Heat-resistance-related mutant protein, nucleotide and application of heat-resistance-related mutant protein and nucleotide in improvement of heat resistance of corn
By introducing single-base mutations into the corn mutant gene ZmPTT1-m, a mutant protein with heat resistance is obtained, which solves the problem of insufficient heat resistance of corn in the prior art, and improves the stress resistance and breeding efficiency of corn.
Patent Information
- Application Number
- CN202311640220.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to effectively improve the heat resistance of corn, especially under extremely high temperature conditions, resulting in a decrease in corn yield and a failure to harvest.
By introducing a single base mutation into the corn mutant gene ZmPTT1-m, G in the amino acid sequence of the protein is mutated to D, and a mutant protein with heat resistance is obtained.
It improves the heat resistance and stress resistance of corn, maintains high pollen vitality and fruiting rate under high temperature conditions, and shortens the breeding cycle of crops.
Smart Images

Figure CN120098097A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and specifically relates to heat-resistant related mutant proteins, nucleotides and their applications in improving the heat resistance of corn.
[0002] application. Background Art
[0003] Monocotyledons are a class of angiosperms. Plants with only one cotyledon on the embryo of the seed. Most monocotyledons have fibrous roots, no cambium in the roots and stems, parallel veins in the leaves, and very small cotyledons. The vast majority are herbaceous, and very few are woody. Gramineae are typical monocotyledons, such as rice, wheat, and corn. Corn (Zea mays L.) is an annual C4 herbaceous plant belonging to the genus Zea of the Gramineae family, and is a multi-purpose crop of "grain-energy-feed". In my country, the spatial distribution of high temperatures in summer highly overlaps with the distribution of corn production, and the time of high temperature occurrence highly overlaps with the flowering period of corn. In recent years, my country's main corn-producing areas have been greatly affected by extreme climate. Extreme high temperatures have seriously affected the pollen vitality of corn during the pollination period, resulting in abortion of corn kernels, resulting in a decrease in corn yield or even a total crop failure, but the existing domestic varieties cannot effectively solve this problem. Selecting high-temperature resistant varieties is the most economical and effective measure to solve the harm of high temperatures.
[0004] At present, technicians in this field mainly improve the heat resistance of plants by screening, knocking out or introducing certain genes. For example, the invention patent CN116179568B discloses that a double knockout mutant strain (zmp5h1 / 2) of maize ZmP5H1 and ZmP5H2 is obtained by constructing a CRISPR-Cas9 vector and using an Agrobacterium-mediated transformation method. By increasing the culture temperature simulation experiment, the role of ZmP5H1 and ZmP5H2 genes in improving plant temperature tolerance is revealed. The invention patent CN114790459B discloses the use of the maize ZmPRA1C1 gene in improving plant heat stress resistance. The results show that the gene can make the model plant maize have good heat stress resistance, which is specifically manifested in not only increasing the fresh weight of the aboveground part of the seedlings under heat stress, but also reducing the degree of damage to maize cells. Some technicians also screen and explore highly heat-resistant corn germplasm and key functional genes by measuring the pollen viability of different corn inbred lines under high temperatures. However, the limitations of this method are that the number of corn inbred lines used is relatively small, the coverage range is small, and simple pollen viability screening cannot fully reflect the heat resistance of pollen.
[0005] The inventor unexpectedly discovered during the research that the 1103rd base of the corn mutant gene ZmPTT1-m mutated from G to A, which significantly improved the heat resistance of corn, thereby improving the stress resistance of corn, providing a new breakthrough direction for the directional design breeding of corn and other monocotyledonous grass plants. The molecular marker of the single base mutation of the corn mutant gene ZmPTT1-m in the present invention can provide a rapid identification method, provide a new target for molecular marker-assisted selection breeding, and greatly save the breeding cycle of crops. Summary of the invention
[0006] The primary purpose of the present invention is to provide a mutant protein with heat resistance, wherein the mutant protein is obtained by mutation based on the amino acid sequence of the original protein, and the amino acid of the original protein includes the following conservative motif:
[0007] X1-X2-X3-G-Y1-Y2-Y3-S, wherein X1 is W or G, X2 is K or R, X3 is L / F, Y1 is K or R, Y2 is S or P, and Y3 is S / C; the amino acid sequence of the mutant protein is that the G in the conservative motif of the original protein is mutated to D.
[0008] The second purpose of the present invention is to provide a corn mutant protein ZmPTT1-m with heat resistance. The amino acid sequence of the corn mutant protein ZmPTT1-m is that the G in the conservative motif in the amino acid sequence of the original corn protein ZmPTT1 is mutated to D. The conservative motif of the amino acid sequence of the original corn protein ZmPTT1 is as follows: X1-X2-X3-G-Y1-Y2-Y3-S, wherein X1 is W or G, X2 is K or R, X3 is L / F, Y1 is K or R, Y2 is S or P, and Y3 is S / C; the amino acid sequence of the mutant protein is that the G in the conservative motif of the original protein is mutated to D.
[0009] Preferably, the amino acid D of the maize mutant protein ZmPTT1-m is located at position 368 of the amino acid sequence of the maize mutant protein ZmPTT1-m, and the amino acid sequence of the maize mutant protein ZmPTT1-m is shown in SEQ ID No.4.
[0010] The third object of the present invention is to provide a biomaterial, characterized in that the biomaterial is any one of the following A1) to A20):
[0011] A1) a nucleotide sequence encoding the maize mutant protein ZmPTT1-m, as shown in SEQ ID No.3;
[0012] A2) an expression cassette containing the mutant gene described in A1);
[0013] A3) a recombinant vector containing the mutant gene described in A1);
[0014] A4) a recombinant vector containing the expression cassette described in A2);
[0015] A5) a recombinant microorganism containing the mutant gene described in A1);
[0016] A6) a recombinant microorganism containing the expression cassette described in A2);
[0017] A7) a recombinant microorganism containing the recombinant vector described in A3);
[0018] A8) a recombinant microorganism containing the recombinant vector described in A4);
[0019] A9) a transgenic plant cell line containing the mutant gene described in A1);
[0020] A10) a transgenic plant cell line containing the expression cassette described in A2);
[0021] A11) a transgenic plant cell line containing the recombinant vector described in A3);
[0022] A12) a transgenic plant cell line containing the recombinant vector described in A4);
[0023] A13) transgenic plant tissue containing the mutant gene described in A1);
[0024] A14) transgenic plant tissue containing the expression cassette described in A2);
[0025] A15) transgenic plant tissue containing the recombinant vector described in A3);
[0026] A16) transgenic plant tissue containing the recombinant vector described in A4);
[0027] A17) A transgenic plant organ containing the mutant gene described in A1);
[0028] A18) a transgenic plant organ containing the expression cassette described in A2);
[0029] A19) a transgenic plant organ containing the recombinant vector described in A3);
[0030] A20) A transgenic plant organ containing the recombinant vector described in A4).
[0031] The fourth object of the present invention is to provide any of the following applications of the mutant protein, the corn mutant protein ZmPTT1-m or the biomaterial:
[0032] (1) Regulating plant heat tolerance;
[0033] (2) Preparation of products for regulating plant heat tolerance;
[0034] (3) Improve plant heat tolerance;
[0035] (4) Preparation of products for improving plant heat resistance;
[0036] (5) Plant breeding.
[0037] Preferably, the plant is a monocotyledonous plant.
[0038] Preferably, the monocotyledonous plant is a crop.
[0039] The fifth object of the present invention is to provide a SNP molecular marker that affects the heat resistance of corn. The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No.5. The SNP molecular marker is located at position 328, and the mutant base is G.
[0040] The sixth object of the present invention is to provide the use of the molecular marker in the preparation of transgenic corn with heat resistance. If the 328th base is G, it is a wild type; if the 311th base is A, it is a mutant.
[0041] The seventh object of the present invention is to provide a specific primer pair for detecting the SNP molecular marker, the nucleotide sequence of the specific primer pair is as follows:
[0042] ZmPTT1-mF: CAGTCAGGGTGCTGGAGAAG
[0043] ZmPTT1-mR: CTTGTGGGCGATTCAGTCCT.
[0044] The eighth object of the present invention is to provide a reagent or a kit containing the specific primer pair.
[0045] The beneficial effects of the present invention are as follows:
[0046] (1) The present invention provides a mutant protein with heat resistance, wherein the mutant protein is obtained by mutation based on the amino acid sequence of the original protein, and the amino acid of the original protein includes the following conservative motif: X1-X2-X3-G-Y1-Y2-Y3-S, wherein X1 is W or G, X2 is K or R, X3 is L / F, Y1 is K or R, Y2 is S or P, and Y3 is S / C; the amino acid sequence of the mutant protein is that the G in the conservative motif of the original protein is mutated to D.
[0047] (2) The present invention mutates the maize ZmPTT1 gene sequence and finds that the 368th amino acid in the maize ZmPTT1 amino acid sequence is mutated from G to D (the 1103rd base is mutated from the wild-type guanine deoxyribonucleotide to an adenine deoxyribonucleotide), thereby obtaining the maize mutant gene ZmPTT1-m, which has the function of conferring heat resistance to maize pollen, improving the tolerance of maize to heat stress, and thus improving the stress resistance of maize.
[0048] (3) The SNP molecular marker in the maize mutant gene ZmPTT1-m described in the present invention can provide a rapid identification method and provide a new target for molecular marker-assisted selection breeding, which greatly saves the breeding cycle of crops, reduces breeding costs, shortens the breeding cycle, and accelerates the breeding process, and has a high application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0049] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.
[0050] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0051] Figure 1 The comparison results of ZmPTT1 homologous sequence proteins in different species in the present invention.
[0052] Figure 2 Comparison of mutations at key amino acid sites in different species.
[0053] Figure 3 Schematic diagram of the structure of the maize mutant gene ZmPTT1-m.
[0054] Figure 4 Pollen phenotype of maize mutant gene ZmPTT1-m after high temperature treatment.
[0055] Figure 5 Grain setting status of maize mutant gene ZmPTT1-m pollen after heat treatment.
[0056] Figure 6 Sequencing results of mutants identified using molecular markers. DETAILED DESCRIPTION
[0057] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.
[0058] The "crops" mentioned in the present invention refer to plants that are cultivated directly or indirectly for human needs. Common cereal crops include rice, wheat, corn, sorghum, millet, coix, etc.; legume crops include soybean, peanut, broad bean, pea, kidney bean, chickpea, mung bean, rice bean, lentil, etc.; tuber crops include yam, yam, big potato, taro, purple taro, konjac of Araceae, Jerusalem artichoke of Asteraceae, yam bean of Leguminosae, banana root of Cannaceae, etc., as well as fiber crops, oil crops, sugar crops, etc.
[0059] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.
[0060] Example 1 Alignment of homologous proteins
[0061] The inventors found in the research process that monocotyledonous plants including rice (Os), wheat (Ta), sorghum (Sb), barley (Hv), millet (Pm) etc. all have homologous proteins, such as Figure 1 shown.
[0062] Further studies have found that the homologous proteins have a conserved motif: X1-X2-X3-G-Y1-Y2-Y3-S, wherein X1 is W or G, X2 is K or R, X3 is L / F, Y1 is K or R, Y2 is S or P, and Y3 is S / C. Figure 2 shown.
[0063] The inventors have found that by mutating G in the conserved motif to D, the mutant protein obtained has heat resistance.
[0064] Example 2 Obtaining maize ZmPTT1 and maize mutant gene ZmPTT1-m
[0065] The corn GRMZM2G171324 mutant seeds of the present invention are derived from the EMS mutagenesis mutant library MEMD (http: / / www.elabcaas.cn / memd / ). The corn ZmPTT1 gene was cloned from the corn inbred line B73, and the ZmPTT1-m gene was cloned from the corn ZmPTT1 mutant ZmPTT1-m. Using corn cDNA as a template, amplification was performed using a combination of ZmPTT1-F and ZmPTT1-R primers to obtain a 1743 bp long CDS fragment. The primer sequences are as follows:
[0066] ZmPTT1-F: ATGGAGCTTGTATACATGGA
[0067] ZmPTT1-R:TCACAGTTTGGGGCAAAGCT
[0068] cDNA acquisition:
[0069] Total RNA was extracted using a kit and then reverse transcribed. The reaction system and reaction conditions are as follows:
[0070] Total RNA 500ng 5×Evo M-MLV RT Master Mix 2μL RNAase free water Up to 10μL Total volume 10μL
[0071] Reaction conditions: 37℃15min; 85℃5sec. After the reaction is completed, the next experiment can be carried out or the reaction solution can be stored at -20℃.
[0072] The PCR reaction system is as follows (25 μL):
[0073]
[0074]
[0075] The reaction conditions were as follows: 98°C for 2 min; 98°C for 10 s, 55°C for 15 s, 72°C for 2 min, 30 cycles; 72°C for 5 min.
[0076] After testing, the coding region of corn ZmPTT1 has not changed, its CDS sequence is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2; the sequencing results of the corn mutant gene ZmPTT1-m showed that the 1103 base mutated from the wild-type guanine deoxyribonucleotide (G) to an adenine deoxyribonucleotide (A), and the encoded amino acid mutated from G to D, its CDS sequence is shown in SEQ ID No.3, and the amino acid sequence is shown in SEQ ID No.4.
[0077] Example 3 Identification of the heat-resistant phenotype of mutant pollen
[0078] The maize ZmPTT1 mutant and the corresponding inbred line B73 were planted in the field. When the maize pollen was shedding, pollen from the mutant and inbred line B73 were collected and placed in an environment of 25°C for 1 h and 37°C for 3 h, respectively, for in vitro pollen germination experiments.
[0079] like Figure 3 As shown, the mutant of maize ZmPTT1 used in the experiment is ZmPTT1-m. ZmPTT1-m is a non-synonymous mutation, in which the amino acid at position 368 is mutated from G to D.
[0080] The pollen germination rate is Figure 4 As shown, compared with the corresponding inbred line B73, there was no significant difference in the germination rate of mutant pollen of the corn mutant gene ZmPTT1-m treated at room temperature; after high temperature treatment, the pollen of the corresponding inbred line B73 did not germinate, and the pollen of the corn mutant gene ZmPTT1-m had a higher germination rate, which was significantly different. In other words, the mutant pollen of the corn mutant gene ZmPTT1-m has heat resistance.
[0081] Example 4 Detection of the fruit setting rate of mutant pollen after heat treatment
[0082] The maize mutant gene ZmPTT1-m mutant and the corresponding inbred line B73 were planted in the field. When the maize pollen was in the pollen shedding period, the pollen of the maize mutant gene ZmPTT1-m mutant and the inbred line B73 were collected respectively, and placed in an environment of 25℃ for 1h and 37℃ for 3h. Then, the pollen treated in vitro was pollinated on the silks of unpollinated B73 plants that were bagged in advance.
[0083] like Figure 5 As shown in the figure, the corn mutant gene ZmPTT1-m mutant and B73 pollen were treated in vitro at 25℃ for 1 hour before pollination. There was no significant difference between the two, and both had relatively normal fruit setting rates. However, the corn mutant gene ZmPTT1-m mutant pollen after in vitro high temperature treatment (37℃ environment treatment for 3 hours) had a higher fruit setting rate than the corresponding inbred line B73 pollen, which was significantly different. The corn mutant gene ZmPTT1-m can tolerate higher temperatures.
[0084] Example 5 Application of molecular marker primers related to heat resistance in corn
[0085] Molecular marker primers related to heat tolerance in maize,
[0086] ZmPTT1-mF: CAGTCAGGGTGCTGGAGAAG
[0087] ZmPTT1-mR: CTTGTGGGCGATTCAGTCCT
[0088] A method for identifying hybrid offspring carrying wild genotypes and mutant genotypes of the maize heat-resistant gene ZmPTT1 (identifying heat-resistant maize plants) using the above molecular marker primers:
[0089] (1) Using the genomic DNA of the maize material to be tested as a template and the sequences shown in the above ZmPTT1-mF and ZmPTT1-mR as primers, PCR amplification was performed to obtain a nucleotide sequence containing the SNP molecular marker, as shown in SEQ ID No.5.
[0090] (2) The PCR product obtained in step (1) is subjected to Sanger sequencing, and then the peak diagram is interpreted using BioEdit software. If the mutation site is base G, the corn material to be tested is a wild genotype; if the mutation site is base A, the corn material to be tested is a homozygous mutant genotype (the plant pollen is heat-resistant). Figure 6 shown.
[0091] The PCR reaction system is as follows (25 μL):
[0092]
[0093] The reaction conditions were as follows: 98°C for 2 min; 98°C for 10 s, 55°C for 15 s, 72°C for 2 min, 30 cycles; 72°C for 5 min.
[0094] In summary, the present invention provides a mutant protein with heat resistance, wherein the mutant protein is obtained by mutation based on the amino acid sequence of the original protein, wherein the amino acid of the original protein includes the following conservative motif: X1-X2-X3-G-Y1-Y2-Y3-S, wherein X1 is W or G, X2 is K or R, X3 is L / F, Y1 is K or R, Y2 is S or P, and Y3 is S / C; the amino acid sequence of the mutant protein is that the G in the conservative motif of the original protein is mutated to D. A corn mutant gene ZmPTT1-m is also provided, wherein the corn mutant gene ZmPTT1-m mutates the 1103rd base of the corn gene sequence ZmPTT1 from the wild-type guanine deoxyribonucleotide (G) to an adenine deoxyribonucleotide (A), and has the function of conferring heat resistance to corn pollen, improving the tolerance of corn to heat stress, and thus improving the stress resistance of corn. The molecular marker of the single base mutation in the maize mutant gene ZmPTT1-m mutant of the present invention can provide a rapid identification method, provide a new target for molecular marker-assisted selection breeding, and greatly save the breeding cycle of crops.
Claims
1. Mutant proteins with heat resistance, It is characterized in that The mutant protein is obtained by mutation based on the amino acid sequence of the original protein, and the amino acid of the original protein includes the following conservative motif: X 1 -X 2 -X 3 -GY 1 -Y 2 -Y 3 -S, where the X 1 W or G, X 2 K or R, X 3 For L / F, Y 1 K or R, Y 2 S or P, Y 3 is S / C; the amino acid sequence of the mutant protein is that the G in the conservative motif of the original protein is mutated to D.
2. A heat-resistant maize mutant protein ZmPTT1-m, It is characterized in that The amino acid sequence of the corn mutant protein ZmPTT1-m is obtained by mutating the G in the conservative motif sequence in the original corn protein ZmPTT1 amino acid sequence to D. The conservative motif sequence in the original corn protein ZmPTT1 amino acid sequence is as described in claim 1.
3. The maize mutant protein ZmPTT1-m as claimed in claim 2, It is characterized in that The amino acid D of the maize mutant protein ZmPTT1-m is located at position 368 of the amino acid sequence of the maize mutant protein ZmPTT1-m. The amino acid sequence of the maize mutant protein ZmPTT1-m is shown in SEQ ID No.
4.
4. A biomaterial, It is characterized in that The biological material is any one of the following A1) to A20): A1) a nucleotide sequence encoding the maize mutant protein ZmPTT1-m according to claim 3, as shown in SEQ ID No. 3; A2) an expression cassette containing the mutant gene described in A1); A3) a recombinant vector containing the mutant gene described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the mutant gene described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the mutant gene described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) a transgenic plant cell line containing the recombinant vector described in A4); A13) transgenic plant tissue containing the mutant gene described in A1); A14) transgenic plant tissue containing the expression cassette described in A2); A15) transgenic plant tissue containing the recombinant vector described in A3); A16) transgenic plant tissue containing the recombinant vector described in A4); A17) A transgenic plant organ containing the mutant gene described in A1); A18) a transgenic plant organ containing the expression cassette described in A2); A19) a transgenic plant organ containing the recombinant vector described in A3); A20) A transgenic plant organ containing the recombinant vector described in A4).
5. Any of the following uses of the mutant protein according to claim 1, the maize mutant protein ZmPTT1-m according to claims 2-3, or the biomaterial according to claim 4: (1) Regulating plant heat tolerance; (2) Preparation of products for regulating plant heat tolerance; (3) Improve plant heat tolerance; (4) Preparation of products for improving plant heat resistance; (5) Plant breeding.
6. The use according to claim 5, It is characterized in that The plant is a monocotyledonous plant.
7. A SNP molecular marker that affects the heat tolerance of corn. It is characterized in that The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No.
5. The SNP molecular marker is located at position 328, and the mutant base is G.
8. Use of the molecular marker of claim 7 in preparing transgenic corn with heat resistance, if the 328th base is G, it is a wild type; if the 311th base is A, it is a mutant.
9. A specific primer pair for detecting the SNP molecular marker according to claim 7, It is characterized in that The nucleotide sequence of the specific primer pair is as follows: ZmPTT1-mF: CAGTCAGGGTGCTGGAGAAG ZmPTT1-mR: CTTGTGGGCGATTCAGTCCT.
10. A reagent or kit containing the specific primer pair according to claim 9.
Citation Information
Patent Citations
Application of the maize ZmPRA1C1 gene in improving plant heat stress resistance
CN114790459B
Application of inhibiting the expression of ZmP5H1 and ZmP5H2 genes in improving heat resistance of maize
CN116179568B
Protein for regulating and controlling height of corn ear position as well as coding gene and application of protein
CN115725642A
Application of corn ZmNF-YC13 gene in corn heat resistance improvement and method of corn ZmNF-YC13 gene
CN116004662A
Protein for regulating and controlling salt tolerance of plants as well as coding gene and application of protein
CN117106821A