Application of medicament for inhibiting autophagy of macrophages

Abstract

The invention relates to an application of a medicament for inhibiting autophagy of macrophages, in particular to a method for reducing the immunosuppressive effect of M2 type macrophages. The invention relates to an application of a medicament for inhibiting autophagy of macrophages in preparation of a medicament for recovering T cell proliferation capacity, and an application in preparation of a medicament for inhibiting synthesis in acetyl coenzyme A cells or an H3K27 acetylation inhibitor. The invention also relates to application of the compound in preparation of drugs for treating acetyl coenzyme A related diseases or H3K27 acetylation related diseases and application of the compound in preparation of an Arg-1 inhibitor or a VEGF alpha inhibitor. The invention finds that the medicament for inhibiting macrophage autophagy can reduce the biosynthesis of acetyl coenzyme A in M2 type macrophages, further reduce the acetylation modification level of histone H3K27 site, reduce the transcription expression of immunosuppression related genes, and finally reverse the tumor immunosuppression function of M2 type macrophages.

Description

Technical Field

[0001] The present invention relates to the field of tumor immunotherapy, and in particular to the application of a medicament for inhibiting macrophage autophagy. Background Art

[0002] Traditional tumor treatment methods mainly include surgery, radiotherapy and chemotherapy, but the treatment results are not satisfactory. With the research on tumor immunotherapy such as dendritic cell vaccines, adoptive immune cell therapy, small molecule targeted drug therapy and anti-tumor monoclonal antibodies, especially targeted immune checkpoint therapy, tumor immunotherapy, as the fourth treatment mode after traditional therapy, plays a huge role in the comprehensive treatment of tumors.

[0003] The tumor microenvironment is a dynamic system composed of tumor cells, immune cells, extracellular matrix, and signaling molecules. Its immunosuppressive properties are key factors leading to tumor progression, metastasis, and treatment resistance. Among the immune cells in the tumor microenvironment, macrophages account for up to 50%, and their functional polarization states show spatiotemporal heterogeneity: in the early stages of tumor development, macrophages can clear tumor cells by phagocytosis. However, under the continuous action of various factors in the tumor microenvironment, macrophages gradually polarize into M2-like phenotype tumor-associated macrophages with immunosuppressive functions. Clinical studies have confirmed that high infiltration of M2 macrophages in solid tumors such as breast cancer, melanoma, and prostate cancer is often closely related to poor prognosis or tumor progression.

[0004] At present, the treatment strategy for M2 macrophages mainly focuses on repolarizing M2 macrophages through drugs or gene editing. Although this treatment strategy has made some progress, it still has some shortcomings and challenges, mainly including the following: For some solid tumors, targeted therapy of M2 macrophages may be difficult to penetrate tumor tissue, resulting in poor treatment effect. The polarization state of M2 macrophages is highly dependent on the tumor microenvironment (TME). Even if it is polarized to the anti-tumor M1 type through treatment, proinflammatory factors in the tumor microenvironment (such as IL-10 and TGF-β) may still induce it to repolarize to the M2 type. This instability limits the durability of treatment. The tumor microenvironment is highly heterogeneous, with large differences between different tumor types and individuals, which makes it difficult to standardize and universalize the treatment strategy for M2 macrophages. M2 macrophages may synergize with other immunosuppressive cells (such as regulatory T cells and myeloid-derived suppressor cells) in the tumor microenvironment to further enhance immunosuppression. The immunosuppressive factors (such as IL-10 and TGF-β) secreted by M2 macrophages not only inhibit the activity of T cells, but may also affect the functions of other immune cells. Summary of the invention

[0005] The present invention finds that the agent that inhibits macrophage autophagy can reduce the biosynthesis of acetyl-CoA in M2 macrophages, thereby reducing the acetylation modification level of histone H3K27 site, down-regulating the transcriptional expression of immunosuppression-related genes, and finally reversing the tumor immunosuppression function of M2 macrophages. Based on this, the present invention provides the use of the agent that inhibits macrophage autophagy, including a method for reducing the immunosuppression of M2 macrophages, the use of the agent that inhibits macrophage autophagy in the preparation of a drug for restoring T cell proliferation ability, the use of the agent that inhibits the intracellular synthesis of acetyl-CoA or the H3K27 acetylation inhibitor, the use of the agent in the preparation of a drug for treating acetyl-CoA-related diseases or H3K27 acetylation-related diseases, and the use of the agent in the preparation of an Arg-1 inhibitor or a VEGFα inhibitor.

[0006] In a first aspect, the present invention provides a method for reducing the immunosuppressive effect of M2 macrophages, the method comprising contacting the M2 macrophages with an agent that inhibits macrophage autophagy.

[0007] In conjunction with the first aspect of the present invention, in some embodiments, the immunosuppressive effect of M2 macrophages includes inhibiting T cell proliferation.

[0008] In a second aspect, the present invention provides use of an agent for inhibiting macrophage autophagy in the preparation of a drug for restoring T cell proliferation ability.

[0009] In a third aspect, the present invention provides use of an agent for inhibiting macrophage autophagy in the preparation of an agent for inhibiting intracellular synthesis of acetyl-CoA or an H3K27 acetylation inhibitor.

[0010] In a fourth aspect, the present invention provides use of an agent for inhibiting macrophage autophagy in the preparation of a drug for treating acetyl-CoA-related diseases or H3K27 acetylation-related diseases.

[0011] In combination with the fourth aspect of the present invention, in some embodiments, the acetyl-CoA-related diseases include one or more of cancer, fatty liver, mitochondrial dysfunction-related diseases, metabolic encephalopathy, heart disease, and metabolic syndrome-related diseases; the H3K27 acetylation-related diseases include one or more of cancer, systemic lupus erythematosus, Alzheimer's disease, neurodegenerative diseases, muscle-related diseases, and heart disease.

[0012] In a fifth aspect, the present invention provides use of an agent for inhibiting macrophage autophagy in the preparation of an Arg-1 inhibitor or a VEGFα inhibitor.

[0013] In combination with the first to fifth aspects of the present invention, in some embodiments, the agent that inhibits macrophage autophagy is SBI-0206965.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention reveals for the first time the molecular mechanism by which autophagy inhibitors inhibit the immunosuppressive function of M2 macrophages through the metabolic-epigenetic regulatory axis. Specifically, the autophagy inhibitor SBI-0206965 is used to intervene in the phenotype of M2 macrophages and reverse the tumor immunosuppressive function of M2 macrophages. The principle is that the drug that inhibits macrophage autophagy reduces the biosynthesis of intracellular acetyl-CoA by inhibiting cell autophagy, resulting in a decrease in the acetylation level of the histone H3K27 site, thereby downregulating the transcription level of genes related to immunosuppression such as Arg1.

[0016] In addition, agents that inhibit macrophage autophagy downregulate intracellular acetyl-CoA levels, acetylation modification levels of histone H3K27 sites, and levels of immunosuppression-related genes Arg-1 and VEGFα, and may also prevent or treat other related diseases associated with these markers. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 The chemical structural formula of SBI-0206965, a drug for inhibiting macrophage autophagy used in an embodiment of the present invention.

[0019] Figure 2 For the present invention, the mRNA expression of Arg-1, a marker of M2 macrophages, in RAW264.7 cells after 24 hours of treatment with IL-4 and SBI-0206965 was analyzed by qPCR. The four groups of treatment objects were all RAW264.7 cells, the RAW264.7 group represented the control group without treatment, and the other three groups were treated with 20 ng / mL IL-4, among which the SBI0 group represented the additional addition of 1.6 μL DMSO, the SBI4 group represented the additional addition of 4 μM SBI-0206965, and the SBI8 group represented the additional addition of 8 μM SBI-0206965. The treatment time was 24 hours.

[0020] Figure 3For the present invention, the mRNA expression of Arg-1, a marker of M2 macrophages, in BMDM after 24 hours of treatment with IL-4 and SBI-0206965 was analyzed by qPCR. The four groups of treatment objects were all BMDM cells, the BMDM group represented the control group without treatment, and the other three groups were treated with 20ng / mL IL-4, among which the SBI0 group represented the addition of 1.6μL DMSO on the basis of the BMDM group, the SBI4 group represented the addition of 4μM SBI-0206965 on the basis of the BMDM group, and the SBI8 group represented the addition of 8μM SBI-0206965 on the basis of the BMDM group. The treatment time was 24h.

[0021] Figure 4 For the embodiment of the present invention, the mRNA expression of M2 macrophage markers Arg-1 and VEGFα in RAW264.7 after 24 hours of treatment with lactic acid, SBI-0206965 and sodium acetate was analyzed by qPCR. The five groups of treatment objects were all RAW264.7 cells, the RAW group represented the control group without treatment, and the other four groups were treated with 10mM lactic acid, among which the DMSO group represented the addition of 1.6μL DMSO on the basis of the RAW group, the SBI group represented the addition of 8μM SBI-0206965 on the basis of the RAW group, the acetate group represented the addition of 10mM acetate on the basis of the RAW group, and the SBI+acetate group represented the addition of 8μM SBI-0206965 and 10mM acetate on the basis of the RAW group. The treatment time was 24h.

[0022] Figure 5 For the embodiment of the present invention, the mRNA expression of M2 macrophage markers Arg-1 and VEGFα in RAW264.7 after 24 hours of treatment with MC38 conditioned medium, SBI-0206965 and sodium acetate was analyzed by qPCR. All five groups of treatment objects were RAW264.7 cells, the RAW group represented the control group without treatment, and the other four groups were treated with MC38 conditioned medium, among which the DMSO group represented the addition of 1.6 μL DMSO on the basis of the RAW group, the SBI group represented the addition of 8 μM SBI-0206965 on the basis of the RAW group, the acetate group represented the addition of 10 mM acetate on the basis of the RAW group, and the SBI+acetate group represented the addition of 8 μM SBI-0206965 and 10 mM acetate on the basis of the RAW group. The treatment time was 24 hours.

[0023] Figure 6For the present invention, the changes in the intracellular acetyl-CoA content of RAW264.7 with or without MC38 conditioned medium and with or without SBI-0206965 treatment were detected by ELISA. The four groups of treatment objects were all RAW264.7 cells, the media-DMSO group represented the addition of 1.6 μL DMSO treatment, the media-SBI group represented the addition of 8 μM SBI-0206965 treatment, the MC38-CM-DMSO group represented the addition of MC38 conditioned medium and 1.6 μL DMSO treatment, and the MC38-CM-SBI group represented the addition of MC38 conditioned medium and 8 μM SBI-0206965 treatment. The treatment time was 24 h.

[0024] Figure 7 For the present invention, the acetylation level of H3K27 was detected by Western Blot after RAW264.7 was treated with Lactate, SBI-0206965 and sodium acetate for 24 hours. The five groups of treatment objects were all RAW264.7 cells, and the grouping from left to right was as follows: the first group represented the untreated control group, and the second to fifth groups were all treated with 10mM lactic acid, among which the second group was additionally treated with 1.6μL DMSO, the third group was additionally treated with 8μMSBI-0206965, the fourth group was additionally treated with 10mM acetate, and the fifth group was additionally treated with 8μM SBI-0206965 and 10mM acetate. The treatment time was 24h.

[0025] Figure 8 For the present invention, Western Blot was used to detect the acetylation level of H3K27 after 24 hours of treatment of RAW264.7 with MC38 conditioned medium, SBI-0206965 and sodium acetate. The five groups of treatment objects were all RAW264.7 cells, and the groupings arranged from left to right were as follows: the first group represented the control group without treatment, and the second to fifth groups were treated with MC38 conditioned medium, among which the second group was additionally treated with 1.6μLDMSO, the third group was additionally treated with 8μMSBI-0206965, the fourth group was additionally treated with 10mM acetate, and the fifth group was additionally treated with 8μM SBI-0206965 and 10mM acetate. The treatment time was 24h.

[0026] Fig. 9In the embodiment of the present invention, the relative abundance of the macrophage marker Arg-1 gene combined with H3K27ac protein in RAW264.7 treated with SBI-0206965 for 24 hours was determined by chromatin coprecipitation. The four groups of treatment objects were all RAW264.7 cells, and MC38 conditioned medium was added to treat them. The groupings arranged from left to right are as follows: the first and second groups were treated with 1.6μL DMSO, and the third and fourth groups were treated with MC38 conditioned medium and 8μMSBI-0206965 for 24h. In addition, the second and fourth groups added H3K27ac antibodies during the "primary antibody incubation", while the first and third groups did not add any antibodies.

[0027] Fig.10 In the present invention, flow cytometry was used to detect the inhibitory effect of RAW264.7 on T cell proliferation under the treatment of lactic acid / MC38 conditioned medium, SBI-0206965, and sodium acetate. The Ctrl group represents T cells only, the RAW264.7 group represents T cells co-cultured with RAW264.7, and the RAW264.7+SBI group represents T cells co-cultured with RAW264.7 cells treated with SBI-0206965. Among them, RAW264.7 was polarized to M2 phenotype with MC38 conditioned medium. DETAILED DESCRIPTION

[0028] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments. It should be noted that the following detailed descriptions are exemplary and are intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those of ordinary skill in the art to which the present invention belongs.

[0029] The present invention provides a method for reducing the immunosuppression of M2 macrophages, which comprises contacting the M2 macrophages with a drug that inhibits macrophage autophagy.

[0030] In some embodiments, the immunosuppressive effect of M2 macrophages comprises inhibiting T cell proliferation.

[0031] The present invention provides the use of a medicament for inhibiting macrophage autophagy in preparing a medicament for restoring T cell proliferation ability.

[0032] The present invention provides the use of a medicament for inhibiting macrophage autophagy in the preparation of a medicament for inhibiting intracellular synthesis of acetyl-CoA or an H3K27 acetylation inhibitor.

[0033] The present invention provides use of a medicament for inhibiting macrophage autophagy in preparing a medicament for treating acetyl-CoA-related diseases or H3K27 acetylation-related diseases.

[0034] In some embodiments, the acetyl-CoA-related diseases include one or more of cancer, fatty liver, mitochondrial dysfunction-related diseases, metabolic encephalopathy, heart disease, and metabolic syndrome-related diseases; the H3K27 acetylation-related diseases include one or more of cancer, systemic lupus erythematosus, Alzheimer's disease, neurodegenerative diseases, muscle-related diseases, and heart disease.

[0035] The present invention provides use of a medicament for inhibiting macrophage autophagy in the preparation of an Arg-1 inhibitor or a VEGFα inhibitor.

[0036] In some embodiments, the agent that inhibits macrophage autophagy is SBI-0206965.

[0037] The technical solution of the present invention will be further described in detail below in conjunction with specific embodiments. Wherein, the methods used in the embodiments are conventional methods unless otherwise specified.

[0038] SBI-0206965 used in the following examples was purchased from MCE Company, CAS No.: 1884220-36-3, structural formula: Figure 1 As shown, it is a highly selective inhibitor of autophagy kinase ULK1 (Unc-51-like kinase 1). ULK1 is a key kinase in the autophagy process, and SBI-0206965 can regulate cell autophagy by inhibiting the activity of ULK1. The Arg-1 gene can be used as a marker of M2 macrophages, while the H3K27ac protein more reflects the epigenetic regulation process of M2 macrophage polarization.

[0039] Example 1: SBI-0206965 inhibits mRNA expression of M2 macrophage markers

[0040] This example uses the following two classical methods to induce macrophages to polarize into M2 macrophages:

[0041] 1. Th2 cytokine induction method: It is known that IL-4 can drive macrophages to polarize toward M2 phenotype by activating the STAT6 signaling pathway. 5 Mouse mononuclear macrophage leukemia cells RAW264.7 or mouse bone marrow-derived macrophages (BMDM) were seeded in 6-well plates at 10 cells / well. After the cells adhered to the plate, the culture medium was replaced with 20 ng / mL IL-4 (Peprotech) for 24 hours.

[0042] 2. Tumor microenvironment simulation method: 5×10 5RAW264.7 or mouse bone marrow-derived macrophages were seeded in 6-well plates at 10 cells / well. After the cells adhered to the plate, the culture medium was replaced with conditioned medium containing 10 mM lactate (sigma) or MC38 for induction treatment for 24 hours.

[0043] After 24 hours of treatment, cells were collected, total RNA was extracted using RNAeasy reagent (Norwegian), and cDNA was synthesized using HiScript II QRT kit (Norwegian). Subsequently, β-Actin (Forword: CATTGCTGACAGGATGCAGAAGG (SEQ ID NO.1)), Reverse: TGCTGGAAGGTGGACAGTGAGG (SEQ ID NO.2)) was used as an internal reference, and Arg-1 (Forword: CATTGGCTTGCGAGACGTAGAC (SEQ ID NO.3), Reverse: GCTGAAGGTCTCTTCCATCACC (SEQ ID NO.4)) and VEGFα (Forword: CTGCTGTAACGATGAAGCCCTG (SEQ ID NO.5), Reverse: GCTGTAGGAAGCTCATCTCTCC (SEQ ID NO.6)) were detected. The reaction system used ChamQ SYBR qPCR Master Mix (Norwegian). Data analysis The relative expression level was calculated using the ΔΔCt method, and the difference was statistically analyzed by t-test.

[0044] like Figure 2 to Figure 5 The experimental results showed that culture medium containing IL-4, lactic acid or MC38 effectively upregulated the mRNA expression of Arg-1 or VEGFα, indicating that the above two induction methods can effectively induce RAW264.7 or BMDM into M2 macrophages.

[0045] Comparative experiment 1: When 20 ng / mL IL-4 was added to induce, 4 μM and 8 μM SBI-0206965 were added to treat the cells. The mRNA expression of Arg-1, an important marker of M2 macrophages, was significantly reduced, and the degree of mRNA reduction increased with the increase of SBI-0206965 concentration (e.g. Figure 2 , Figure 3 shown).

[0046] Comparative experiment 2: Under the induction of 10 mM lactate or MC38 conditioned medium, cells were treated with 8 μM SBI-0206965, and the expression of Arg-1 mRNA and VEGFα, important markers of M2 macrophages, was significantly reduced (e.g. Figure 4 , Figure 5 shown), Figure 4The results of 10 mM lactate treatment are shown in Table 1. Figure 5 The results are shown for the treatment of MC38 conditioned medium.

[0047] The above experimental results show that SBI-0206965 can effectively downregulate the mRNA expression of important markers of M2 macrophages, which suggests that SBI-0206965 may change the immunosuppressive function of M2 macrophages by changing the phenotype of M2 macrophages.

[0048] Furthermore, the present invention uses acetate to provide exogenous acetyl-CoA, and adds it to the experimental group treated with induction medium and SBI-0206965. It is found that the suppressed M2 macrophage markers Arg-1 and VEGFα can be restored to expression (such as Figure 4 , 5 As shown), it is possible that SBI-0206965 inhibits the polarization of macrophages into M2 macrophages by inhibiting the synthesis of acetyl-CoA. Based on this, the present invention uses an ELISA kit (Shengong) to detect the content of acetyl-CoA in cells. The specific experimental process is as follows:

[0049] 1×10 6 RAW264.7 cells were plated in 6 cm dishes and after attachment, conditioned medium from MC38 cells was replaced and treated with 8 μM SBI-0206965 for 24 h.

[0050] The treated cells were lysed on ice for 10 min using Hypotonic buffer (10 mM Tris PH8.0, 50 mM NaCl, 1 mM EDTA PH8.0, 0.1% NP-40).

[0051] The supernatant was collected after centrifugation at 12000 g for 5 min as the sample.

[0052] 100 μL of sample and standard were added to the reaction wells, and the plates were sealed and incubated at 37°C for 90 min.

[0053] After incubation, spin dry the liquid.

[0054] Add 100 μL of biotin-labeled acetyl-CoA antibody working solution to the reaction wells, seal the plate and incubate at 37°C for 60 min.

[0055] After incubation, wash with 350 μL of washing solution, repeat twice, and spin dry the liquid.

[0056] Add 100 μL of HRP-labeled streptomycin working solution to the reaction wells, seal the plate and incubate at 37°C for 30 min.

[0057] After incubation, wash with 350 μL of washing solution, repeat twice, and spin dry the liquid.

[0058] In the dark, add 90 μL of color developer to each reaction well, seal the plate and incubate at 37°C for 15 min.

[0059] Add 50 μL of stop solution to each reaction well and detect the OD value at 450 nm using an enzyme reader.

[0060] like Figure 6 As shown, the present invention found that under the treatment of SBI-0206965, the content of acetyl-CoA in cells decreased significantly, confirming that SBI-0206965 inhibited the polarization of RAW264.7 into M2 macrophages by inhibiting the synthesis of acetyl-CoA.

[0061] Example 2: SBI-0206965 can reduce the expression of specific histone acetylation in the promoter region of M2 macrophage-related genes

[0062] In this example, the expression of acetylated H3K27 was detected in vitro by Western blot analysis. The specific experimental process is as follows:

[0063] (1) Cell treatment: 5×10 5 RAW264.7 cells / well were seeded in 6-well plates, and after the cells attached, they were induced with conditioned medium containing 10 mM lactate or MC38, and treated with 8 μM SBI-0206965 and 10 mM sodium acetate (Macklin) for 24 hours.

[0064] (2) Total protein extraction: Add 100 μL of Sample lysis buffer to the lysed cells, transfer them to a 1.5 mL EP tube, sonicate with an ultrasonic cell disruptor for 2–3 seconds, centrifuge at 12,000 g for 10 minutes, and collect 90 μL of the supernatant as a protein sample.

[0065] (3) BCA protein quantification (Biyuntian):

[0066] Add 0, 1, 2, 4, 8, 12, 16, and 20 μL of 5 mg / mL protein standard to a 96-well plate, and add RNase-free water to 20 μL.

[0067] Add 2 μL of protein sample to a 96-well plate and add RNase-free water to 20 μL.

[0068] Add 200 μL of BCA working solution to each well and incubate at 37°C for 30 min.

[0069] The absorbance value of the sample was measured by an ELISA instrument at a wavelength of 562 nanometers. A standard curve of protein absorbance-concentration was made based on the measured data to calculate the concentration of the protein sample. Based on the calculation results, the protein concentration was unified with 5-fold concentrated protein loading buffer (full gold) and RNase-free water. Denature at 99°C for 10 minutes.

[0070] (4) Western blot:

[0071] 1) Preparation of separation gel: Taking 12% separation gel as an example, add the reagents listed in Table 1 into a 50 mL centrifuge tube in sequence, shake well, add to a glass plate, and seal the liquid surface with isopropanol.

[0072] Table 1 12% separation gel configuration (8 mL)

[0073]

[0074]

[0075] Prepare 5% concentrated gel: After the separation gel solidifies, pour off the isopropanol, dry it with filter paper, prepare concentrated gel according to Table 2, mix thoroughly and add the concentrated gel to the upper layer of the separation gel, then insert a comb to avoid bubbles.

[0076] Table 2 4% concentrated gel configuration (2mL)

[0077]

[0078] 2) Electrophoresis: According to Figure 7-Figure 8 15 μL protein sample was added in the order of 80V electrophoresis for 20 min in the first stage and 110V electrophoresis for 70 min in the second stage. The electrophoresis was stopped when the target protein moved to the appropriate position.

[0079] 3) Transfer: Soak the cut PVDF membrane in anhydrous methanol for 30 seconds, rinse with deionized water, and place in transfer solution for balance. Place the electrophoresis gel and balanced PVDF membrane in the order of "black gel and white membrane", place sponges on both sides, and install the transfer clip. Transfer at low temperature 300mA for 90 minutes.

[0080] 4) Blocking: Block with 5% skim milk (TBST) at room temperature for 2 h.

[0081] 5) Primary antibody incubation: Cut the target band according to the antibody instructions, dilute the antibody with 5% BSA, and then incubate the antibody at 4°C overnight.

[0082] 6) Recover the primary antibody and wash the membrane three times with TBST buffer, each time for 10 min.

[0083] 7) Secondary antibody incubation: Dilute the secondary antibody with 5% skim milk according to the antibody instructions and incubate at room temperature for 2 h.

[0084] 8) Exposure: Prepare the developer (Clarity Western ECL Substrate, Bio-Rad) according to the instructions, drop an appropriate amount onto the front of the membrane, and quickly place it in the imager for exposure.

[0085] like Figure 7 , Figure 8 As shown, the present invention found that the acetylation level of H3K27 of RAW264.7 increased under the treatment of lactic acid / MC38 conditioned medium, while the acetylation level of H3K27 was significantly reduced under the treatment of SBI-0206965, which indicates that SBI-0206965 affects the level of histone acetylation. After the addition of sodium acetate, the acetylation level of H3K27 was restored, indicating that autophagy defects reduce the level of histone acetylation.

[0086] The present invention also uses the Hyperactive pG-MNase CUT&RUN Assay Kit for PCR / qPCR (Novozyme) to supplement the chromatin co-precipitation experiment of the macrophage marker Arg-1 gene and H3K27ac protein. The specific experimental process is as follows (the amount of reagents used is based on one sample as an example):

[0087] (1) Sample preparation: 3×10 5 RAW264.7 was plated in a six-well plate and divided into two groups, each with two samples, for a total of four samples. The difference between the two groups of samples was whether they were treated with SBI-0206965.

[0088] (2) ConA Beads Pro processing:

[0089] 1) Take a 1.5mL EP tube and add 100μL of binding buffer.

[0090] 2) Use a pipette to reselect ConA Beads Pro, take 10 μL and add it to the above liquid, place it on a magnetic stand, and after clarification, discard the supernatant.

[0091] 3) Remove the EP tube from the magnetic stand, add 100 μL of binding buffer, and mix gently by pipetting.

[0092] 4) Place the EP tube on a magnetic rack, wait for the solution to become clear, discard the supernatant, and add 10 μL of binding buffer to resuspend.

[0093] (3) Cell collection:

[0094] 1) Collect and count RAW264.7 cells, 5×10 5For a sample.

[0095] 2) Place the cells in a 1.5 mL EP tube, centrifuge at 2500 rpm for 5 min, and remove the supernatant.

[0096] 3) Add 500 μL Wash buffer to resuspend the cells, centrifuge at 2500 rpm for 5 min, and remove the supernatant.

[0097] 4) Add 100 μL of binding buffer to each sample and resuspend.

[0098] (4) Incubation of cells with ConA Beads Pro:

[0099] 1) Transfer beads into cells, mix well, and incubate at room temperature for 10 minutes. Gently shake 2-3 times during this time.

[0100] 2) Centrifuge at 30 g for 20 seconds, place on a magnetic rack, and discard the supernatant after clarification.

[0101] (5) Primary antibody incubation:

[0102] 1) Add 100 μL of pre-cooled Antibody buffer to each sample and resuspend the cell-magnetic bead complex.

[0103] 2) According to the antibody instructions, add 1 μg of H3K27ac antibody and shake gently to mix. Distinguish the experimental group from the control group.

[0104] 3) Centrifuge at 30 g for 20 seconds and incubate at 4°C overnight.

[0105] (6) pG-MNase Enzyme incubation:

[0106] 1) Take 1 μL pG-MNase Enzyme and add it to 100 μL MNase Dilution Buffer. After dilution, take 1 μL and add it to 100 μL Dig-Wash Buffer to make pG-MNase Enzyme premix. Place it upside down on ice.

[0107] 2) Take the EP tube incubated with primary antibody, centrifuge at 30g for 20s, place it in a magnetic rack, and discard the supernatant after clarification.

[0108] 3) Add 800 μL Dig-Wash Buffer to the EP tube and invert it several times to ensure that the buffer and cell-magnetic bead complex are fully mixed.

[0109] 4) Centrifuge at 30g for 20s, place on a magnetic rack, and discard the supernatant after clarification.

[0110] 5) Repeat steps 3) and 4) once.

[0111] 6) Add 100 μL of pG-MNase Enzyme premix prepared in step 1).

[0112] 7) Incubate with rotation at 4°C for 1 hour.

[0113] (7) Fragmentation:

[0114] 1) Take 2 μL CaCl 2 Add 98 μL Dig-Wash Buffer, mix well and place on ice.

[0115] 2) Take the incubated EP tube, centrifuge it instantly, place it on a magnetic rack, and discard the supernatant after clarification.

[0116] 3) Add 800 μL Dig-Wash Buffer to the EP tube and mix well.

[0117] 4) Centrifuge immediately, place on a magnetic rack, and discard the supernatant after clarification.

[0118] 8) Repeat steps 3) and 4) once.

[0119] 5) Add CaCl in step 1) 2 Premix, mix well.

[0120] 6) Digest on ice for 1 h.

[0121] (8) Fragmentation termination and release:

[0122] 1) Add 100 μL stop buffer to the EP tube in fragmentation and mix well.

[0123] 2) Place the EP tube in a 37°C water bath and incubate for 10 to 30 minutes (do not shake).

[0124] 3) Centrifuge at 4°C, 12,000 rpm for 5 min.

[0125] 4) Place the EP tube on a magnetic rack and transfer the supernatant to a new 1.5 mL EP tube after clarification.

[0126] (9) DNA extraction

[0127] 1) Add 1 mL of Buffer GDP to the EP tube, vortex thoroughly to mix, and incubate at room temperature for 10 min, inverting 2 to 3 times to mix.

[0128] 2) Quickly remove the liquid from the collection tube wall, place the FastPure gDNA mini Columns adsorption column in the CollectionTubes 2mL collection tube, transfer 650 μL of sample to the adsorption column, and centrifuge at 12000 rpm for 60 seconds.

[0129] 3) Discard the filtrate and transfer all the remaining samples to the adsorption column and centrifuge at 12000 rpm for 60 seconds.

[0130] 4) Discard the filtrate, add 700 μL Buffer GW to the adsorption column along the tube wall, and centrifuge at 12000 rpm for 60 seconds.

[0131] 5) Discard the filtrate and centrifuge at 12000 rpm for 2 min.

[0132] 6) Open the lid and let dry at room temperature for 2 to 5 minutes.

[0133] 7) Insert the adsorption column into a new 1.5mL EP tube and add 20μL ddH 2 O to the center of the adsorption column and leave it for 2 minutes.

[0134] 8) Centrifuge at 12000 rpm for 2 min and store the product at -20°C.

[0135] (10) qPCR: Spike in DNA (ATAACTCAATGTTGGCCTGTATAGCTTTCAGTGATT GCGATTCGCCTGTCTCTGCCTAATCCAAACTCTTTACCCGTCCTTGGGTCCCTGTAGCAGTAATATCCATTGTTTCTTATATAAAGGTTAGGGGGTAAATCCCGGCGCTCATGACTTCGCCTTCTTCCCATTTC TGATCCTCTTCAAAAGGCCACCTGTTACTGGTCGATTTAAGTCAACCTTTACCGCTGATTCGTGGAACAGATACTCTCTTCCATCCTTAACCGGAGGTGGGAATATCCTGCATTCCCGAACCCATCGACGA(SEQ ID NO.7)) uniformly calibrate the data, Arg-1 (Forword: AGTTGTCTTTGTCGTGTG (SEQ ID NO.8)

[0136] CC, Reverse: CCCATTGCTCCGTTTCGATT (SEQ ID NO.9)). The reaction system used ChamQ SYBR qPCR Master Mix (Novozyme). The ΔΔCt method was used to calculate the relative expression level, and the difference was analyzed by t-test statistics.

[0137] like Fig. 9,The results showed that after SBI-0206965 treatment, autophagy deficiency reduced the acetylation level of Arg-1 gene, enhancer-specific histone, which also verified the results of western blotting.

[0138] Example 3: Autophagy inhibition can reduce the immunosuppressive ability of M2 macrophages

[0139] In this example, flow cytometry was used to detect the inhibition of T cell proliferation by RAW264.7 treated with induction medium and SBI-0206965. The specific experimental process is as follows:

[0140] (1) CD3 plating: Calculate the number of wells required for plating in a 96-well plate, dilute CD3 (Biolegend) to 250 ng / mL with PBS and add 200 μL to each well, and incubate at 4°C overnight.

[0141] (2) Extraction of T cells:

[0142] 1) After euthanizing the mice, soak them in alcohol for 2 minutes and extract the spleen.

[0143] 2) Prepare MACS solution according to Table 3, soak the spleen in MACS solution and grind it, then filter it with a 70 μM cell sieve, collect the single cell solution in a 15 mL centrifuge tube, centrifuge at 300×g for 5 min, and discard the supernatant.

[0144] Table 3 MACS solution preparation (500 mL)

[0145]

[0146]

[0147] 3) Prepare red blood cell lysis buffer with RBC Lysis Buffer (Biolegend), add the cell pellet from the previous step, add PBS after 5 minutes to stop red blood cell lysis, centrifuge at 300×g for 5 minutes, and discard the supernatant.

[0148] (3) CFSE staining: resuspend the cells with 2 mL PBS, add 0.5 μL 5 mM CFSE, incubate at 37°C for 10 min, and add PBS solution containing 1% FBS to terminate the staining.

[0149] (4) Centrifuge at 300 × g for 5 min, discard the supernatant, add T cell culture medium, and count (subsequently every 2 × 10 5 One well of a 96-well plate).

[0150] (5) Add 250 ng / mL CD28 to the T cells to be plated, remove the CD3 incubated overnight, and plate the T cells.

[0151] (6) RAW264.7 cells treated accordingly were added to the corresponding wells at a ratio of T cells to RAW cells of 2:1 and co-cultured for 48 h.

[0152] (7) Collect the cells after co-culture, wash the cells once with MACS solution, and discard the supernatant. Add 5 μL rat serum (Kangyuan Biotechnology), 1 μL Alexa 700CD90.2 (BioLegend), 20 μL magnetic activated cell sorting (MACS) solution, incubate in the dark for 20 min.

[0153] (8) Centrifuge at 300 × g for 5 min, discard the supernatant, add 1 mL of MACS solution, and detect T cell proliferation using flow cytometry.

[0154] like Fig.10 Compared with the control group (treated with induction medium only), the degree of inhibition of T cell proliferation in RAW264.7 treated with induction medium and SBI-0206965 was significantly reduced, which indicates that autophagy inhibition can reduce the immunosuppressive ability of M2 macrophages.

[0155] The foregoing is merely a specific embodiment of the present invention, which enables those skilled in the art to understand or implement the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features claimed herein.

Claims

1. A method for reducing the immunosuppressive effect of M2 macrophages, characterized in that: The method comprises contacting M2 macrophages with an agent that inhibits macrophage autophagy.

2. The method according to claim 1, characterized in that: The immunosuppressive effects of M2 macrophages include inhibition of T cell proliferation.

3. The method according to claim 1, characterized in that: The agent that inhibits macrophage autophagy is SBI-0206965.

4. Use of an agent that inhibits macrophage autophagy in the preparation of a drug for restoring T cell proliferation ability.

5. Use of an agent for inhibiting macrophage autophagy in the preparation of an agent for inhibiting intracellular synthesis of acetyl-CoA or an H3K27 acetylation inhibitor.

6. The use according to claim 4 or 5, characterized in that: The agent for inhibiting macrophage autophagy is SBI-0206965.

7. Use of an agent for inhibiting macrophage autophagy in the preparation of a drug for treating acetyl-CoA-related diseases or H3K27 acetylation-related diseases.

8. The use according to claim 7, characterized in that: The acetyl-CoA-related diseases include one or more of cancer, fatty liver, mitochondrial dysfunction-related diseases, metabolic encephalopathy, heart disease, and metabolic syndrome-related diseases; The H3K27 acetylation-related diseases include one or more of cancer, systemic lupus erythematosus, Alzheimer's disease, neurodegenerative diseases, muscle-related diseases, and heart disease.

9. Use of an agent for inhibiting macrophage autophagy in the preparation of an Arg-1 inhibitor or a VEGFα inhibitor.

10. The use according to any one of claims 7 to 9, characterized in that: The agent for inhibiting macrophage autophagy is SBI-0206965.

Images