 Methods

[0038] 1.2.1 Microinjection

[0039] The bees were captured, and an opening was made in the single eye of the bees' heads using forceps and an insect scalpel. Then, a microinjector (Ultra micro pump (model: UMP3), World Precision Instruments, Inc., USA) was used to inject 10 mmol / L PBS (control group) or 500 ng / μL mixed siRNA prepared with 10 mmol / L PBS (experimental group, each siRNA was mixed at a mass ratio of 1:1:1, and the concentration of each single siRNA was 500 ng / ul) or 500 ng / μL nonsense siRNA prepared with 10 mmol / L PBS (negative control group) into the bees' brains. The injection reagent volume was 1 μL. No microinjection was performed in the blank group.

[0040] 1.2.2 Bee feeding and sampling

[0041] Each group of bees was placed in a constant temperature incubator at 33°C and 40% humidity, and fed with an equal amount of sugar water (1:1, v:v). Samples were collected after 5 days. The bees were euthanized with liquid nitrogen, placed on ice for dissection, glands were removed, and bee brain samples were collected.

[0042] 1.2.3 Extraction of RNA from bee brain

[0043] The RNA of bee brain was extracted according to the extraction procedures of the column-type animal tissue total RNA extraction and purification kit (Sangon Biotechnology (Shanghai) Co., Ltd. (Shanghai, China)).

[0044] 1.2.4 Reverse transcription

[0045] According to PrimeScript TM Reverse transcription was performed using the RT Master Mix (Perfect Real Time) kit (Beijing Bio-Ray Pharmaceutical Biotechnology (Beijing) (Beijing, China). The total amount of bee brain RNA input was controlled to be 500 ng. The reverse transcription reaction was carried out at 37°C for 15 min, and the reverse transcriptase was inactivated at 85°C for 5 s.

[0046] 1.2.5 Fluorescence quantitative PCR

[0047] After the cDNA obtained by reverse transcription of bee brain RNA, internal reference gene and Vg gene was diluted 10 times, 2 μL was taken for qPCR. The operation steps were as follows: Premix Ex Taq TM II FAST qPCR kit (Beijing Bio-Rad Pharmaceutical Biotechnology (Beijing, China)). After pre-denaturation at 95°C for 30 s in 480II real-time fluorescence quantitative PCR system (Roche, Switzerland), 45 cycles of 95°C for 5 s→60°C for 30 s (fluorescence detection) were performed.

[0048] 1.2.6 Statistical analysis

[0049] The expression of Vg gene was calculated by 2-△△Ct method. One-way ANOVA combined with Waller-Duncan test was used for statistical significance analysis.

[0050] 1.2.7 Test results

[0051] The results are as follows Figure 1As shown, there is no significant difference between the negative control group, the control group, and the blank group, indicating that nonsense RNA and PBS do not interfere with the expression of the Vg gene. There is a significant difference between the negative control group, the control group, the blank group and the experimental group (p = 0.031 < 0.05), indicating that the mixed siRNA interferes with the expression of the Vg gene in the experimental group bee brain. This proves that microinjection of mixed siRNA can achieve the knockdown of the Vg gene in the bee brain.

[0052] 2Microinjection of mixed siRNA significantly regulates lipid metabolism in honey bees

[0053] 2.1 Experimental Materials

[0054] The samples were the same as in 1.1.1. The mixed siRNA and PBS were the same as in 1.1.2. Methanol, dichloromethane, and ammonium formate were purchased from Tianjin Alta Technology Reagent Co., Ltd. Acetonitrile, isopropanol, and formic acid were all of mass spectrometry grade and purchased from Thermo Fisher Scientific (UK).

[0055] 2.2 Methods

[0056] 2.2.1 Microinjection and Bee Feeding and Sampling

[0057] Refer to 1.2.1 for microinjection of mixed siRNA, and add a blank group, which does not undergo microinjection. Refer to 1.2.2 for bee feeding and sampling, collect 60 bees from each group, randomly combine 10 bees into one sample, and set up 6 parallel samples for each group.

[0058] 2.2.2 Lipid extraction from bee brain samples

[0059] To extract lipid substances in bee brain, 160 μL methanol and 320 μL dichloromethane were first added to each bee brain sample, vortexed and homogenized for 10 min at 4 °C using an ultrasonic disruptor with a parameter of 5 s on and 10 s off. Then 150 μL ultrapure water was added, incubated on ice for 10 min, and then centrifuged at 4 °C and 10000 r / min for 10 min to collect the lower organic phase. 250 μL of dichloromethane: methanol (2:1, V / V) mixture was added to the remaining aqueous phase and solid sample, and the above ultrasonic homogenization, incubation, and centrifugation operations were repeated, and the lower organic phase was collected again. The organic phases obtained twice were combined, dried with nitrogen at room temperature, filtered through a 0.22 μm membrane, and re-dissolved with 100 μL dichloromethane: methanol (1:1, V / V), and finally analyzed on the machine. 10 μL of each sample was mixed to form a quality control sample.

[0060] 2.2.3 Lipidomics methods for bee brain samples

[0061] Lipidome analysis was performed using a 1290 Infinity II high performance liquid chromatography system combined with a 6545 LC-ESI-QTOF mass spectrometer (Agilent, USA). The lipid extract (injection volume was 2 μL) was separated at 50°C on a Waters Xbridge C18 column (2.1×100 mm, 3.5 μm). The mobile phase used a binary solvent system, including mobile phase A (acetonitrile: water = 6:4, V / V) and mobile phase B (isopropanol: acetonitrile = 9:1, V / V), both of which contained 10 mmol of ammonium formate and 0.1% formic acid. The separation process was carried out at a flow rate of 0.3 mL / min for a total of 30 min, and the gradient elution program was as follows: at 0 min, mobile phase A accounted for 60%; at 4 min, mobile phase A accounted for 50%; at 25 min, mobile phase A increased to 100%; at 27 min, mobile phase A was maintained at 100%; at 27.1 min, mobile phase A decreased to 60%; at 30 min, mobile phase A remained at 60%. Data acquisition adopted data dependent acquisition (DDA) mode, including positive and negative ion modes, and the acquisition mass range was set from 100 to 2000 m / z. All samples were analyzed in the same batch, and at least one quality control sample was inserted for every 6 samples. The raw data obtained by mass spectrometry analysis were processed using MS-DIAL software.

[0062] 2.3 Statistical analysis

[0063] The PCA model and KEGG pathway enrichment were constructed by Metaboanalyst (https: / / www.metaboanalyst.ca / ). Significantly differential lipids were screened with VIP>1, combined with Fold change ≥2 or ≤0.5 and p value (p<0.05). The KEGG enrichment pathways of significantly differential lipids were annotated with reference to the RaMP-DB database.

[0064] 2.4 Test results

[0065] The results are as follows Figure 2 As shown in the figure, in the PCA model, the quality control samples clustered, indicating that the collected data was stable and reliable. The principal component PC1 explained 98.7% of the differences, and the control group and the experimental group were clearly separated, indicating that there were significant differences in the lipid composition of the control group and the experimental group. Figure 3It can be seen that there are 24 significantly different lipids between the experimental group and the control group. After injection of mixed siRNA, the levels of 13 lipids, including PE P-18:3_16:0, PC O-18:5_22:6, PC 20:0_18:3, TG 18:2_18:2_19:3; O, Cer14:1; O2 / 18:0, SM 14:1; O2 / 21:0, SM 16:1; O2 / 24:1, PC O-16:0_14:0, SM 16:1; O2 / 20:0, TG 16:0_20:3_18:3; O3, PC O-18:3_18:0, SM 21:0; O2 / 21:1, PC 20:0_20:0, were significantly increased; while PC 18:1_18:3, PC The levels of 11 lipids, including PC 16:1_18:2, PC 18:0_18:3, PC 18:0_18:1, PC O-18:0_18:3, PC 18:1_18:1, PC 16:0_18:3, NAE 20:1, SM 14:0; O2 / 20:0, SM 14:1; O2 / 20:0, PC16:0_18:1, were significantly reduced, indicating that microinjection of mixed siRNA significantly regulated the lipid levels of honey bees. Figure 4 As shown, these 24 significantly different lipids are mainly enriched in sphingolipid metabolism: comprehensive pathway, and are also significantly enriched in sphingolipid pathway and sphingolipid Kennedy pathway, indicating that microinjection of mixed siRNA significantly regulates sphingolipid metabolism in honey bees. These results show that after injection of mixed siRNA, the lipid composition, lipid level and related metabolism of bee brains have been significantly changed, indicating that microinjection of mixed siRNA significantly regulates lipid metabolism in honey bees.

[0066] 3. Microinjection of mixed siRNA to inhibit honey bee crawling behavior

[0067] 3.1 Experimental Materials

[0068] The honeycombs with larvae were from the experimental bee farm of the Bee Research Institute of the Chinese Academy of Agricultural Sciences. The bee samples were the same as in 1.1.1. The mixed siRNA and PBS were the same as in 1.1.2.

[0069] 3.2 Methods

[0070] The microinjection of mixed siRNA and the feeding and sampling of bees were carried out according to 1.2.1 and 1.2.2, with 20 bees in each group. The bees were placed in a crawling device, and the crawling behavior of the bees was recorded using a camera device with the assistance of a supplementary light device ( Figure 5 ), each bee was recorded for 20 minutes,

[0071] 3.3 Statistical analysis

[0072] The crawling trajectories of bees were counted using idTracker software ( Figure 6 )、Crawling distance( Figure 7 ), crawling speed( Figure 8 ). Unpaired sample t test was used for significance analysis.

[0073] 3.4 Test results

[0074] The results are as follows Figure 6 As shown in the figure, the crawling track of the experimental group was disordered and irregular, while the crawling track of the control group was still normal, indicating that the microinjection of mixed siRNA interfered with the crawling track of the bees. Figure 7 As shown in the figure, the crawling distance of the experimental group was significantly shorter than that of the control group (p=0.002<0.025), indicating that microinjection of mixed siRNA significantly inhibited the crawling distance of honey bees. Figure 8 As shown, the crawling speed of the experimental group was significantly slower than that of the control group (p=0.0028<0.025), indicating that microinjection of mixed siRNA significantly inhibited the crawling speed of honey bees. This proves that microinjection of mixed siRNA effectively inhibited the crawling behavior of honey bees.

[0075] 4Microinjection of mixed siRNA is a bee-friendly behavior regulation technology

[0076] 4.1 Experimental Materials

[0077] The samples are the same as in 1.1.1. The mixture of siRNA and PBS is the same as in 1.1.2.

[0078] 4.2 Methods

[0079] The mixed siRNA was microinjected as described in 1.2.1, and a blank group was added, and no microinjection was performed on the bees in this group. The feeding and sampling of the bees were the same as described in 1.2.2. During the feeding period, the number of bee deaths was recorded every day.

[0080] 4.3 Statistical analysis

[0081] The Kaplan-Meier survival curve was drawn according to the number of bee deaths, and the log-rank test statistic was used for statistical significance analysis.

[0082] 4.4 Test results

[0083] The results are as follows Fig. 9As shown, there was no significant difference in the survival curves between the experimental group and the blank group (p = 0.843> 0.05), and there was no significant difference in the survival curves between the control group and the blank group (p = 0.567> 0.05), indicating that microinjection is friendly to bees. There was no significant difference in the survival curves between the experimental group and the control group (p = 0.707> 0.05), indicating that mixed siRNA is friendly to bees. This proves that microinjection of mixed siRNA to knock down the expression of Vg gene in bee brain is a bee-friendly technology.

Claims

1. Application of vitellogenin gene in regulating lipid metabolism and / or crawling behavior of honey bees.

2. The use according to claim 1, characterized in that: The invention relates to an application of a preparation for regulating the expression amount of vitellogenin gene in the preparation of a preparation for regulating the crawling speed of honey bees.

3. The use according to claim 1, characterized in that: The honey bee is Apis mellifera.

4. The use according to claim 1, characterized in that: The preparation for regulating the expression of the vitellogenin gene is an over-expression agent of the vitellogenin gene or an inhibitor of the vitellogenin gene; preferably, the regulating bee lipid metabolism is to make PE P-18:3_16:0, PC O-18:5_22:6, PC 20:0_18:3, TG 18:2_18:2_19:3; O, Cer The levels of 13 lipids, including PC 18:1_18:3, PC 16:1_18:2, PC 18:0_18:3, PC 18:0_18:1, PC O-18:0_18:3, PC 18:1_18:1, PC 16:0_18:3, NAE 20:1, SM 21:0, O2 / 21:1, PC 20:0_20:0, and PC 18:1_18:3 were significantly increased. The levels of 11 lipids, including 14:0; O2 / 20:0, SM 14:1; O2 / 20:0, PC16:0_18:1, were significantly reduced.

5. The use according to claim 1, characterized in that: The inhibitor of the vitellogenin gene is siRNA, which is Vg_3408, Vg_2276 or Vg_2641 or a mixture thereof, wherein the 5'→3' sequence sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdTdT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT; the 5'→3' sequence sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT; the 5'→3' sequence sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUCCUUCdTdT.

6. A preparation for regulating the crawling speed of bees, characterized in that: Contains a preparation for regulating the expression of the vitellogenin gene.

7. The preparation according to claim 6, characterized in that The honey bee is Apis mellifera.

8. The preparation according to claim 6, characterized in that The preparation for regulating the vitellogenin gene is an over-expression agent of the vitellogenin gene or an inhibitor of the vitellogenin gene.

9. The preparation according to claim 6, characterized in that The inhibitor of the vitellogenin gene is siRNA, which is Vg_3408, Vg_2276 or Vg_2641 or a mixture thereof, wherein the 5'→3' sequence sense strand of Vg_3408 is GCAGAAAGAUCCUGUGAUAdTdT, and the antisense strand is UAUCACAGGAUCUUUCUGCdTdT; the 5'→3' sequence sense strand of Vg_2276 is GGAAAGAUCUCGCGAAGAAdTdT, and the antisense strand is UUCUUCGCGAGAUCUUUCCdTdT; the 5'→3' sequence sense strand of Vg_2641 is GAAGGAAACUUGAUGAUAAdTdT, and the antisense strand is UUAUCAUCAAGUUUCCUUCdTdT.

10. A method for inhibiting the crawling speed of bees, characterized in that: The method is to inject the inhibitor of the vitellogenin gene into the bee. Preferably, the inhibitor of the vitellogenin gene is siRNA of the vitellogenin gene.

Citation Information

Patent Citations

  • Calcium-zinc stabilizer stirring and dispersing device

    CN208852796U

  • Wireless diversity receiver with shared receive path

    US20050181752A1

  • Compounds that modulate estrogen actions

    WO2003000730A1