New applications of the IGF2BP1 gene

By overexpressing or interfering with the genes IGF2BP1, circMYO9B, METTL3, and FTO in goat skeletal muscle satellite cells, the m6A methylation modification of circMYO9B was regulated, thus resolving the unclear molecular mechanism of IGF2BP1 protein regulating myocyte development and promoting goat muscle development.

CN120093952BActive Publication Date: 2025-11-14SICHUAN AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510258144.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-06
Publication Date
2025-11-14
Estimated Expiration
2045-03-06

AI Technical Summary

Technical Problem

Current research has not clarified the molecular mechanism by which IGF2BP1 protein regulates circRNA through the m6A pathway to affect myocyte development, and the molecular mechanism by which it affects economic traits in livestock and poultry is unclear.

Method used

By enhancing or promoting the expression of IGF2BP1, circMYO9B, and METTL3 genes, and reducing the expression of FTO gene, the expression of related genes was overexpressed or interfered with in cells using homologous primers and vector ligation technology. The m6A methylation modification level of circMYO9B was regulated, and its expression was stabilized to promote the proliferation and differentiation of goat skeletal muscle satellite cells.

Benefits of technology

The study clarified the promoting effect of IGF2BP1 on the proliferation and differentiation of goat MuSCs, improved the molecular regulatory network of goat muscle development, and enhanced the molecular regulatory efficiency of muscle development.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120093952B_ABST
    Figure CN120093952B_ABST
Patent Text Reader

Abstract

This invention provides novel applications for the IGF2BP1 gene, including the use of the IGF2BP1 gene and related reagents to prepare products that promote the proliferation and differentiation of goat skeletal muscle satellite cells (MuSCs) or promote goat muscle development. This invention demonstrated the promoting effect of IGF2BP1 on the proliferation and differentiation of goat MuSCs by overexpressing and interfering with IGF2BP1 in goat MuSCs. This invention also found a significant positive correlation between the expression level of IGF2BP1 and circMYO9B, and that circMYO9B is a circRNA with m6A modification, regulated by the level of m6A modification. IGF2BP1 recognizes circMYO9B via the m6A pathway, stabilizes its expression, and thus regulates the proliferation of goat MuSCs. The technical research of this invention provides epigenetic insights into goat muscle development and further refines the molecular regulatory network of goat muscle development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of poultry breeding technology, specifically to a new application of the IGF2BP1 gene. Background Technology

[0002] Skeletal muscle satellite cells (MuSCs) are stem cells located between the basement membrane and plasma membrane of muscle fibers. They can differentiate into myoblasts under specific conditions, providing the foundation for skeletal muscle development. Understanding the mechanisms by which key genes regulate skeletal muscle growth and development is a core aspect of molecular genetic breeding research in meat sheep. Insulin-like growth factor 2 mRNA-binding proteins (IGF2BP1) are important candidate genes affecting economic traits in livestock and poultry, but the related molecular mechanisms remain unclear. Current research on the functional level of IGF2BP1 protein mainly focuses on exploring the mechanisms of cancer-related diseases; the molecular mechanism by which it regulates circRNA through the m6A pathway and thus affects muscle cell development has not been reported. Therefore, this study aims to explore the molecular mechanism by which IGF2BP1 regulates circRNA through the m6A pathway to affect muscle cell development, starting from the function of the IGF2BP1 m6A reading protein. Summary of the Invention

[0003] The purpose of this invention is to explore in depth the molecular mechanism by which IGF2BP1 regulates circRNA through the m6A pathway to affect myocyte development, thereby providing new applications for the IGF2BP1 gene.

[0004] To achieve the above objectives, the technical solution of the present invention is as follows:

[0005] In a first aspect, the present invention provides the application of the IGF2BP1 gene in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0006] Preferably, the IGF2BP1 gene promotes the proliferation and differentiation of goat skeletal muscle satellite cells or promotes goat muscle development by recognizing circMYO9B in goat skeletal muscle satellite cells.

[0007] Secondly, the present invention provides the application of reagents that enhance or promote IGF2BP1 gene expression in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0008] Reagents that enhance or promote IGF2BP1 gene expression, such as pEGFP-IGF2BP1, are obtained by PCR amplification of the IGF2BP1 gene using homologous primers, ligating the amplification product with a linearized pEGFP-N1 vector, and transforming it into competent cells.

[0009] Thirdly, the present invention provides the application of reagents that enhance or promote the expression of the circMYO9B gene in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0010] Reagents that enhance or promote the expression of the circMYO9B gene, such as pCD5-circMYO9B, are obtained by PCR amplification of the full-length circMYO9B gene, followed by enzymatic digestion of the amplification product and pCD5-ciR vector, followed by transformation into competent cells.

[0011] Fourthly, this invention provides the application of the circMYO9B gene in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0012] Preferably, the upstream regulatory genes of the circMYO9B gene are METTL3 and FTO; the circMYO9B gene has an m6A methylation modification site, and the m6A methylation modification level of the circMYO9B gene is promoted by overexpressing the METTL3 gene and / or interfering with the FTO gene, thereby promoting the proliferation and differentiation of goat skeletal muscle satellite cells, or promoting goat muscle development; more preferably, the m6A methylation modification sites are circMYO9B-17 and circMYO9B-77.

[0013] Preferably, the method of overexpressing the METTL3 gene includes: designing primers and amplifying the target gene, then ligating it with an overexpression vector and transforming it; and / or, the interfering FTO gene includes designing interfering siRNA or using a demethylase activity inhibitor.

[0014] Fifthly, the present invention provides the application of the METTL3 gene and / or FTO gene in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0015] In a sixth aspect, the present invention provides the application of reagents that enhance or promote the expression of the METTL3 gene in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0016] Reagents that enhance or promote METTL3 gene expression, such as pEGFP-METTL3, are obtained by PCR amplification of the METTL3 gene using homologous primers, ligating the amplification product with a linearized pEGFP-N1 vector, and transforming it into competent cells.

[0017] In a seventh aspect, the present invention provides the use of reagents that reduce or inhibit FTO gene expression in the preparation of products that promote the proliferation and differentiation of goat skeletal muscle satellite cells or products that promote goat muscle development.

[0018] Agents that reduce or inhibit FTO gene expression include siFTO (sequence shown in SEQ ID NO.35) and demethylase activity inhibitors such as FB23-2.

[0019] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0020] This invention demonstrated the promoting effect of IGF2BP1 on the proliferation and differentiation of goat muscle cells (MuSCs) by overexpressing and interfering with IGF2BP1. The invention also found a significant positive correlation between the expression levels of IGF2BP1 and circMYO9B, and that circMYO9B is a circRNA with m6A modification, regulated by the level of m6A modification. IGF2BP1 recognizes circMYO9B via the m6A pathway, stabilizing its expression and thus regulating the proliferation of goat MuSCs. This research provides epigenetic insights into goat muscle development and further refines the molecular regulatory network of goat muscle development. Attached Figure Description

[0021] The accompanying drawings, which are included to provide a further understanding of the invention and form part of this invention, illustrate exemplary embodiments of the invention and are used to explain the invention, but do not constitute an undue limitation of the invention. In the drawings:

[0022] Figure 1 This invention relates to Example 1, which describes the effects of overexpression or interference with IGF2BP1 on proliferation and differentiation marker genes and cell phenotypes. The effects are as follows: A. Identification of goat MuSCs (Pax7, scale bar: 200 μm) and MYHC, respectively, using immunofluorescence assays; B. Effects of IGF2BP1 overexpression on proliferation marker genes; C. Effects of IGF2BP1 interference on proliferation marker genes; D. Effects of IGF2BP1 overexpression on differentiation marker genes; E. Effects of IGF2BP1 interference on differentiation marker genes. The bar charts represent the mean ± standard error of at least three replicates. *p<0.05, **p<0.01.

[0023] Figure 2This invention relates to Example 1, which describes the effect of circMYO9B on the proliferation of goat MuSCs. The study included: A. Screening of circMYO9B; B. Sanger sequencing detection of circMYO9B circularization sites; C. Expression of circMYO9B in different goat tissues; D. Expression of IGF2BP1 during the proliferation and differentiation of goat MuSCs; E. Expression of circMYO9B during the proliferation and differentiation of goat MuSCs; F. Effect of IGF2BP1 overexpression on circMYO9B; G. Effect of circMYO9B overexpression on proliferation marker genes; and H. Effect of circMYO9B overexpression on the number of goat MuSCs. The bar chart represents the mean ± standard error of at least three replicates. *p<0.05, **p<0.01; p < 0.05 indicates no significant difference if there is only one identical marker letter, and p < 0.05 indicates a significant difference if there are different marker letters.

[0024] Figure 3 This invention relates to the effect of m6A modification level on circMYO9B in Example 1, where: A. Prediction of circMYO9B m6A modification sites; B. Enrichment of circMYO9B fragments on m6A antibodies; C. Effect of METTL3 overexpression on circMYO9B; D. Effect of FTO interference on circMYO9B; E. Effect of METTL3 interference on circMYO9B m6A modification; F. Effect of FTO interference on circMYO9B m6A modification level; G. Effect of FTO interference on overall m6A modification level of MuSCs; H. Effect of FB23-2 on overall m6A modification level of MuSCs; I. Effect of FB23-2 on circMYO9B m6A modification level; J. Schematic diagram of dual-luciferase reporter vector; K. Effect of FTO interference on luciferase activity. The bar chart represents the mean ± standard error of at least three replicates, *p<0.05, **p<0.01; any pair with the same label letter is considered not significant, and any pair with different label letters is considered significant, with lowercase letters representing p<0.05.

[0025] Figure 4This invention relates to Example 1 of the study, which describes the effect of IGF2BP1 on the stability of circMYO9B in MuSCs, including: A. Prediction of circMYO9B binding to IGF2BP1; B. Enrichment of circMYO9B on IGF2BP1 antibody; C. Effect of IGF2BP1 overexpression on luciferase activity; D. Effect of IGF2BP1 interference on luciferase activity; E. Effect of IGF2BP1 overexpression on the stability of circMYO9B in MuSCs; F. Effect of IGF2BP1 interference on the stability of circMYO9B in MuSCs; G. Effect of FTO interference on the stability of circMYO9B in MuSCs; and H. Effect of FB23-2 on the stability of circMYO9B in MuSCs. The bar charts and scatter plots represent the mean ± standard error of at least three replicates, *p<0.05, **p<0.01.

[0026] Figure 5 In Embodiment 1 of this invention, IGF2BP1 recognizes circMYO9B via the m6A pathway and stabilizes its expression.

[0027] Figure 6 To verify the coding function of circMYO9B in Example 1 of this invention, the following steps were performed: A. circMYO9B IRES site prediction; B. circMYO9B ORF prediction; C. IRES activity verification in circMYO9B; D. Schematic diagram of the circMYO9B-FLAG tag protein vector; E. Immunofluorescence results of the FLAG protein (scale bar: 200 μm); F. Schematic diagram of the vector for studying circRNA coding function; G. The effect of fragments containing different numbers of m6A motifs on the circRNA coding signal. The bar chart represents the mean ± standard error of at least three replicates, *p<0.05, **p<0.01; a single identical marker letter indicates no significant difference, while different marker letters indicate significant differences, with lowercase letters representing p<0.05.

[0028] Figure 7 The figure shows the m6A modification level of circMYO9B in Embodiment 1 of this invention. The blue areas mark the m6A-modified sequences. Using the online website SRAMP to predict m6A modification sites in circMYO9B, six potential m6A modification sites were identified: circMYO9B-17, circMYO9B-77, circMYO9B-89, circMYO9B-202, circMYO9B-230, and circMYO9B-278. The two high-confidence m6A sequences marked in the figure are circMYO9B-17 and circMYO9B-77. Detailed Implementation

[0029] In the description of this invention, it should be noted that unless specific conditions are specified in the examples, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0030] In embodiments of the present invention, the process of obtaining several functional carriers is as follows:

[0031] 1) pEGFP-IGF2BP1 overexpression vector

[0032] Homologous primer design: Based on the mRNA CDS region sequence (excluding the stop codon) of the IGF2BP1 gene in the NCBI database, homologous primers for IGF2BP1 were designed using the Vazyme online tool. The primer sequences are shown in Table 1.

[0033] Target fragment amplification: Goat cDNA was used as a template, utilizing... Max DNA Polymerase (Takara) high-fidelity enzyme was used for PCR amplification of the IGF2BP1 gene.

[0034] Vector linearization: The pEGFP-N1 vector was linearized using Xho I and BamHI restriction endonucleases.

[0035] Purification of target fragment and vector: The IGF2BP1 amplified fragment was extracted by gel electrophoresis, and the linearized pEGFP-N1 vector was purified.

[0036] Ligation: The target fragment and the linearized vector were ligated using Vazyme's homologous recombination kit.

[0037] Transformation: The ligation product was transformed into competent E. coli cells (DH5-α), and the cells were inoculated onto LB solid medium containing antibiotic (Kana) using the dilution plate method and grown overnight at 37°C.

[0038] Picking single colonies: Pick single colonies from the plate and inoculate them into LB liquid medium containing antibiotic (Kana), and incubate at 37°C until the medium becomes turbid.

[0039] Bacterial culture PCR: The target fragment is amplified by PCR using bacterial culture as a template, and positive bacterial cultures are screened by gel electrophoresis.

[0040] Sequencing verification: Positive bacterial cultures were identified by Sanger sequencing (Sangon). If successful, the cultures were propagated and cultured.

[0041] Plasmid extraction: After propagation, the bacterial culture is used for plasmid extraction. The steps are as per the plasmid extraction instructions (Omega).

[0042] 2) pCD5-circMYO9B overexpression vector

[0043] (1) Amplification of the target fragment: Primers for amplifying the full length of circMYO9B were designed based on the RNA-seq sequencing results. The forward primer was preceded by the ECORI restriction site and the TAATACTTTCAG sequence, and the reverse primer was preceded by the BamHI restriction site and the AGTTGTTCTTAC sequence. The primer sequences are shown in Table 1.

[0044] (2) Enzyme digestion and ligation: The vector used for circMYO9B overexpression was pCD5-ciR. The target fragment and the pCD5-ciR vector were digested with BamHI and ECORI respectively at 37℃ for 2 hours. After digestion, the DNA was purified by gel recovery and then ligated overnight at 16℃ with T4 DNA ligase.

[0045] (3) Conversion: Add 5 μL of the ligation product to 50 μL of Trelief. TM 5α competent cells were incubated on ice for 5 min, then at 42°C for 45 s, and then on ice for 2 min. 500 μL of antibiotic-free liquid culture medium was added, mixed well, and 100 μL was evenly spread on a solid culture plate. The plate was then incubated upright at 37°C for 1 h and then inverted overnight.

[0046] Single clonal bacterial selection: On the second day, single clonal bacteria were selected from the plate and placed in liquid medium containing AMP resistance. After culturing at 37°C and 200 rpm for 5 hours, the culture was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. After sequence identification, the bacteria were amplified and plasmid DNA was extracted for subsequent experiments.

[0047] 3) pEGFP-METTL3 overexpression vector

[0048] Homologous primer design: Homologous primers were designed based on the sequence of the METTL3 gene, and a suitable design scheme was selected in the Vazyme online tool. The primer sequences are shown in Table 1.

[0049] Target fragment amplification: Using goat cDNA as a template, PCR amplification of the METTL3 gene was performed.

[0050] Vector linearization: The pEGFP-N1 vector was linearized using Xho I and BamHI.

[0051] Purification of target fragment and vector: The amplified METTL3 fragment and linearized vector were recovered and purified by gel electrophoresis.

[0052] Ligation: The target fragment was ligated to the linearized vector using Vazyme's homologous recombination kit.

[0053] Transformation: The ligation product was transformed into competent E. coli cells (DH5-α), and the cells were inoculated onto LB solid medium containing antibiotic (Kana) using the dilution plate method and grown overnight at 37°C.

[0054] Picking single colonies: Pick single colonies from the plate and inoculate them into LB liquid medium containing antibiotic (Kana), and incubate at 37°C until the medium becomes turbid.

[0055] Bacterial culture PCR: The target fragment is amplified by PCR using bacterial culture as a template, and positive bacterial cultures are screened by gel electrophoresis.

[0056] Sequencing verification: Positive bacterial cultures were identified by Sanger sequencing (Sangon). If successful, the cultures were propagated and cultured.

[0057] Plasmid extraction: After propagation, the bacterial culture is used for plasmid extraction. The steps are as per the plasmid extraction instructions (Omega).

[0058] 4) pEGFP-FTO overexpression vector

[0059] Homologous primer design: Homologous primers were designed based on the FTO gene sequence from NCBI. Single-fragment cloning and double-enzyme-digested linearized vectors were selected using the Vazyme online experimental tool to design homologous primers. The primer sequences are shown in Table 1.

[0060] Target fragment amplification: PCR amplification of the FTO gene was performed using MuSCs cDNA as a template. Max DNA Polymerase (Takara) is a high-fidelity enzyme used to amplify the target fragment using homologous primers. The reaction system and amplification procedure should be followed according to the instructions for the high-fidelity enzyme reagent.

[0061] Vector linearization: The pEGFP-N1 vector was linearized using two restriction endonucleases, XhoⅠ and BamHI, and the reaction was performed according to the restriction endonuclease instructions.

[0062] Purification of target fragment and vector: The reaction products from the above two steps were subjected to gel electrophoresis, and the target band was excised and recovered by gel extraction. The purification process was carried out in accordance with the instructions of the gel extraction kit (Omega).

[0063] Ligation: The FTO target fragment was ligated to the linearized vector using Vazyme's homologous recombination kit.

[0064] Transformation: The ligation product was transformed into competent E. coli cells (DH5-α), and the cells were inoculated onto LB solid medium containing antibiotic (Kana) using the dilution plate method and grown overnight at 37°C.

[0065] Picking single colonies: Pick single colonies from the plate and inoculate them into LB liquid medium containing antibiotic (Kana), and incubate at 37°C until the medium becomes turbid.

[0066] Bacterial culture PCR: The target fragment is amplified by PCR using bacterial culture as a template, and positive bacterial cultures are screened by gel electrophoresis.

[0067] Sequencing verification: Positive bacterial cultures were identified by Sanger sequencing (Sangon). If successful, the cultures were propagated and cultured.

[0068] Plasmid extraction: After propagation, the bacterial culture is used for plasmid extraction. The steps are as per the plasmid extraction instructions (Omega).

[0069] Table 1. Vector primer sequences

[0070]

[0071]

[0072] 5) Dual-fluorescent vectors: The dual-luciferase vectors used for promoter and enhancer activity verification were also constructed using homologous recombination. The Basic vector was used for promoter activity verification, and the Promoter vector was used for enhancer activity verification. During vector construction, the target fragment contained different SNP sites, and the template was DNA from different genotypes of Nanjiang Yellow Sheep. The linearization restriction sites for both vectors were Kpn I and Xho I, and the antibiotic resistance in LB medium was Amp. The dual-fluorescent vector used for m6A modification site verification was psiCHECK2, synthesized by Qingke Biotechnology. The dual-fluorescent vector used for IRES activity verification was Luc2-IRES-Reporter (Gise Biotechnology).

[0073] 6) Translation function verification carrier (circMYO9B-FLAG)

[0074] circMYO9B-FLAG is a sequence in which GATTACAAGGACGACGATGACAAG (SEQ ID NO. 9) is inserted before the stop codon of the predicted open reading frame sequence. This sequence encodes the amino acid sequence DYKDDDDK (SEQ ID NO. 10). The vector for the effect of m6A modification on translation was purchased from Guangzhou Gisei Biotechnology.

[0075] In embodiments of the present invention, the cell transfection reagent is used. For the transfection assay, strictly follow the instructions. Dilute the plasmid with P3000 and Lip3000 separately and incubate for 5 min. Then, mix the two dilutions and incubate for 15 min before adding to the cell culture medium for transfection. Adjust the post-transfection treatment time according to experimental requirements. RNA extraction is performed 48 h post-transfection using the Trizol assay, and the dual-luciferase reporter assay is performed 36-72 h post-transfection.

[0076] In an embodiment of the present invention, the cell proliferation capacity was detected using the CCK-8 cell proliferation kit. The experiment was conducted according to the instructions. Cells were seeded in 96-well cell culture plates. After processing the cells according to the experimental requirements, 10 μL of CCK-8 reagent was added to each well. The cells were incubated at 37°C in the dark for 1-4 hours, and the absorbance was measured at 450 nm using a microplate reader. The results were plotted as a cell growth curve with culture time on the ordinate and OD value on the ordinate.

[0077] In the embodiments of the present invention, the primer information for RT-qPCR is shown in Table 1:

[0078] Table 2 Quantitative Primer Information

[0079]

[0080] Note: GAPDH is an internal reference gene.

[0081] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0082] Furthermore, the present invention divides the research content corresponding to the above experimental process into the following 5 embodiments, and conducts a detailed result analysis in conjunction with the above experimental process.

[0083] Example 1

[0084] This example investigates the effect of the goat IGF2BP1 gene on the proliferation and differentiation of MuSCs, as detailed below:

[0085] The goat tissues used in the experiment were collected from Chengdu Ma sheep, including the heart, liver, spleen, lungs, kidneys, and longissimus dorsi muscle from 1 day after birth, and the longissimus dorsi muscle from 45 days of embryonic development. All samples were stored at -80℃ after collection, and all operations were strictly carried out in accordance with the Experimental Animal Operation Specifications of Sichuan Agricultural University (Sichuan Agricultural University

[2014] No. 18). The method for isolating goat skeletal muscle satellite cells (MuSCs) used in the experiment was as follows: the collected longissimus dorsi muscle tissue blocks from newborn lambs were minced, and then digested for the first time with 0.1% type I collagenase and 0.1% type Ⅱ collagenase, followed by a second digestion with 0.25% trypsin. Finally, the MuSCs were isolated and purified by centrifugation and differential adhesion. The isolated goat skeletal muscle satellite (MuSCs) cells were identified. The immunofluorescence results of Pax7 and MYHC proteins showed that the isolated cells had a high Pax7 positivity rate, and the cells could produce myotubes after induction of differentiation. Figure 1 The result (A) indicates that it conforms to the characteristics of MuSCs and can be used for subsequent experiments. Successfully identified MuSCs cells were stored in liquid nitrogen for later use.

[0086] To confirm the role of IGF2BP1 in goat muscle development, IGF2BP1 was overexpressed and interfered with in MuSCs at different stages (proliferation and differentiation). Overexpression was performed using RT-qPCR, with primers shown in Table 1. The RT-qPCR experiment was conducted using ChamQ SYBR qPCR Master Mix (Vazyme). The reaction mixture consisted of 10 μL of ChamQ SYBR qPCR Master Mix (5 μL), upstream primer (0.4 μL), downstream primer (0.4 μL), cDNA (0.8 μL), and ddH2O (3.4 μL). The amplification program was: 95℃ for 2 min; 95℃ for 5 s, Tm 10 s, 39 cycles, 65℃~95℃, 0.5℃ / 30 s. Results were obtained according to 2... -ΔΔCt The relative expression levels of genes were calculated. RT-qPCR results showed that overexpression of IGF2BP1 (pEGFP-IGF2BP1) during the proliferation phase significantly increased the expression of the MuSCs marker gene Pax7 and the proliferation marker genes PCNA and mki67 (p<0.01). Figure 1 (B)

[0087] The interfering siRNA was designed and synthesized by Ribobio, with the following sequence: siIGF2BP1: CTTTATGCAGGCTCCAGAG (SEQ ID NO. 34). RNA was extracted using the standard Trizol method, and reverse transcription was performed using RNAiso Plus (Takara) lysis buffer and an RNA reverse transcription kit (Vazyme). The results showed that interfering with IGF2BP1 (siIGF2BP1) reduced the expression of PCAN and mki67 (p<0.01). Figure 1 (C) During the differentiation phase, overexpression of IGF2BP1 showed a trend of increasing the expression of MYOD and MYHC, but the difference was not significant (p>0.05). Figure 1 Interference with IGF2BP1 (siIGF2BP1) led to a significant decrease in the muscle differentiation marker genes MYOD and MYOG (p<0.05 or p<0.01). Figure 1 (E). In summary, IGF2BP1 can promote the proliferation and differentiation of goat MuSCs.

[0088] Example 2

[0089] This embodiment examines how IGF2BP1 recognizes m6A-circMYO9B to promote MuSC proliferation.

[0090] IGF2BP1 was overexpressed in goat MuSCs. RNA-seq data analysis revealed differential expression in 49 circRNAs. By predicting their m6A modification, coding potential, and IGF2BP1 binding, one novel circRNA—circMYO9B—possessed all three characteristics. Figure 2 The presence of m6A in the DNA suggests that it is an m6A-circRNA that can bind to IGF2BP1. Therefore, further analysis of its related functions was conducted in goat muscle cells.

[0091] (1) Effect of circMYO9B on the proliferation of goat MuSCs

[0092] RT-qPCR was used to detect the expression patterns of IGF2BP1 and circMYO9B during the proliferation and differentiation of MuSCs. The results showed that the expression patterns of IGF2BP1 and circMYO9B were consistent, with both gradually decreasing expression levels during the proliferation phase and higher levels at early differentiation (DM-1) and late differentiation (DM-7). Figure 2 (D and E in the middle). Spearman correlation coefficient analysis showed ρ = 0.6161 and p = 0.0065, indicating a positive correlation between IGF2BP1 and circMYO9B. Sanger sequencing results showed that circMYO9B originates from exons 6, 7, and 8 of the MYO9B gene, with a full length of 342 bp ( Figure 2(B). RT-qPCR was performed on heart, liver, spleen, lung, kidney, and longissimus dorsi muscle tissues from Chengdu Ma sheep 1 day after birth. The results showed that circMYO9B was expressed at high levels in the spleen and lungs, at moderate levels in the liver and kidneys, and at low levels in the heart and longissimus dorsi muscle. Figure 2 (C)

[0093] Overexpression of circMYO9B during the proliferation stage of goat muSCs was investigated to explore its effect. RT-qPCR results showed that overexpression of circMYO9B (pCD5-circMYO9B) significantly enhanced the expression of circMYO9B. Figure 2 (F). Overexpression of circMYO9B (pCD5-circMYO9B) significantly enhanced the expression of the MuSCs marker gene Pax7 (p<0.05) and the proliferation marker gene PCNA (p<0.01). Figure 2 (G). CCK-8 assay results showed that, compared with the NC group (pCD5-ciR), overexpression of circMYO9B (pCD5-circMYO9B) significantly increased the number of MuSCs at 48H and 72H of proliferation (p<0.05). Figure 2 (H). These results indicate that circMYO9B can promote the proliferation of goat MuSCs.

[0094] (2) circMYO9B m6A modification level

[0095] Predicting m6A modification sites of circMYO9B using the online website SRAMP revealed six potential m6A modification sites: circMYO9B-17, circMYO9B-77, circMYO9B-89, circMYO9B-202, circMYO9B-230, and circMYO9B-278. Two of these sites, circMYO9B-17 and circMYO9B-77, had high confidence levels. Figure 3 (A). Subsequently, using the longissimus dorsi muscle of Chengdu Ma sheep embryos at 45D embryonic stage as material, RNA fragments containing m6A modification were enriched by MeRIP-PCR. The results showed that, compared with the control group (IgG), the circMYO9B fragment was significantly enriched on the m6A antibody (p<0.05), indicating that circMYO9B underwent m6A methylation modification. Figure 3 (B)

[0096] MeRIP-PCR was performed according to the manufacturer's instructions using Magna MeRIP. TMm6A RNA was enriched using the m6A Kit (Sigma-Aldrich). The enriched RNA was purified using the RNeasy mini kit (Qiagen, Hilden, Germany), and the circMYO9B m6A level was quantified by RT-qPCR. The quantification of m6A modification levels was performed using the EpiQuik m6A RNA methylation quantitative kit (Epigentek, NY, USA) to detect the overall m6A level of total RNA. The experimental procedure was followed according to the manufacturer's instructions. After terminating the reaction, the OD value at 450 nm was read using a VARIOSKAN LUX (Thermo-Fisher Scientific), and the m6A modification level in the wells was calculated using a standard curve based on the OD value.

[0097] The effects of m6A modification on circMYO9B were investigated by overexpressing or interfering with the methyltransferase METTL3 and demethylase FTO in MuSCs. Overexpression was performed using RT-qPCR, with primers shown in Table 1, following the same procedure as in Example 1. The interfering siRNA was designed and synthesized by Ribobio, and its sequence is shown in Table 3. Results showed that overexpression of METTL3 (pEGFP-METTL3) significantly increased the expression level of circMYO9B (p<0.01). Figure 3 In the study of MTEEL3 (siMETTL3), interference with MTEEL3 showed a decreasing trend in the enrichment of circMYO9B on m6A antibody, but the difference was not significant (p>0.05). Figure 3 Interfering with FTO (siFTO) significantly increased the expression level of circMYO9B (p<0.05). Figure 3 (D), and MeRIP-PCR detection showed that circMYO9B enrichment on m6A antibody was significantly increased (p<0.05). Figure 3 The presence of FTO (in the middle F) indicates that interfering with FTO can increase the methylation level of circMYO9B.

[0098] Table 3. siMETTL3, siFTO, and siCtrl sequences

[0099]

[0100] Note: SiCtrl is a negative control, a control group that does not contain the target interfering substance, used to exclude non-specific effects.

[0101] In addition, MuSCs cells were cultured and maintained at 60%-80% confluence in appropriate culture medium. Then, FB23-2 was dissolved in DMSO, diluted to the desired working concentration (e.g., 5 μM), and added to the cell culture for 24 to 48 hours. After treatment, total RNA was extracted using TRIzol reagent, and the m6A modification level was detected using MeRIP-qPCR. m6A-modified circMYO9B was enriched using a specific antibody, followed by qPCR quantification. Furthermore, the expression of FTO and related proteins (such as IGF2BP1) was analyzed by Western blot to verify the inhibitory effect of FB23-2 on FTO. All experiments included a solvent control group (DMSO only) and were performed at least three biological replicates to ensure data reliability. Finally, statistical analysis was used to compare the differences in circMYO9B m6A modification levels between the FB23-2 treated group and the control group. The results showed that, using the FTO demethylase activity inhibitor (FB23-2) to detect the m6A modification level of circMYO9B, the addition of FB23-2 to MuSCs, consistent with the FTO interference group (siFTO), significantly increased the overall m6A modification level (p<0.01). Figure 3 The enrichment of the circMYO9B fragment on the m6A antibody was significantly increased (p<0.05) (G and H). Figure 3 The results showed that FTO's regulation of circMYO9B depends on its demethylase activity. Subsequently, wild-type (WT) and mutant (MUT) fragments containing the m6A modification site (Table 4) were inserted into the dual-luciferase reporter vector (psiCHECK-2). Figure 3 (J). After FTO interference and transfection with a dual-luciferase reporter vector into MuSCs, the results showed that FTO interference (siFTO) significantly enhanced the luciferase activity of the wild-type vector (WT) (p<0.05), but had no significant effect on the fluorescence activity of the mutant vector (MUT) (p>0.05). Figure 3 The presence of K indicates that the regulatory effect of FTO on the circMYO9B fragment disappears after the m6A modification is lost.

[0102] In summary, the expression level of circMYO9B is related to its m6A modification, and FTO regulates the expression of circMYO9B through the m6A pathway.

[0103] Table 4 Wild-type (WT) and mutant (MUT) fragments

[0104]

[0105] (3) IGF2BP1 maintains its stability by recognizing circMYO9B through m6A.

[0106] To predict the interaction between circMYO9B and IGF2BP1, we used the RBPsuite online tool and selected a specific model for analysis. The results showed that when the predicted binding fraction of the RNA sequence was greater than 0.5, it indicated that the sequence might have a strong binding potential with the target RBP. Figure 4 (A). MeRIP-qPCR assays showed that the circMYO9B fragment was significantly enriched on the IGF2BP1 antibody (p<0.01). Figure 4 The results showed that IGF2BP1 could bind to circMYO9B. Subsequently, IGF2BP1 in MuSCs was overexpressed and interfered with, respectively, using the same methods as in Example 1, and transfected with a dual-luciferase reporter vector (psiCHECK2) containing an m6A modification site. The results showed that overexpression of IGF2BP1 (pEGFP-IGF2BP1) significantly enhanced the fluorescence activity of wild-type (WT) (p<0.05), but did not affect the fluorescence activity of mutant (MUT) (p<0.05). Figure 4 Correspondingly, interfering with IGF2BP1 (siIGF2BP1) significantly reduced the fluorescence activity of the wild-type (WT) (p<0.01), while having no effect on the fluorescence activity of the mutant (MUT). Figure 4 (D). In summary, IGF2BP1 is a methyl readout protein that recognizes circMYO9B and regulates circMYO9B expression through the m6A pathway.

[0107] In response, IGF2BP1 was overexpressed and interfered with in MuSCs, using the same methods as in Example 1, and cells were treated with actinomycin D (ACTD) at 0H, 1H, 2H, and 4H, respectively. The results showed that the expression level of circMYO9B in the IGF2BP1 overexpression group (pEGFP-IGF2BP1) was higher than that in the control group (pEGFP-N1). Figure 4 The levels of circMYO9B in the interfering IGF2BP1 group (siIGF2BP1) were significantly lower than those in the control group (siCrtl) at 3H, 4H, and 6H (p<0.01). Figure 4 The result (F) indicates that interfering with IGF2BP1 significantly reduces the stability of circMYO9B.

[0108] IGF2BP1 recognizes circMYO9B via the m6A pathway, therefore, the m6A modification level of circMYO9B should affect its stability. This study aimed to increase the m6A modification level of circMYO9B in muscocytes (MuSCs) by interfering with FTO and adding the FTO inhibitor FB23-2, and to investigate changes in circMYO9B mRNA levels at different time points using actinomycin D (ACTD). The experimental design included multiple treatment groups: an FTO interference group, an FB23-2 treatment group, and a control group. First, FTO demethylation activity was increased by siRNA interference and the addition of the FB23-2 inhibitor, thereby increasing the m6A modification level of circMYO9B. Then, MuSCs were treated with ACTD, and cell samples were collected at different time points (0 h, 1 h, 2 h, and 4 h). ACTD promotes the degradation of circMYO9B by inhibiting transcription, helping to observe the stability of circMYO9B.

[0109] Subsequently, the expression level of circMYO9B at each time point was quantitatively determined using qRT-PCR, and the degradation rate of circMYO9B among different experimental groups was analyzed. By comparing the differences among the FTO interference group, the FB23-2 treatment group, and the control group, we can further reveal how the m6A modification level of circMYO9B affects its stability. The results showed that the expression level of circMYO9B in the FTO interference group (siFTO) was higher than that in the control group (siCtrl). Figure 4 The expression levels of circMYO9B in the FTO demethylase activity inhibitor group (FB23-2) were significantly lower than those in the control group (siCrtl) at 1H (p<0.05). Figure 4 (H).

[0110] IGF2BP1 may influence myocyte development by recognizing and stabilizing the expression of m6A-modified circMYO9B. Meanwhile, FTO, as an m6A demethylase, can regulate this process by removing m6A modification. Figure 5 In summary, increased m6A modification levels enhance the stability of circMYO9B. Mechanistically, IGF2BP1 maintains its stability by recognizing m6A modifications of circMYO9B.

[0111] (4) circMYO9B functions by encoding a protein.

[0112] circMYO9B possesses coding potential, potentially promoting goat muscle cell proliferation by encoding a protein. To verify this coding potential, its open reading frame (ORF) was predicted using the NCBI online ORF Finder website. The results showed that circMYO9B contains one ORF. Figure 6 (B). This open reading frame (ORF) begins translation at the 19th base (ATG) of the full-length circMYO9B and terminates at the end, containing 107 amino acids. To demonstrate that circMYO9B contains an IRES site required for independent RNA translation initiation, IRESfinder prediction revealed that there may be three segments in circMYO9B with IRES activity. Figure 6 (See A in the middle, and Table 5).

[0113] Table 5. Three active IRES fragments

[0114]

[0115]

[0116] These three fragments and the full-length circMYO9B sequence were respectively inserted into the Luc2-IRES-Reporter vector to construct a dual-luciferase reporter vector. Figure 6 The luciferase activity of dual fluorescent vectors (Luc2-IRES-0) containing the full-length circMYO9B sequence and stained with MuScs was significantly increased (p<0.05 or p<0.01) compared to the control group (Luc2-IRES-Reporter). The results showed that the luciferase activity of dual fluorescent vectors (Luc2-IRES-2 and Luc2-IRES-3) containing the first fragment was significantly increased (p<0.05 or p<0.01). However, the luciferase activity of dual fluorescent vectors containing the other two fragments (Luc2-IRES-2 and Luc2-IRES-3) was not different from that of the control group (Luc2-IRES-Reporter). These results indicate that circMYO9B contains a sequence with IRES activity located in Fragement 1.

[0117] To identify potential circMYO9B proteins, we inserted a FLAG sequence before the stop codon of the predicted open reading frame of circMYO9B and constructed an overexpression vector (circMYO9B-FLAG) using this sequence. Figure 6 (D). After transfecting goat MuSCs with circMYO9B-FLAG, an immunofluorescence assay was performed on FLAG cells, and red fluorescence was observed in the FLAG group. Figure 6 The presence of the FLAG-tagged protein (e.g., circMYO9B) in the cell indicates the presence of this protein.

[0118] To investigate the effect of circMYO9B m6A modification on its translation, a circRNA translation-specific vector containing a CMV promoter and an SV40 PA signal was used. These two elements work synergistically to drive efficient expression of the target gene. Subsequently, linear DNA molecules were treated with specific restriction enzyme sites to induce ligation at both ends, forming a stable circular structure.

[0119] To investigate the potential impact of m6A methylation on circRNA properties, four DNA sequence variants (such as...) were presented. Figure 6 (F). Sequence 0 represents the original sequence that has not been changed, while sequences 1 through 4 are used to simulate the m6A methylation state or to explore its effect on circRNA function by introducing point mutations at key positions.

[0120] Using the online website SRAMP to predict m6A modification sites in circMYO9B, six potential m6A modification sites were identified: circMYO9B-17, circMYO9B-77, circMYO9B-89, circMYO9B-202, circMYO9B-230, and circMYO9B-278. The two m6A modification sites with the highest confidence were circMYO9B-17 and circMYO9B-77. Figure 7 In the diagram, the blue portion represents the m6A modification site. The "A" below the arrow indicates the sequence number.

[0121] Furthermore, PCR technology was used to verify the correctness of circRNA construction. By designing specific primers, amplification of specific regions of circRNA can be performed, thereby ensuring the success of the circularization process and the accurate formation of circRNA. The process from vector construction to sequence variation analysis and final verification of circRNA construction is systematically demonstrated, providing a molecular biology method for studying the role of m6A methylation in circRNA. Figure 6 In a study, the two most confident m6A motifs of circMYO9B, circMYO9B-17 and circMYO9B-77, were inserted into a vector and transfected into MuSCs. The results showed that when only one m6A modification was present (m6A-1), the GFP coding signal in the vector was significantly enhanced (p<0.05); however, when the first m6A modification was directly removed (m6A-2), the coding signal was significantly reduced (p<0.05); when two m6A modifications were present (m6A-3), the coding signal was significantly higher than that of the unmodified fragment (m6A-0) (p<0.05), but not significantly different from that of the fragment with one modification (m6A-1); when the modification site was mutated rather than directly removed (m6A-4), the coding signal was consistent with that of the unmodified fragment (m6A-0). Figure 6 These results indicate that the m6A modification on circMYO9B can significantly improve its encoded signal, while removing the m6A modification reduces the encoded signal, and the effect of the m6A modification on the encoded signal is independent of the number of modifications.

[0122] In summary, circMYO9B possesses coding potential and can be translated via the IRES pathway, with the translation process regulated by m6A modification. However, the resulting protein requires further identification, and its function also needs further investigation.

[0123] Although embodiments of the present invention have been shown and described, it will be understood by those skilled in the art that various changes, modifications, substitutions, and variations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the appended claims and their equivalents. The embodiments described above merely illustrate several implementations of the invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make several modifications and improvements without departing from the concept of the invention, and these all fall within the protection scope of the invention. Therefore, the protection scope of this invention should be determined by the appended claims.

Claims

1. The application of a reagent that enhances or promotes circMYO9B gene expression in the preparation of products that promote the proliferation of goat skeletal muscle satellite cells or promote goat muscle development, wherein the reagent is pCD5-circMYO9B; the method for constructing pCD5-circMYO9B includes: Step 1: Design primers for amplifying circMYO9B. Add an ECORI restriction site and a TAATACTTTCAG sequence to the front primer, and add a BamHI restriction site and an AGTTGTTCTTAC sequence to the front primer. Then amplify circMYO9B to obtain the target fragment. The sequences of the front primer and the reverse primer are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. Step 2: The target fragment and pCD5-ciR vector obtained in Step 1 are digested with enzymes, and the DNA is purified by gel recovery after enzyme digestion and ligated using T4 DNA ligase. Step 3: Transform the ligation product into competent cells and culture them, pick single clones to extract plasmids, and obtain the pCD5-circMYO9B; The nucleotide sequence of the circMYO9B gene is as follows: CTCCTCAACAAGAAGGACATGGAGGAGTCTGTCTCGTGCCTGTCTATCGGAGTCCTCGACATCTTTGGGTTTGAAGACTTTGAGAGGAACAGTTTTGAGCAGTTCTGCATCAACTACGCCAACGAGCAGCTCCAGTATTACTTCAACCAGCACATTTTTCAAGCTAGAGCAG GTGAAGCGGGAAATCTTAGTGGAAGTTCTGACCAAAAGAAAAACAGTGACCTCCAATGACAAGCTCATCCTTCCCTATAGTCTCAGCGAGGCCATCACCGCCCGTGACTCCATGGCCAAGTCACTGTACAGCGCGCTGTTCGATTGGATTGTGCTGCGGATCAACCACGCT.