Processing method of traditional Chinese medicine decoction pieces for lividae animal vein blood
By homogenizing, filtering, freezing and drying the deer blood, Chinese herbal medicines were prepared and tested by PCR, the problem of inconvenience in the detection of deer blood in the prior art was solved, and efficient and accurate detection effects were achieved.
Patent Information
- Application Number
- CN202510271081.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-06-06
AI Technical Summary
In the prior art, when producing deer blood capsules and tablets, it is difficult to achieve efficient and accurate detection operations, and it is not convenient to conduct control experiments, and cannot meet the detection needs.
By homogenizing, filtering, freezing and drying the fresh deer blood of the deer family, the Chinese herbal medicine tablets were prepared intravenous blood of the deer family, and the obtained Chinese herbal medicine tablets and deer blood crystals were compared and tested by polymerase chain reaction method (PCR method), so that DNA extraction and PCR reaction were achieved.
It realizes efficient and accurate detection of deer blood products, can quickly prepare Chinese herbal medicines, and ensure the accuracy of the detection through multiple controlled experiments.
Smart Images
Figure CN120093783A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of blood products, in particular to a method for preparing Chinese medicinal pieces of venous fresh blood of deer. Background Art
[0002] Deer blood is the blood of sika deer and red deer, animals of the Cervidae family. It is a precious Chinese medicine. Since ancient times, it has been a treasure for royal families and dignitaries to treat diseases and keep fit. The compound products based on it are called immortal prescriptions. It tastes sweet and salty, is hot in nature, and enters the liver and kidney meridians. It has the effects of nourishing blood and essence, promoting blood circulation and removing paralysis, and reducing swelling and healing wounds. It is mainly used to treat weakness, low back pain, palpitations, insomnia, repeated vomiting of blood in the lungs, metrorrhagia, and leucorrhea. With the advancement of modern medicine and the development of science and technology, the research on the chemical composition and pharmacological effects of deer blood has become more and more in-depth, and the application of deer blood is no longer limited to the field of health food. Products developed with deer blood as raw materials have good small quantities and broad market prospects.
[0003] When deer blood is currently used to make capsules and tablets, it is not convenient to perform efficient and accurate testing operations on the finished deer blood products, and it is not convenient to implement control experiments during testing; therefore, it does not meet existing needs. In this regard, we propose a method for preparing Chinese medicinal slices of venous fresh blood of deer animals. Summary of the invention
[0004] The purpose of the present invention is to provide a method for preparing Chinese medicinal slices of venous fresh blood of Cervidae animals, so as to solve the problems raised in the above background technology that when deer blood is currently used to make capsules and tablets, it is not convenient to perform efficient and accurate detection operations on the finished deer blood products, and it is not convenient to carry out control experiments during detection.
[0005] To achieve the above object, the present invention provides the following technical solution: a method for preparing Chinese medicinal slices of venous fresh blood of deer, comprising the following steps:
[0006] S1: obtaining fresh deer blood of Cervidae, homogenizing and filtering the fresh deer blood in an environment of temperature t1, and then freezing and drying to prepare Chinese medicinal slices of fresh venous blood of Cervidae, and performing comparative detection on the prepared Chinese medicinal slices of fresh venous blood of Cervidae and deer blood crystals by polymerase chain reaction method;
[0007] S2: Specifically, 0.02 g of each of the fine powder and the decoction pieces of fresh venous blood of Cervidae were taken, wherein the fresh venous blood of Cervidae was used as the sample and the deer blood crystal was used as the control medicinal material, and the powder and the deer blood crystal were placed in a 1.5 ml centrifuge tube, and genomic DNA was extracted using a blood DNA extraction kit;
[0008] S3: Add 200ul buffer GS and shake to dissolve, add 20ul proteinase K with a concentration of 20mg / ml and mix by pipetting, add 200ul buffer GB and mix by inversion and place in a 56℃ water bath for 10 minutes, add 200ul anhydrous ethanol and mix by pipetting and add to the DNA purification column and keep it in a centrifugal state, discard the filtrate and add 500ul rinse solution GD and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and then keep it in a centrifugal state again, take out the adsorption column and put it in another centrifuge tube, add 200ul elution buffer TB and let it stand at room temperature for 2min, then centrifuge and keep it in a centrifugal state at a speed of 8000r / min for 2min, take the eluate as the test solution and store it at minus 20℃ for use;
[0009] S4: The template DNA solutions of the above-mentioned samples and control medicinal materials and the same volume of sterile ultrapure water are subjected to PCR reaction, wherein the sterile ultrapure water is a blank control. Specifically, the samples, control medicinal materials and sterile ultrapure water are all subjected to PCR reaction in a 200ul centrifuge tube, and the total reaction volume is 10ul. The reaction system includes 2×Taq MasterMix premixed with Taq enzyme and a capacity of 5ul, wherein the forward and reverse identification primers with a concentration of 2umol / L are 1ul each, the samples and control medicinal materials are 1ul each, and the sterile ultrapure water is 2ul. The centrifuge tube is placed in a PCR instrument, and the PCR reaction parameters of the PCR instrument are set;
[0010] S5: According to the agarose gel electrophoresis method, the gel concentration is controlled at 1.5%, and the nucleic acid dye GelRed is added to the gel. The loading amount of the PCR reaction solution of the sample and the control medicinal material is 5ul, and the loading amount of the DNA molecular weight marker is 5ul with a concentration of 0.08mg / ml. After the electrophoresis is completed, take the gel slice and examine it on a gel imager or a UV transilluminator. There should be a single DNA band at the corresponding position of 350-400bp in the gel electrophoresis map of the sample and the control medicinal material, and there is no amplification band with the specific primers of other animals. Sterile ultrapure water as a blank control shows no band.
[0011] Preferably, the Cervidae animal in S1 is a sika deer or a red deer, and the Cervidae animal venous blood Chinese medicinal slices are in the form of fragments and powder, with a purple-red or purple-black surface and a crystal luster, a loose texture, easy to break, easy to absorb moisture, a slightly fishy smell, and a sweet and slightly salty taste.
[0012] Preferably, t1 in S1 is 5-8°C.
[0013] Preferably, the method for extracting genomic DNA in S2 is column affinity method and chromatography method.
[0014] Preferably, the centrifugal state in S3 is 8000 r / min and maintained for 30 seconds.
[0015] Preferably, the PCR reaction parameters in S4 are pre-denaturation at 94°C for 5 min, 35 cycles of 94°C for 45 s, 56°C for 45 s, 72°C for 45 s, and extension at 72°C for 10 min.
[0016] Preferably, the identification primers in S4 are respectively 5'CAGCCTTCCTATTGACCCTTAAT3' and 5'CGGCTGTAAAGTTACTTTCGTTG3' for deer, 5'AATTTCTAAAAACCTTCAAGAA3' and 5'CAAGTACTTGCTTATAAGCAT3' for reindeer, 5'GCACACCTATAACGGTAGCTCAT3' and 5'TCCTAGCTATCGTGTGTCAGGAT3' for pig, 5'GGcCCTCTTACTAATTCTAGCT3' and 5'CCGATGGTGATATATGGGTGTT3' for cattle, and 5'CAAGCTCAACGACACATCTATC3' and 5'CCCTGAAGGTTAAGGTTT3' for horse. TG3', donkey 5CAAGCTCAACGTCACACATATC3' and 5CCTGTGTTGGGTTAACAATAGTC3', sheep 5GGCGCCATGCTACTAATTCTTGTT3' and 5'GAGGAAGGGTACAAGTACTAAGAT3', rabbit 5'CGGCGTAAAGCGTGATTAGAATAA3' and 5GCTATCGTGAGTTCGAAGAGTAT3', chicken 5'CCATCTTAGCCTCAACGATTAA3' and 5'GGCTATTGAGCTCACTGTTGTT3', duck 5GCGCTATCCTATATCTCAGGGATTA3' and 5'TGATTGTCATCGGGTTTGGATCGT3'.
[0017] Preferably, the moisture content of the Chinese herbal medicine slices of fresh venous blood of Cervidae is no more than 9.0%, the residue on ignition is no more than 6.0%, the total number of aerobic bacteria is ≤105cfulg, the total number of molds and yeasts is ≤103cfulg, the bile-resistant Gram-negative bacteria is <10+cfu / g, and the value of the Chinese herbal medicine slices of fresh venous blood of Cervidae measured by cold immersion method according to the water-soluble extract determination method is not less than 90.0%.
[0018] Compared with the prior art, the present invention has the following beneficial effects:
[0019] The present invention sequentially homogenizes, filters, freezes and dries the venous fresh blood of Cervidae, so as to quickly prepare Chinese medicinal pieces. Meanwhile, a plurality of control experiments are performed on the Chinese medicinal pieces of venous fresh blood of Cervidae, deer blood crystals and sterile ultrapure water, so as to extract DNA, sequentially perform PCR reaction and electrophoresis detection, and realize efficient and accurate detection of deer blood products. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 It is a schematic diagram of the overall process of the present invention;
[0021] Figure 2 The figure is a schematic diagram of the deer blood polymerase chain reaction method of the present invention. DETAILED DESCRIPTION
[0022] The technical solutions in the embodiments of the present invention will be described clearly and completely below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments.
[0023] See also Figure 1 and Figure 2 The present invention provides an embodiment: a method for preparing a Chinese medicinal piece of fresh venous blood of a deer family animal, comprising the following steps:
[0024] S1: obtaining fresh deer blood of Cervidae, homogenizing and filtering the fresh deer blood in an environment of temperature t1, and then freezing and drying to prepare Chinese medicinal slices of fresh venous blood of Cervidae, and performing comparative detection on the prepared Chinese medicinal slices of fresh venous blood of Cervidae and deer blood crystals by polymerase chain reaction method;
[0025] S2: Specifically, 0.02 g of each of the fine powder and the decoction pieces of fresh venous blood of Cervidae were taken, wherein the fresh venous blood of Cervidae was used as the sample and the deer blood crystal was used as the control medicinal material, and the powder and the deer blood crystal were placed in a 1.5 ml centrifuge tube, and genomic DNA was extracted using a blood DNA extraction kit;
[0026] S3: Add 200ul buffer GS and shake to dissolve, add 20ul proteinase K with a concentration of 20mg / ml and mix by pipetting, add 200ul buffer GB and mix by inversion and place in a 56℃ water bath for 10 minutes, add 200ul anhydrous ethanol and mix by pipetting and add to the DNA purification column and keep it in a centrifugal state, discard the filtrate and add 500ul rinse solution GD and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and then keep it in a centrifugal state again, take out the adsorption column and put it in another centrifuge tube, add 200ul elution buffer TB and let it stand at room temperature for 2min, then centrifuge and keep it in a centrifugal state at a speed of 8000r / min for 2min, take the eluate as the test solution and store it at minus 20℃ for use;
[0027] S4: The template DNA solutions of the above-mentioned samples and control medicinal materials and the same volume of sterile ultrapure water are subjected to PCR reaction, wherein the sterile ultrapure water is a blank control. Specifically, the samples, control medicinal materials and sterile ultrapure water are all subjected to PCR reaction in a 200ul centrifuge tube, and the total reaction volume is 10ul. The reaction system includes 2×Taq MasterMix premixed with Taq enzyme and a capacity of 5ul, wherein the forward and reverse identification primers with a concentration of 2umol / L are 1ul each, the samples and control medicinal materials are 1ul each, and the sterile ultrapure water is 2ul. The centrifuge tube is placed in a PCR instrument, and the PCR reaction parameters of the PCR instrument are set;
[0028] S5: According to the agarose gel electrophoresis method, the gel concentration is controlled at 1.5%, and the nucleic acid dye GelRed is added to the gel. The loading amount of the PCR reaction solution of the sample and the control medicinal material is 5ul, and the loading amount of the DNA molecular weight marker is 5ul with a concentration of 0.08mg / ml. After the electrophoresis is completed, take the gel slice and examine it on a gel imager or a UV transilluminator. There should be a single DNA band at the corresponding position of 350-400bp in the gel electrophoresis map of the sample and the control medicinal material, and there is no amplification band with the specific primers of other animals. Sterile ultrapure water as a blank control shows no band.
[0029] See attached Figure 1 , t1 in S1 is 5-8°C, the method for extracting genomic DNA is column affinity method and chromatography, and the centrifugal state is 8000r / min and maintained for 30s;
[0030] The PCR reaction parameters are pre-denaturation at 94°C for 5 min, 35 cycles of reaction at 94°C for 45 s, 56°C for 45 s, 72°C for 45 s, and extension at 72°C for 10 min. By extracting DNA from Chinese herbal medicines and performing PCR reactions, it is possible to generate a gel electrophoresis map according to the agarose gel electrophoresis method.
[0031] The Cervidae animal is a sika deer or a red deer. The Chinese medicinal slices of venous fresh blood of Cervidae are in the form of fragments and powder, with a purple-red or purple-black surface and crystal luster, loose texture, easy to break, easy to absorb moisture, slightly fishy smell, sweet and slightly salty taste. The moisture content of the Chinese medicinal slices of venous fresh blood of Cervidae is not more than 9.0%, the residue on ignition is not more than 6.0%, the total number of aerobic bacteria is ≤105cfulg, the total number of molds and yeasts is ≤103cfulg, and the number of bile-resistant Gram-negative bacteria is <10+cfu / g. The Chinese medicinal slices of venous fresh blood of Cervidae have a value of not less than 90.0% when measured by cold immersion method according to the water-soluble extract determination method. By measuring various parameters of the Chinese medicinal slices of venous fresh blood of Cervidae, the stable quality in production and sales can be effectively guaranteed.
[0032] The identification primers in S4 were deer 5′CAGCCTTCCTATTGACCCTTAAT3′ and 5′CGGCTGTAAAGTTACTTTCGTTG3′, reindeer 5′AATTTCTAAAAACCTTCAAGAA3′ and 5′CAAGTACTTGCTTATAAGCAT3′, pig 5′GCACACCTATAACGGTAGCTCAT3′ and 5′TCCTAGCTATCGTGTGTCAGGAT3′, cattle 5′GGcCCTCTTACTAATTCTAGCT3′ and 5′CCGATGGTGATATATGGGTGTT3′, and horse 5′CAAGCTCAACGACACATCTAT3′ and 5′CCCTGAAGGTTAAGGTTTGT3′. ', donkey 5CAAGCTCAACGTCACACATATC3' and 5CCTGTGTTGGGTTAACAATAGTC3', sheep 5GGCGCCATGCTACTAATTCTTGTT3' and 5'GAGGAAGGGTACAAGTACTAAGAT3', rabbit 5'CGGCGTAAAGCGTGATTAGAATAA3' and 5GCTATCGTGAGTTCGAAGAGTAT3', chicken 5'CCATCTTAGCCTCAACGATTAA3' and 5'GGCTATTGAGCTCACTGTTGTT3', duck 5GCGCTATCCTATATCTCAGGGATTA3' and 5'TGATTGTCATCGGGTTTGGATCGT3'.
[0033] It will be apparent to those skilled in the art that the invention is not limited to the details of the exemplary embodiments described above and that the invention can be implemented in other specific forms without departing from the spirit or essential features of the invention. Therefore, the embodiments should be considered exemplary and non-limiting in all respects, and the scope of the invention is defined by the appended claims rather than the foregoing description, and it is intended that all variations falling within the meaning and scope of the equivalent elements of the claims be included in the invention. Any reference numeral in a claim should not be considered as limiting the claim to which it relates.
Claims
1. A method for preparing a Chinese medicinal piece of fresh venous blood of a deer family animal, characterized in that: The steps include: S1: obtaining fresh deer blood of Cervidae, homogenizing and filtering the fresh deer blood in an environment of temperature t1, and then freezing and drying to prepare Chinese medicinal slices of fresh venous blood of Cervidae, and performing comparative detection on the prepared Chinese medicinal slices of fresh venous blood of Cervidae and deer blood crystals by polymerase chain reaction method; S2: Specifically, 0.02 g of each of the fine powder and the decoction pieces of fresh venous blood of Cervidae were taken, wherein the fresh venous blood of Cervidae was used as the sample and the deer blood crystal was used as the control medicinal material, and the powder and the deer blood crystal were placed in a 1.5 ml centrifuge tube, and genomic DNA was extracted using a blood DNA extraction kit; S3: Add 200ul buffer GS and shake to dissolve, add 20ul proteinase K with a concentration of 20mg / ml and mix by pipetting, add 200ul buffer GB and mix by inversion and place in a 56℃ water bath for 10 minutes, add 200ul anhydrous ethanol and mix by pipetting and add to the DNA purification column and keep it in a centrifugal state, discard the filtrate and add 500ul rinse solution GD and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and then keep it in a centrifugal state again, take out the adsorption column and put it in another centrifuge tube, add 200ul elution buffer TB and let it stand at room temperature for 2min, then centrifuge and keep it in a centrifugal state at a speed of 8000r / min for 2min, take the eluate as the test solution and store it at minus 20℃ for use; S4: The template DNA solutions of the above-mentioned samples and control medicinal materials and the same volume of sterile ultrapure water are subjected to PCR reaction, wherein the sterile ultrapure water is a blank control. Specifically, the samples, control medicinal materials and sterile ultrapure water are all subjected to PCR reaction in a 200ul centrifuge tube, and the total reaction volume is 10ul. The reaction system includes 2×Taq Master Mix premixed with Taq enzyme and a volume of 5ul, wherein the forward and reverse identification primers with a concentration of 2umol / L are 1ul each, the samples and control medicinal materials are 1ul each, and the sterile ultrapure water is 2ul. The centrifuge tube is placed in a PCR instrument, and the PCR reaction parameters of the PCR instrument are set; S5: According to the agarose gel electrophoresis method, the gel concentration is controlled at 1.5%, and the nucleic acid dye GelRed is added to the gel. The loading amount of the PCR reaction solution of the sample and the control medicinal material is 5ul, and the loading amount of the DNA molecular weight marker is 5ul with a concentration of 0.08mg / ml. After the electrophoresis is completed, take the gel slice and examine it on a gel imager or a UV transilluminator. There should be a single DNA band at the corresponding position of 350-400bp in the gel electrophoresis map of the sample and the control medicinal material, and there is no amplification band with the specific primers of other animals. Sterile ultrapure water as a blank control shows no band.
2. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 1, characterized in that: The deer in S1 is a sika deer or a red deer, and the Chinese medicinal preparation of fresh venous blood of the deer is in the form of fragments and powder, with a purple-red or purple-black surface and a crystal luster, a loose texture, easy to break, easy to absorb moisture, a slightly fishy smell, and a sweet and slightly salty taste.
3. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 2, characterized in that: The t1 in S1 is 5-8°C.
4. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 1, characterized in that: The method for extracting genomic DNA in S2 is column affinity method and chromatography method.
5. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 1, characterized in that: The centrifugal state in S3 is 8000 r / min and maintained for 30 seconds.
6. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 1, characterized in that: The PCR reaction parameters in the S4 are pre-denaturation at 94°C for 5 min, 35 cycles of reaction at 94°C for 45 s, 56°C for 45 s, 72°C for 45 s, and extension at 72°C for 10 min.
7. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 6, characterized in that: The identification primers in S4 are deer 5'CAGCCTTCCTATTGACCCTTAAT3' and 5'CGGCTGTAAAGTTACTTTCGTTG3', reindeer 5'AATTTCTAAAAACCTTCAAGAA3' and 5'CAAGTACTTGCTTATAAGCAT3', pig 5'GCACACCTATAACGGTAGCTCAT3' and 5'TCCTAGCTATCGTGTGTCAGGAT3', cattle 5'GGcCCTCTTACTAATTCTAGCT3' and 5'CCGATGGTGATATATGGGTGTT3', horse 5'CAAGCTCAACGACACATCTATC3' and 5'CCCTGAAGGTTAAGGTTTGT3'. 3', donkey 5CAAGCTCAACGTCACACATATC3' and 5CCTGTGTTGGGTTAACAATAGTC3', sheep 5GGCGCCATGCTACTAATTCTTGTT3' and 5'GAGGAAGGGTACAAGTACTAAGAT3', rabbit 5'CGGCGTAAAGCGTGATTAGAATAA3' and 5GCTATCGTGAGTTCGAAGAGTAT3', chicken 5'CCATCTTAGCCTCAACGATTAA3' and 5'GGCTATTGAGCTCACTGTTGTT3', duck 5GCGCTATCCTATATCTCAGGGATTA3' and 5'TGATTGTCATCGGGTTTGGATCGT3'.
8. The method for preparing the Chinese medicinal slices of venous fresh blood of Cervidae according to claim 1, characterized in that: The moisture content of the Chinese medicinal slices of fresh venous blood of Cervidae is no more than 9.0%, the residue on ignition is no more than 6.0%, the total number of aerobic bacteria is ≤105cfulg, the total number of molds and yeasts is ≤103cfulg, the bile-resistant Gram-negative bacteria is <10+cfu / g, and the value of the Chinese medicinal slices of fresh venous blood of Cervidae measured by cold immersion method according to the water-soluble extract determination method is not less than 90.0%.