Application of TOMM40 in preparation of medicine for treating breast cancer

By constructing breast cancer cell lines with overexpression and knockdown of TOMM40, it was found that TOMM40 promotes the metastasis and proliferation of breast cancer cells, and treats cells with PHB2 binding agents and DDR1 inhibitors, inhibits the activation of signaling pathways caused by the increase of TOMM40, significantly enhances the killing ability of breast cancer cells, and provides a new breast cancer treatment strategy.

CN120093925APending Publication Date: 2025-06-06FUDAN UNIV SHANGHAI CANCER CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510276346.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-10
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art lacks research on the regulatory mechanism of TOMM40 in breast cancer metastasis, and it is difficult to find potential diagnostic and therapeutic targets for breast cancer.

Method used

By constructing breast cancer cell lines that stably knock out and overexpress TOMM40, the role of TOMM40 was verified, and the interaction of TOMM40 and PHB2 was determined using IP-mass, it was further found that TOMM40 promoted the phosphorylation activation of DDR1 and SRC and activated downstream signaling pathways. Breast cancer cells were treated with PHB2 binding agent Fluorizoline and DDR1 inhibitor DDR1-IN-1, which inhibited signaling pathway activation caused by increased TOMM40.

Benefits of technology

By inhibiting the binding of TOMM40 to PHB2 and DDR1 phosphorylation, the killing ability of breast cancer cells is significantly enhanced, providing a new breast cancer treatment strategy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120093925A_ABST
    Figure CN120093925A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicine, in particular to application of TOMM40 in preparation of a medicine for treating breast cancer. The invention finds that TOMM40 overexpression promotes the increase of the content of DDR1 in lipid rafts instead of early-stage endosomes; a co-immunoprecipitation experiment shows that TOMM40 and PHB2 interact with DDR1 and SRC, and DDR1 and SRC also interact with each other; the combination of TOMM40 and PHB2 can promote phosphorylation activation of DDR1, the activated DDR1 further promotes activation of SRC interacting with the activated DDR1, activation of a downstream MAPK signal channel is caused, and meanwhile, the activated DDR1 can directly activate an AKT / mTOR channel; furthermore, the invention finds that the killing ability of tumor cells can be obviously enhanced by further utilizing Flurizoline and DDR1-IN-1 to treat the breast cancer cells, and the method is expected to become a new strategy for breast cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of TOMM40 in the preparation of drugs for treating breast cancer. Background Art

[0002] The latest data from the World Health Organization shows that the global cancer burden continued to increase in 2020, and the incidence of breast cancer exceeded that of lung cancer for the first time, becoming the most common cancer in the world. Globally, breast cancer accounts for more than a quarter of female cancer cases, and deaths caused by it account for about one-sixth of cancer deaths. Distant metastasis is the main cause of life threats to breast cancer patients. The AJCC (American Joint Committee on Cancer) cancer staging system divides primary breast cancer into four stages (TNM staging) with obvious prognostic differences based on the size of breast cancer tumors, lymph node metastasis, and the presence or absence of distant metastasis. Among them, the 5-year overall survival rate of early breast cancer patients in TNM stages I and II is more than 90%, while the 5-year overall survival rate of stage IV breast cancer patients with distant metastasis is only about 30%. Finding potential new targets related to breast cancer and exploring the specific mechanisms of malignant transformation of breast cancer will help in the diagnosis and treatment of breast cancer.

[0003] In recent years, with the development of deep sequencing and mass spectrometry technologies of various omics such as genomics, transcriptomics and proteomics, more and more tumor targets have been discovered and used for personalized treatment. In order to screen mitochondrial proteins that may promote breast cancer metastasis, this project used magnetic beads to separate the mitochondria of high and low metastatic breast cancer cell lines with the same genetic background in the laboratory, and then used iTRAQ-LC-MS / MS quantitative proteomics technology to analyze the mitochondrial proteins highly expressed in two high metastatic potential cell lines relative to the parental cell lines, and combined with online databases (Kaplan-Meier Plotter and Pubmed) to screen out mitochondrial proteins that may promote breast cancer metastasis. Subsequently, CRISPR-Cas9 gene knockout library technology was used to screen out genes that may promote breast cancer metastasis through a mouse lung metastasis model.

[0004] Studies have found that TOMM40 plays an important role in some neurodegenerative diseases such as Parkinson's disease, late-onset Alzheimer's disease and Huntington's disease. The relevant mechanism may be related to TOMM40 affecting mitochondrial function and mediating protein entry into mitochondria. There are very few studies on TOMM40 in tumors, and there is a lack of exploration of related mechanisms. Studies have found that TOMM40 expression is elevated in ovarian cancer and is associated with a poor prognosis. Interference with TOMM40 can reduce the production of ATP and increase the production of ROS. In breast cancer, researchers analyzed the membrane components of paclitaxel-resistant and sensitive cells and found that TOMM40 content increased in resistant cell membranes.

[0005] However, there is currently no research on the mechanism by which TOMM40 regulates breast cancer metastasis. Therefore, it is still crucial to explore the role of TOMM40 in breast cancer and its possible molecular mechanism. The research results are expected to provide a theoretical basis for discovering potential diagnostic and drug treatment targets for breast cancer. Summary of the invention

[0006] In order to solve the above problems, the purpose of the present invention is to provide the use of TOMM40 in the preparation of drugs for treating breast cancer.

[0007] The purpose of the present invention can be achieved by the following technical solutions:

[0008] The first object of the present invention is to provide an application of a TOMM40 inhibitor in the preparation of a drug for treating breast cancer. The nucleotide sequence of the TOMM40 gene is shown in SEQ ID NO.1.

[0009] In one embodiment of the present invention, the drug is a drug that inhibits the binding between TOMM40 and PHB2.

[0010] In one embodiment of the present invention, the drug is a drug that inhibits DDR1 phosphorylation.

[0011] In one embodiment of the present invention, the drug is a drug that inhibits SRC phosphorylation and AKT phosphorylation.

[0012] In one embodiment of the present invention, the drug is a drug that inhibits AKT / mTOR and MAPK signaling pathways.

[0013] In one embodiment of the present invention, the medicament further comprises a PHB2 binder.

[0014] In one embodiment of the present invention, the medicament further comprises a DDR1 inhibitor.

[0015] In one embodiment of the present invention, the PHB2 binder is Fluorizoline and the DDR1 inhibitor is DDR1-IN-1.

[0016] The second object of the present invention is to provide the use of TOMM40 in preparing a breast cancer prevention kit and / or screening drugs for treating breast cancer. The nucleotide sequence of the TOMM40 gene is shown in SEQ ID NO.1.

[0017] The third object of the present invention is to provide the use of TOMM40 in preparing a breast cancer prognosis detection kit, and the nucleotide sequence of TOMM40 is shown in SEQ ID NO.1.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] The present invention firstly constructs a breast cancer cell line with stable knockout and overexpression of TOMM40 and then verifies the cell function. It is found that overexpression of TOMM40 promotes the proliferation, tumor formation and metastasis of breast cancer cells in vivo and in vitro, while knocking down TOMM40 is the opposite. Further, the present invention uses IP-mass to determine that TOMM40 and PHB2 interact. TOMM40 does not affect the expression of PHB2 in breast cancer, but its increase can cause the content of PHB2 in mitochondria, cell membranes and lipid rafts to increase, while there is no obvious change in the nucleus. Then, it is found that overexpression of TOMM40 promotes the increase of DDR1 content in lipid rafts rather than early endosomes. Immunoprecipitation experiments found that TOMM40 and PHB2 interact with DDR1 and SRC, and DDR1 also interacts with SRC. The combination of TOMM40 and PHB2 can promote the phosphorylation activation of DDR1, and the activated DDR1 further promotes the activation of SRC that interacts with it, leading to the activation of the downstream MAPK signaling pathway. At the same time, the activated DDR1 can also directly activate the AKT / mTOR pathway. Finally, after the PHB2 binder Fluorizoline was used to block the binding of TOMM40 and PHB2, their binding to DDR1 and SRC was weakened, and the activation of SRC and downstream AKT / mTOR and MAPK signaling pathways caused by the increase of TOMM40 was inhibited. Simultaneously treating breast cancer cells with Fluorizoline and DDR1 inhibitor DDR1-IN-1 can significantly enhance the killing ability of tumor cells, which is expected to become a new strategy for the treatment of breast cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 To construct the characterization diagram of TOMM40 knockdown and overexpression cell lines. A: Western Blotting was used to detect the effects of TOMM40 knockdown and overexpression in different cell lines; BC: Real-time PCR was used to detect the effects of TOMM40 knockdown and overexpression in different cell lines. The differences were statistically significant, and * represents p<0.05.

[0021] Figure 2The results of the effect of TOMM40 on the migration and invasion of breast cancer cells in vitro are shown in Figure 1. A: The effect of TOMM40 knockdown in MDA-MB-231-HM and Hs578T and overexpression of the gene in 4173 and MDA-MB-231 on cell migration ability was detected, and the magnification was 200×; Figure B is a statistical graph of Figure A; C: The effect of TOMM40 knockdown in MDA-MB-231-HM and Hs578T and overexpression of the gene in MDA-MB-231 on cell invasion ability was detected, and the magnification was 200×; Figure D is a statistical graph of Figure C; * represents p<0.05.

[0022] Figure 3 The results of the effect of TOMM40 on the proliferation ability of breast cancer cells in vitro are shown in Figure 5. AC: The effect of TOMM40 on cell proliferation ability was detected in the TOMM40 overexpressing cell line MDA-MB-231 (A) and knockdown cell lines MDA-MB-231-HM (B) and Hs578T (C) using the IncuCyteZoom live cell workstation; DG: The effect of TOMM40 on cell clone formation ability was detected in the TOMM40 knockdown cell lines MDA-MB-231-HM and Hs578T (D) and the overexpressing cell line MDA-MB-231 (F) using a plate clone formation experiment, where E and G are the statistical graphs of D and F respectively; H: The effect of knockdown of TOMM40 in MDA-MB-231 on cell cycle was detected by flow cytometry; * represents p<0.05.

[0023] Figure 4 The results of the effect of TOMM40 on the metastasis and tumor formation of breast cancer cells in vivo are shown in Figure 5. AC: The effect of TOMM40 overexpression on the metastasis ability of MDA-MB-231 in mice was analyzed by in vivo imaging of small animals, where Figure A is the overall imaging of mice, Figure B is the imaging of ex vivo lung tissue, and Figure C is a statistical graph of the fluorescence signal intensity of Figure B; DF: The effect of TOMM40 overexpression on the tumor formation ability of MDA-MB-231 in mice, where Figure D is the overall imaging of mice, Figure E is the ex vivo tumor tissue, and Figure F is a statistical graph of the tumor weight of Figure E.

[0024] Figure 5The results of the effects of Fluorizoline and DDR1-IN-1 alone or in combination on cell proliferation ability. Among them, AD: drug sensitivity curves of different concentrations of Fluorizoline treated with TOMM40 knockdown or control cells (A and B: MDA-MB-231-HM; C and D: MDA-MB-231), where B and D are IC50 statistical graphs in A and C, respectively, and * represents p<0.05; E: The effect of low concentration of Fluorizoline on the activity of TOMM40 knockdown cells MDA-MB-231-HM, MDA-MB-231 and overexpressed cells MDA-MB-231; FK: Drug sensitivity curves of different concentrations of DDR1-IN-1 alone or in combination with Fluorizoline (4μM) treated with TOMM40 knockdown or overexpressed cells, where G, I, and K are IC50 statistical graphs of F, H, and J, respectively, and * represents p<0.05. DETAILED DESCRIPTION

[0025] The present invention is described in detail below with reference to the accompanying drawings and specific embodiments.

[0026] In the following examples, the sequences involved were commissioned to be synthesized by Cytoxan; unless otherwise specified, the reagents used were commercially available reagents, and the detection means and methods used were conventional detection means and methods in the art.

[0027] Example 1

[0028] This example provides the construction of a cell line with stable overexpression and knockdown of TOMM40, comprising the following steps:

[0029] In the present invention, the nucleotide sequence of TOMM40 is shown in SEQ ID NO.1 (5'-3');

[0030]

[0031] TOMM40-F (SEQ ID NO.2): 5'-CCGGAATTCGCCACCATGGACTACAAGGA CGATGATGACAAGCTCGATGGAGGAATGGGGAACGTGTTGGCT GC-3';

[0032] TOMM40-R (SEQ ID NO.3): 5'-CGCGGATCCTCAGCCGATGGTGAGGCCA A-3';

[0033] The targets of TOMM40 are sgTOMM40#5 and sgTOMM40#6.

[0034] sgTOMM40#5 (SEQ ID NO.4): 5'-CACCGCTCACAGGCGTTCCCTGTAC-3';

[0035] sgTOMM40#5-F (SEQ ID NO.5): 5'-CACCGCACCGCTCACAGGCGTTCCCT GTAC-3';

[0036] sgTOMM40#5-R (SEQ ID NO.6): 5'-AAACGTACAGGGAACGCCTGTGAGCG GTGC-3';

[0037] sgTOMM40#6 (SEQ ID NO.7): 5'-CACCGTGGACTCCCCGATTGTGCTG-3';

[0038] sgTOMM40#6-F (SEQ ID NO.8): 5'-CACCGCACCGTGGACTCCCCGATTGT GCTG-3';

[0039] sgTOMM40#6-R (SEQ ID NO.9): 5'-AAACCAGCACAATCGGGGAGTCCACG GTGC-3';

[0040] sgNC fragment (SEQ ID NO. 10): 5'-CACCGACGGAGGCTAAGCGTCGCAAGTT T-3'.

[0041] (I) Construction of recombinant plasmid:

[0042] (A) Construction of TOMM40 overexpression recombinant plasmid:

[0043] (A1) using TOMM40-F and TOMM40-R as primers and the sequence shown in SEQ ID NO.1 as a template, synthesizing the TOMM40 fragment;

[0044] (A2) digesting the TOMM40 fragment with EcoRI-HF and BamH1-HF to obtain digested fragments;

[0045] (A3) using EcoRI-HF and BamH1-HF to digest the pCDH vector to obtain a digested vector;

[0046] (A4) using T4 ligase to connect the digested fragment and the digested vector to obtain a TOMM40 overexpression ligation product;

[0047] Among them, the vector pCDH was used as the overexpression control group.

[0048] (B) Construction of TOMMM40 knockdown recombinant plasmid:

[0049] (B1) The lentiGuide-puro vector digested with BsmBI was used as the vector fragment;

[0050] (B2) using sgTOMM40#5-F and sgTOMM40#5-R as primers and the sequence shown in SEQ ID NO.4 as a template, synthesizing the sgTOMM40#5 fragment;

[0051] The sgTOMM40#5 fragment was digested with BsmBI to obtain digested fragment 1;

[0052] (B3) using sgTOMM40#6-F and sgTOMM40#6-R as primers and the sequence shown in SEQ ID NO.7 as a template, synthesizing the sgTOMM40#6 fragment;

[0053] The sgTOMM40#6 fragment was digested with BsmBI to obtain digested fragment 2;

[0054] (B4) using BsmBI to digest the sgNC fragment to obtain digested fragment 3;

[0055] (B5) using T4 ligase to connect the digested fragment and digested vector 1 to obtain sgTOMM40#5 ligation product;

[0056] The restriction fragment and the restriction vector 2 were connected using T4 ligase to obtain the sgTOMM40#6 connection product;

[0057] The restriction fragment and the restriction vector 3 were ligated using T4 ligase to obtain the sgNC ligation product (as a knockdown control group).

[0058] (II) Transformation

[0059] The TOMM40 overexpression ligation product, sgTOMM40#5 ligation product, sgTOMM40#6 ligation product, and sgNC ligation product were added to the DH5α competent cell respectively, placed on ice for 2 minutes, 42°C for 30 seconds, and then placed on ice for 2 minutes. Then, 900 μL of empty LB culture medium was added, and the competent cells were cultured at 37°C for 1 hour. Then, the competent cells were centrifuged at 3000 rpm for 3 minutes, the supernatant was poured out, and 100 μL was kept for even blowing and then coated on the plate; single clones were picked, shaken, and sent for sequencing. The bacterial solution with correct sequencing was shaken.

[0060] (III) Plasmid extraction

[0061] (1) Centrifuge 5 mL of LB medium containing the correctly sequenced bacterial suspension at high speed (13,000 g) for 1 minute, pour off the upper liquid and retain the precipitate.

[0062] (2) Add 500 μL of P1 buffer (to which RNase A has been added) to the precipitate to thoroughly suspend the bacterial precipitate.

[0063] (3) Add 500 μL of P2 solution to the centrifuge tube, gently invert it 6-8 times, then add 500 μL of P4 and immediately invert it 6-8 times, and let it stand at room temperature for 10 minutes.

[0064] (4) Centrifuge at 13,000 g for 10 minutes, collect the supernatant and transfer it to a CS filter column in a centrifuge tube. Centrifuge at 13,000 g for 2 minutes and collect the filtrate in the centrifuge tube.

[0065] (5) Add isopropanol (about 30% of the volume of the filtrate) according to the volume of the filtrate collected in the previous step, invert 6-8 times to mix, and then transfer the liquid to the treated CP4 adsorption column (treatment: add 500 μL of BL balance solution to the CP4 adsorption column and centrifuge at 13000g for 1 minute).

[0066] (6) Centrifuge at 13,000 g for 1 minute, discard the waste liquid, add 0.5 mL of PD solution to the CP4 adsorption column, continue to centrifuge the adsorption column at 13,000 g for 1 minute, and then retain the CP4 adsorption column.

[0067] (7) Add 0.7 mL of PW rinse solution (with anhydrous ethanol added in advance) to the CP4 adsorption column, centrifuge at 13,000 g for 1 min, and discard the waste liquid. Repeat this step once.

[0068] (8) Centrifuge the adsorption column again at 13000g for 2 minutes, place the adsorbed column in a new centrifuge tube, add 100 μL of elution buffer TB preheated at 65°C, leave at room temperature for 3 minutes, centrifuge at 13000g for 1 minute, and the collected liquid is the plasmid (TOMM40 overexpression recombinant plasmid, sgTOMM40#5 recombinant plasmid, sgTOMM40#6 recombinant plasmid, sgNC recombinant plasmid). Determine the concentration and store at -20°C.

[0069] (IV) Lentivirus packaging

[0070] (1) One day before virus packaging, HEK-293T cells were seeded into a 60 mm culture dish so that the density could reach about 80-90% on the next day.

[0071] (2) 4 μg of target plasmids (TOMM40 overexpression recombinant plasmid, vector pCDH, sgTOMM40#5 recombinant plasmid, sgTOMM40#6 recombinant plasmid, sgNC recombinant plasmid), 1.2 μg of pMD 2 G and 3 μg psPAX 2 The packaging plasmid was added to 200 μl 0.9% NaCl and then 24 μl of transfection reagent PEI was added. All reagents were mixed by vortexing for 10 seconds and then allowed to stand at room temperature for 10 minutes.

[0072] (4) Replace the HEK-293T cells with 3 mL of culture medium without dual antibody and serum, gently drip the liquid that has been left to stand in the previous step into the culture medium, shake it slowly, and place it in the incubator.

[0073] (5) After 6-8 hours, gently add 3 mL of complete culture medium to the HEK-293T cells and continue to culture in the incubator.

[0074] (6) After 48 h of transfection, the supernatant was collected and filtered with a 0.45 μm filter, and dispensed into sterile Eppendorf tubes. The virus solutions were used immediately or stored in a −80°C refrigerator to obtain the following: sgNC, sgTOMM40#5, sgTOMM40#6, pCDH, and TOMM40.

[0075] (V) Construction of overexpression and knockdown cells

[0076] (A) Construction of overexpression cells:

[0077] (A1) The cells to be infected (4173 and MDA-MB-231, respectively) were seeded into a 60 mm culture dish one day in advance so that the density reached about 40-60% on the next day of infection.

[0078] (A2) On the day of infection, discard the old culture medium, add 2 mL of complete culture medium, 1 mL of virus solution (pCDH, TOMM40) and 3 μL of polybrene in a ratio of 2:1, shake well and place in the incubator for further culture.

[0079] (A3) After 6-8 hours, discard the old culture medium and replace with 4 mL of fresh complete culture medium, and continue culturing for up to 48 hours.

[0080] (A4) After 48 hours of infection, the culture medium was replaced with ampicillin and positive cells were selected for one week to obtain TOMM40 overexpressing cells (4173-TOMM40, MDA-MB-231-TOMM40) and control cells (4173-pCDH, MDA-MB-231-pCDH).

[0081] (B) Construction of knockdown cells:

[0082] (B1) The cells to be infected (MDA-MB-231HM, Hs-578T, MDA-MB-231) were seeded into a 60 mm culture dish one day in advance so that the density reached about 40-60% on the next day of infection.

[0083] (B2) On the day of infection, discard the old culture medium, add 2 mL of complete culture medium and 1 mL of virus solution (sgNC, sgTOMM40#5, sgTOMM40#6 or pCDH, TOMM40) and 3 μL of polybrene in a ratio of 2:1, shake well and place in the incubator for further culture.

[0084] (B3) After 6-8 hours, discard the old medium and replace with 4 mL of fresh complete medium, and continue culturing for up to 48 hours.

[0085] (B4) After 48 hours of infection, the culture medium was replaced with blastcidin and screened for one week to obtain positive cells, and knockdown group cells (MDA-MB-231HM-sgTOMM40#5, MDA-MB-231HM-sgTOMM40#6, Hs-578T-sgTOMM40#5, Hs-578T-sgTOMM40#6, MDA-MB-231-sgTOMM40#5, MDA-MB-231-sgTOMM40#6) and control group cells (MDA-MB-231HM-sgNC, Hs-578T-sgNC, MDA-MB-231-sgNC) were obtained.

[0086] MDA-MB-231HM-sgNC, MDA-MB-231HM-sgTOMM40#5, MDA-MB-231HM-sgTOMM40#6, Hs-578T-sgNC, Hs-578T-sgTOMM40#5, Hs-578T-sgTOMM40#6 , MDA-MB-231-sgNC, MDA-MB-231-sgTOMM40#5, MDA-MB-231-sgTOMM40#6, 4173-pCDH, 4173-TOMM40, MDA-MB-231-pCDH, MDA-MB-231-TOMM40.

[0087] In summary, in this example, the CRISPR / Cas9 system was used to construct a cell line with stable knockdown of TOMM40 gene expression in cells with high TOMM40 expression levels, such as MDA-MB-231-HM and Hs-578T; at the same time, a cell line with overexpression of TOMM40 was constructed in cell lines with low TOMM40 expression, such as 4173; the expression level of TOMM40 in MDA-MB-231 was intermediate, and TOMM40 gene knockdown and overexpression cell lines were constructed at the same time. Western Blotting and Real-time PCR were used to verify the efficiency of cell TOMM40 overexpression and knockdown (such as Figure 1 ). Figure 1 It can be found that compared with the control group, sgRNA fragments 5 and 6 can effectively knock down the expression of endogenous TOMM40 mRNA and protein. The exogenously introduced TOMM40 gene in the overexpression cell line is also stably expressed at the gene transcription and translation levels ( Figure 1 A, B and C).

[0088] Example 2

[0089] This example provides the effect of TOMM40 on the migration and invasion ability of breast cancer cells in vitro.

[0090] (1) Cells (MDA-MB-231HM-sgNC, MDA-MB-231HM-sgTOMM40#5, MDA-MB-231HM-sgTOMM40#6, Hs-578T-sgNC, Hs-578T-sgTOMM40#5, Hs-578T-sgTOMM40#6, 4173-pCDH, 4173-TOMM40, MDA-MB-231-pCDH, MDA-MB-231-TOMM40 prepared in Example 1, respectively) were seeded at 2000 cells / well in a 96-well plate, and three or more replicate wells were set for each cell type. The cells were cultured in an incubator overnight. On the next day, the culture plate was placed in an IncuCyte live cell detection workstation, and the culture medium was replaced every 3 days.

[0091] (2) In vitro cell migration assay:

[0092] (201) The logarithmically growing cells in step (1) were digested with trypsin and centrifuged at 1000 rpm for 3 minutes. The cell pellet was resuspended in a basal medium without serum and double antibody, and the cell suspension density was adjusted to 2.5×10 after counting using a cell counter. 5 Pieces / mL.

[0093] (202) Add 0.6 mL of culture medium (containing 20% ​​serum) to each well of a 24-well culture plate. Use tweezers to place a Transwell chamber (pore size 0.8 μm) into the 24-well plate containing the culture medium, and try to avoid the generation of bubbles. After blowing the cell suspension with the adjusted density evenly, add 200 μL (5 × 10 4 / well), gently placed in the incubator, and cultured for 7-24h according to the cell migration ability.

[0094] (203) After a specific incubation time, the chamber was removed and placed in crystal violet (containing methanol) for fixation and staining for 30 min. The cells on the inner layer of the chamber were carefully wiped off with a cotton swab in clean water, and the chamber was inverted and allowed to dry naturally.

[0095] (204) Using an inverted microscope, 3–4 fields of view in the chamber were randomly photographed and subsequently counted and statistically analyzed.

[0096] The results are as follows Figure 2 As shown in the figure, compared with the control cells, the number of migrating cells in cells with TOMM40 knockdown was significantly reduced within the same period of time, while the number of migrating cells in cells overexpressing TOMM40 was significantly increased, and the difference was statistically significant ( Figure 2 A and B, p < 0.05)

[0097] (3) In vitro cell invasion assay

[0098] The basic steps and methods of the in vitro cell invasion assay are the same as those of the in vitro migration assay. The difference is that the invasion assay uses a Transwell chamber pre-coated with Matrigel matrix gel, and the density of the cell suspension is 5×10 5 Add 200 μL of cell suspension to each chamber, i.e. 1×10 5 cells per well.

[0099] The results are as follows Figure 2 As shown in Figure 2, the number of breast cancer cells passing through Matrigel was significantly reduced after knocking down TOMM40, while the number of breast cancer cells overexpressing TOMM40 passing through Matrigel was significantly increased, and the difference was statistically significant ( Figure 2 C and D, p < 0.05).

[0100] The above results indicate that TOMM40 can significantly enhance the migration and invasion ability of breast cancer cells in vitro.

[0101] Example 3

[0102] This example provides a cell clone formation experiment and flow cytometry cell cycle exploration.

[0103] (1) Cell clone formation experiment

[0104] (101) The cell suspensions (MDA-MB-231HM-sgNC, MDA-MB-231HM-sgTOMM40#5, MDA-MB-231HM-sgTOMM40#6, Hs-578T-sgNC, Hs-578T-sgTOMM40#5, Hs-578T-sgTOMM40#6, MDA-MB-231-pCDH, MDA-MB-231-TOMM40) were counted and adjusted to a density of 2.5 × 10 3 cells / mL.

[0105] (102) 200 μL of the cell suspension with adjusted density was inoculated into the wells of a 6-well plate, and each well was supplemented with 2 mL of complete culture medium. The plate was placed in an incubator and cultured for about 2 weeks. Three replicates were set up for each sample.

[0106] (103) The complete culture medium was replaced every 3-4 days, and the cell status was observed under an inverted microscope. The culture was terminated when obvious cell colonies were observed under the microscope.

[0107] (104) Discard the culture medium and carefully rinse the cells twice with PBS. Add approximately 1.5 mL of crystal violet staining solution (containing methanol fixative) to each well for fixation and staining for 30 min. Gently rinse with clean water until the background of the culture well is clean, and invert the 6-well plate to air dry naturally.

[0108] (105) The 6-well plate was placed on a film reader to take pictures, followed by counting and statistical analysis.

[0109] The results are shown in 3. Compared with the control group, overexpression of TOMM40 promoted the in vitro proliferation ability of cells, while knockdown of TOMM40 significantly inhibited the in vitro proliferation ability of cells ( Figure 3 A, B and C). The results of the plate cloning experiment showed that compared with the control group, the breast cancer cells with TOMM40 knockdown had significantly reduced cell colony formation ( Figure 3 D and E), while the number of colony formation of breast cancer cells overexpressing TOMM40 was significantly increased ( Figure 3 F and G), and the differences were statistically significant (p<0.05).

[0110] (2) Flow cytometry for cell cycle detection

[0111] (201) were inoculated with 4.5×10 5 Cells (MDA-MB-231-sgNC, MDA-MB-231-sgTOMM40#6) were cultured in multiple 60 mm culture dishes overnight until the cells adhered to the wall.

[0112] (202) Discard the supernatant, add complete medium containing 2 mM thymidine, and then culture for 18 hours before changing to complete medium without thymidine. Depending on the growth rate of the cells, the medium is again changed to 2 mM thymidine after 7-10 hours, and then changed to complete medium after 16 hours. At this point, the cells are theoretically synchronized at the G0 / G1 phase, and the cells collected at this time are the 0h benchmark cells after synchronization. Continue to culture the cells, and collect cells at different release points at 3, 6, 9, 12, and 15 hours.

[0113] (203) After cell digestion, the cells were centrifuged at 300 g for 5 min. The cells were washed once with PBS and centrifuged to discard the supernatant. The cells were resuspended in 100 μL PBS and slowly added dropwise to 900 μL pre-cooled 75% ethanol and placed in a −20 °C refrigerator for fixation overnight.

[0114] (204) The fixed cells were centrifuged at 1000 rpm for 5 min, the ethanol solution was discarded, and the cells were washed twice with PBS. Then, 0.4 mL of the prepared PI staining solution was added to each sample and incubated in the dark for 30 min.

[0115] (205) Flow cytometry was used to detect the cell cycle distribution of each cell.

[0116] The results showed that at the same release time point, the proportion of G1 cells in the cell line with TOMM40 knockdown was higher than that in the control group, and the cell cycle progressed more slowly ( Figure 3 H).

[0117] Example 4

[0118] This example provides an experiment on lung metastasis and transplanted tumor formation in nude mice.

[0119] Among them, the in vivo tumor formation and tail vein metastasis experiments were performed using SPF-grade 6-8 week-old BALB / c (nu / nu) female nude mice, and the cells used were treated with Plasmocin2 for more than one week to eliminate potential mycoplasma infection.

[0120] (1) In vivo lung metastasis:

[0121] The MDA-MB-231-pCDH and MDA-MB-231-TOMM40 cells were infected with lentivirus containing the PWPXL-GFP-Luciferase plasmid (HTR1A Inhibits the Progression of Triple-Negative Breast Cancer via TGF-βCanonical and Noncanonical Pathways. Adv. Sci. 2022, 9, 2105672), and the GFP-positive cells were sorted by flow cytometry. After two stable passages, the centrifuged cells were digested and resuspended in serum-free DMEM medium. The concentration was adjusted to 2×10 6 cells / mL.

[0122] The two groups of cells with adjusted concentrations were injected into each mouse through the tail vein at a rate of 100 μL (2×10 5 Each group of mice was treated with 8 cells, and the weight of mice was measured weekly. After about 8 weeks, when there was no significant change in the weight of mice, the mice were anesthetized with 10% chloral hydrate, and each mouse was injected with 200 μL mouse live imaging substrate (D-luciferin potassium salt) through the tail vein, and the lung metastasis was evaluated by fluorescence intensity using a small animal live instrument.

[0123] The fluorescence imaging results of mice and ex vivo lung tissues showed that the fluorescence intensity in the lung metastases of the TOMM40 overexpression group was stronger than that of the control group, and the number of lung metastases also increased significantly, but the difference did not reach statistical significance ( Figure 4 A, B, C), which is consistent with the results of in vitro experiments, suggesting that TOMM40 can promote the metastasis ability of breast cancer in vivo and in vitro.

[0124] (2) In vivo transplanted tumor formation:

[0125] The cells of MDA-MB-231-pCDH and MDA-MB-231-TOMM40 were digested and resuspended in DMEM medium (without antibiotics and serum). The concentration of the suspension was adjusted to 2×107 cells / mL; inoculation of 100 μL means 2×10 6 Each group had 9 mice and the tumor diameter was measured every week. When the tumor grew to a suitable size, the mice were euthanized (by carbon dioxide inhalation method) and the tumor was taken out for weighing and photographing.

[0126] The results showed that the TOMM40 overexpression group significantly promoted tumor formation. In the TOMM40 overexpression group, the tumor formation rate was as high as 88% (8 / 9), while in the control group it was only 44% (4 / 9) (p = 0.06, Fisher's exact test, Figure 4 D, E, F). The in vivo proliferation results of mice, in vitro proliferation and plate clone formation results together suggest that TOMM40 can enhance the proliferation and tumorigenicity of breast cancer cells.

[0127] Example 5

[0128] This example provides an investigation into the effect of Fluorizoline on cell proliferation activity.

[0129] After counting the cells of MDA-MB-231-sgNC and MDA-MB-231-sgTOMM40, 8,000 cells were seeded into 96-well plates. The next day, different concentrations of Fluorizoline were added to treat the cells. After 48 hours, CCK8 was added and incubated in the incubator for 2 hours. The OD was detected using an enzyme reader. 450 The results showed that after treating breast cancer cells (MDA-MB-231-HM and MDA-MB-231) with different concentrations of Fluorizoline, it was found that cells with knockdown of TOMM40 were more sensitive to Fluorizoline, and the corresponding IC 50 Smaller value ( Figure 5 A, B, C, D).

[0130] The results of testing the killing ability of DDR1 inhibitor DDR1-IN-1 on breast cancer cells showed that cells with high TOMM40 expression were insensitive to DDR1-IN-1, and its IC50 was higher than that of the low expression group ( Figure 5 FK). In order to clarify whether Fluorizoline and DDR1-IN-1 have a combined effect, the effect of low concentrations of Fluorizoline on the proliferation activity of breast cancer cells was first detected. It was found that Fluorizoline concentrations of 4 μM and below had no significant killing effect on breast cancer cells ( Figure 5E), however, it is known from previous results that 4μM Fluorizoline can block the binding of TOMM40 and PHB2. Fluorizoline (4μM) was selected to treat cells in combination with different concentrations of DDR1-IN-1. The results showed that Fluorizoline can significantly increase the sensitivity of breast cancer cells to DDR1-IN-1 ( Figure 5 FK).

[0131] The above description of the embodiments is to facilitate the understanding and use of the invention by those skilled in the art. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative work. Therefore, the present invention is not limited to the above embodiments, and improvements and modifications made by those skilled in the art based on the explanation of the present invention without departing from the scope of the present invention should be within the scope of protection of the present invention.

Claims

1. Use of a TOMM40 inhibitor in the preparation of a drug for treating breast cancer, characterized in that: The nucleotide sequence of the TOMM40 gene is shown in SEQ ID NO.

1.

2. The use according to claim 1, characterized in that: The drug is a drug that inhibits the binding between TOMM40 and PHB2.

3. The use according to claim 2, characterized in that: The drug is a drug that inhibits DDR1 phosphorylation.

4. The use according to claim 3, characterized in that: The drug is a drug that inhibits phosphorylation of SRC and AKT.

5. The use according to claim 4, characterized in that: The drug is a drug that inhibits AKT / mTOR and MAPK signaling pathways.

6. The use according to claim 1, characterized in that: The medicaments also include PHB2 binders.

7. The use according to claim 6, characterized in that: The drugs also include DDR1 inhibitors.

8. The use according to claim 7, characterized in that: The PHB2 binder is Fluorizoline and the DDR1 inhibitor is DDR1-IN-1.

9. Use of TOMM40 in preparing a breast cancer prevention kit and / or screening a drug for treating breast cancer, characterized in that: The nucleotide sequence of the TOMM40 gene is shown in SEQ ID NO.

1.

10. The use of TOMM40 in the preparation of a breast cancer prognosis detection kit, characterized in that: The nucleotide sequence of TOMM40 is shown in SEQ ID NO.1.