Method for improving heat resistance of corn, related mutant protein, nucleotide and application
By mutation of the amino acid position 443 of the corn ZmPTT1 gene from Q to termination, the corn mutant protein ZmPTT1-m2 was obtained, which solved the problem of insufficient heat tolerance of corn under high temperature conditions, significantly improved the heat resistance and stress resistance of corn, and provided a rapid breeding identification method.
Patent Information
- Application Number
- CN202311640851.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-04
- Publication Date
- 2025-06-06
AI Technical Summary
The prior art is difficult to effectively improve the heat resistance of corn, especially under high temperature conditions, which leads to poor corn solidity and even failure to harvest.
By mutation of the amino acid position 443 of the corn ZmPTT1 gene from Q to termination, the corn mutant protein ZmPTT1-m2 was obtained, which significantly improved the heat resistance of corn.
It improves corn's tolerance to high temperatures, enhances the stress resistance of corn, and provides a rapid identification method to assist in breeding selection, saves breeding cycles and reduces costs.
Smart Images

Figure CN120098098A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of genetic engineering, and specifically relates to a method for improving the heat resistance of corn, related mutant proteins, nucleotide
[0002] and applications. Background Art
[0003] Corn (Zea mays L.) is an annual C4 herbaceous plant belonging to the genus Zea of the Poaceae family. It is a multi-purpose crop of "food-energy-feed". The spatial distribution of high temperatures in my country in summer highly overlaps with the distribution of corn production, and the time of high temperature occurrence highly overlaps with the flowering period of corn. In recent years, my country's main corn-producing areas have been greatly affected by extreme climate. For example, in 2013, 2016-2019 and 2022, the temperature in the reproductive period of corn in the Huanghuaihai region exceeded 35°C for three consecutive days, resulting in poor corn setting or even crop failure. Extreme high temperatures seriously affect the pollen vitality of corn during the pollination period, causing corn kernels to abort, resulting in a decrease in corn yield or even crop failure, but the existing domestic varieties cannot effectively solve this problem. Selecting high temperature resistant varieties is the most economical and effective measure to solve the harm of high temperatures.
[0004] At present, technicians in this field mainly improve the heat resistance of plants by screening, knocking out or introducing certain genes. For example, the invention patent CN116445538A discloses that the heat resistance of corn is enhanced by reducing the expression of ZmCCS in corn plants, which provides a theoretical basis for the cultivation and improvement of heat-resistant corn varieties. The invention patent CN116004662A discloses that the expression of ZmNF-YC13 gene is driven in corn by heat-induced expression promoter, which can not only improve the tolerance of corn plants to high temperature, but also effectively avoid the plant growth retardation effect caused by excessive expression of ZmNF-YC13 gene, which provides a theoretical basis for further mining the excellent mutation sites of ZmNF-YC13 gene. There are also technicians who screen and mine high heat-resistant corn germplasm and key functional genes by measuring the pollen viability of different corn inbred lines at high temperature, but the limitation of this method is that the number of corn inbred lines used is small, the coverage is small, and the simple pollen viability screening cannot fully reflect the heat resistance of pollen.
[0005] The inventor unexpectedly discovered during the research that the amino acid at position 443 of the corn mutant gene ZmPTT1-m2 mutated from Q to termination, which significantly improved the heat resistance of corn, thereby improving the stress resistance of corn, providing a new breakthrough direction for the directional design breeding of corn and other monocotyledonous grass plants. The molecular marker of the single base mutation of the ZmPTT1 gene in the ZmPTT1 mutant of the present invention can provide a rapid identification method, provide a new target for molecular marker-assisted selection breeding, and greatly save the breeding cycle of crops. Summary of the invention
[0006] The primary purpose of the present invention is to provide a method for improving the heat resistance of corn, wherein the method comprises damaging / changing the function of the corn ZmPTT1 protein, and the amino acid sequence of the corn ZmPTT1 protein is shown in SEQ ID No.2.
[0007] Preferably, the method for damaging / changing the function of the maize ZmPTT1 protein is to terminate the translation, transcription or protein degradation of the maize ZmPTT1 protein.
[0008] The second objective of the present invention is to provide a heat-resistant corn mutant protein ZmPTT1-m2, wherein the corn mutant protein ZmPTT1-m2 is based on the amino acid sequence of corn ZmPTT1, and the amino acid at position 443 is mutated from Q to stop.
[0009] Preferably, the amino acid sequence of the maize mutant protein ZmPTT1-m2 is shown in SEQ ID No.4.
[0010] The third object of the present invention is to provide a biological material, which is any one of the following A1) to A20): A1) a nucleotide sequence encoding the maize mutant protein ZmPTT1-m2;
[0011] A2) an expression cassette containing the maize mutant gene ZmPTT1-m2 described in A1);
[0012] A3) a recombinant vector containing the maize mutant gene ZmPTT1-m2 described in A1);
[0013] A4) a recombinant vector containing the expression cassette described in A2);
[0014] A5) a recombinant microorganism containing the maize mutant gene ZmPTT1-m2 described in A1);
[0015] A6) a recombinant microorganism containing the expression cassette described in A2);
[0016] A7) a recombinant microorganism containing the recombinant vector described in A3);
[0017] A8) a recombinant microorganism containing the recombinant vector described in A4);
[0018] A9) a transgenic plant cell line containing the maize mutant gene ZmPTT1-m2 described in A1);
[0019] A10) a transgenic plant cell line containing the expression cassette described in A2);
[0020] A11) a transgenic plant cell line containing the recombinant vector described in A3);
[0021] A12) a transgenic plant cell line containing the recombinant vector described in A4);
[0022] A13) transgenic plant tissue containing the maize mutant gene ZmPTT1-m2 described in A1);
[0023] A14) transgenic plant tissue containing the expression cassette described in A2);
[0024] A15) transgenic plant tissue containing the recombinant vector described in A3);
[0025] A16) transgenic plant tissue containing the recombinant vector described in A4);
[0026] A17) transgenic plant organs containing the maize mutant gene ZmPTT1-m2 described in A1);
[0027] A18) a transgenic plant organ containing the expression cassette described in A2);
[0028] A19) a transgenic plant organ containing the recombinant vector described in A3);
[0029] A20) A transgenic plant organ containing the recombinant vector described in A4).
[0030] The fourth object of the present invention is to provide any of the following applications of the maize mutant protein ZmPTT1-m2:
[0031] (1) Regulating plant heat tolerance;
[0032] (2) Preparation of products for regulating plant heat tolerance;
[0033] (3) Improve plant heat tolerance;
[0034] (4) Preparation of products for improving plant heat resistance;
[0035] (5) Plant breeding.
[0036] Preferably, the plant is a monocotyledonous plant.
[0037] Preferably, the monocotyledonous plant is a crop.
[0038] The fifth object of the present invention is to provide a SNP molecular marker that affects the heat resistance of corn. The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No.5. The SNP molecular marker is located at position 311, and the mutant base is C.
[0039] The sixth object of the present invention is to provide the use of the molecular marker in the preparation of transgenic corn with heat resistance. If the 311th base is C, it is a wild type; if the 311th base is T, it is a mutant.
[0040] The seventh object of the present invention is to provide a specific primer pair for detecting the SNP molecular marker, the nucleotide sequence of the specific primer pair is as follows:
[0041] ZmPTT1-m2-F: GAAAGGGAAGGGCCTTGTCA
[0042] ZmPTT1-m2-R: ACCGTTGAGCACTCTGATGG.
[0043] The eighth object of the present invention is to provide a reagent or a kit containing the specific primer pair.
[0044] The beneficial effects of the present invention are as follows:
[0045] (1) The present invention mutates the maize ZmPTT1 gene sequence and unexpectedly finds that the 1327th base of the maize ZmPTT1 gene sequence is mutated from the wild-type cytosine deoxyribonucleotide (C) to thymine deoxyribonucleotide (T), that is, the 443rd amino acid is mutated from Q to stop, to obtain the maize mutant gene ZmPTT1-m2, which has the function of conferring heat resistance to maize pollen, improving the tolerance of maize to heat stress, and thus improving the stress resistance of maize.
[0046] (2) The present invention also provides SNP molecular markers in the mutant of the maize mutant gene ZmPTT1-m2, which can provide a rapid identification method and provide a new target for molecular marker-assisted selection breeding, greatly saving the breeding cycle of crops, reducing breeding costs, shortening the breeding cycle, and accelerating the breeding process, and has a high application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0047] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.
[0048] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.
[0049] Figure 1 The comparison results of ZmPTT1 homologous sequence proteins in different species in the present invention.
[0050] Figure 2 Comparison of amino acids (Q443*) at the premature termination site of protein expression in different species.
[0051] Figure 3 Schematic diagram of the structure of the maize ZmPTT1 mutant.
[0052] Figure 4 Pollen phenotype of maize ZmPTT1 mutant after high temperature treatment.
[0053] Figure 5 Grain setting status of maize ZmPTT1 mutant after pollen heat treatment.
[0054] Figure 6 Sequencing results of mutants identified using molecular markers. DETAILED DESCRIPTION
[0055] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.
[0056] The "crops" mentioned in the present invention refer to plants that are cultivated directly or indirectly for human needs. Common cereal crops include rice, wheat, corn, sorghum, millet, coix, etc.; legume crops include soybean, peanut, broad bean, pea, kidney bean, chickpea, mung bean, rice bean, lentil, etc.; tuber crops include yam, yam, big potato, taro, purple taro, konjac of Araceae, Jerusalem artichoke of Asteraceae, yam bean of Leguminosae, banana root of Cannaceae, etc., as well as fiber crops, oil crops, sugar crops, etc.
[0057] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.
[0058] Example 1 Obtaining maize ZmPTT1 and maize mutant gene ZmPTT1-m2 and comparison of their homologous proteins
[0059] The corn GRMZM2G171324 mutant seeds of the present invention are derived from the EMS mutagenesis mutant library MEMD (http: / / www.elabcaas.cn / memd / ). The corn ZmPTT1 gene was cloned from the corn inbred line B73, and the corn mutant gene ZmPTT1-m2 was cloned from the corn ZmPTT1 mutant ZmPTT1-m2. Using corn cDNA as a template, amplification was performed using a combination of ZmPTT1-F and ZmPTT1-R primers to obtain a 1743 bp long CDS fragment. The primer sequences are as follows:
[0060] ZmPTT1-F: ATGGAGCTTGTATACATGGA
[0061] ZmPTT1-R:TCACAGTTTGGGGCAAAGCT
[0062] Obtaining cDNA:
[0063] Total RNA was extracted using a kit and then reverse transcribed. The reaction system and reaction conditions are as follows:
[0064] Total RNA 500ng 5 × EvoM-MLVRTMasterMix 2μL RNAase-freewater Up to 10 μL Total volume 10μL
[0065] Reaction conditions: 37℃15min; 85℃5sec. After the reaction is completed, the next experiment can be carried out or the reaction solution can be stored at -20℃.
[0066] The PCR reaction system is as follows (25 μL):
[0067] cDNA 1.0μL 5×PS buffer 5μL dNTP(2.0mM) 1.0μL ZmPTT1-F (10 μM) 1.0μL ZmPTT1-R (10 μM) 1.0μL PrimeSATR High-Fidelity DNA Amplification Enzyme 0.25μL Double distilled water 15.75μL Total volume 25μL
[0068] The reaction conditions were as follows: 98°C for 2 min; 98°C for 10 s, 55°C for 15 s, 72°C for 2 min, 30 cycles; 72°C for 5 min.
[0069] After testing, the coding region of corn ZmPTT1 has not changed, its CDS sequence is shown in SEQ ID No.1, and the amino acid sequence is shown in SEQ ID No.2; the sequencing results of the corn mutant gene ZmPTT1-m2 showed that the 1327th base mutated from the wild-type cytosine deoxyribonucleotide (C) to a thymine deoxyribonucleotide (T), and the encoded amino acid mutated from Q to a stop amino acid, its CDS sequence is shown in SEQ ID No.3, and the amino acid sequence is shown in SEQ ID No.4.
[0070] The sequence of maize ZmPTT1 protein was compared and it was found that it is conserved in common gramineous crops, including rice (Os), wheat (Ta), sorghum (Sb), barley (Hv), millet (Pm), etc., all of which have homologous proteins ( Figure 1 The 443rd amino acid encoded by the obtained maize mutant gene ZmPTT1-m2 was mutated from Q to stop, and the 443rd amino acid sequence was aligned as follows Figure 2 .
[0071] Example 2 Identification of the heat-resistant phenotype of mutant pollen
[0072] The maize ZmPTT1 mutant and the corresponding inbred line B73 were planted in the field. When the maize pollen was shedding, pollen from the mutant and inbred line B73 were collected and placed in an environment of 25°C for 1 h and 37°C for 3 h, respectively, for in vitro pollen germination experiments.
[0073] like Figure 3 As shown, the mutant of maize ZmPTT1 used in the experiment is maize mutant gene ZmPTT1-m2. Maize mutant gene ZmPTT1-m2 is a premature termination mutation, and the amino acid at position 443 is mutated from Q to termination.
[0074] The pollen germination rate is Figure 4 As shown, compared with the corresponding inbred line B73, there was no significant difference in the germination rate of pollen with the corn mutant gene ZmPTT1-m2 treated at room temperature; after high temperature treatment, the pollen corresponding to the inbred line B73 did not germinate, and the pollen with the corn mutant gene ZmPTT1-m2 had a higher germination rate, which was significantly different. In other words, the mutant pollen of the corn mutant gene ZmPTT1-m2 has heat resistance.
[0075] Example 3 Detection of the fruit setting rate of mutant pollen after heat treatment
[0076] The maize ZmPTT1 mutant, maize mutant gene ZmPTT1-m2 and the corresponding inbred line B73 were planted in the field. When the corn was in the pollen shedding period, pollen from the mutant maize mutant gene ZmPTT1-m2 and the inbred line B73 were taken respectively, and placed in a 25°C environment for 1 hour and a 37°C environment for 3 hours. Then, the pollen treated in vitro was pollinated on the silks of unpollinated B73 plants that were bagged in advance.
[0077] like Figure 5 As shown in the figure, the mutant maize mutant gene ZmPTT1-m2 and B73 pollen were treated in vitro at 25℃ for 1 hour before pollination. There was no significant difference between the two, and both had relatively normal fruit setting rates. However, the maize mutant gene ZmPTT1-m2 pollen after in vitro high temperature treatment (37℃ environment treatment for 3 hours) had a higher fruit setting rate than the corresponding inbred line B73 pollen, which was significantly different. The maize mutant gene ZmPTT1-m2 can tolerate higher temperatures.
[0078] Example 4 Identification of mutants using molecular markers
[0079] A molecular marker primer pair related to heat tolerance in maize:
[0080] ZmPTT1-m2-F: GAAAGGGAAGGGCCTTGTCA
[0081] ZmPTT1-m2-R: ACCGTTGAGCACTCTGATGG
[0082] A method for identifying hybrid offspring carrying the wild genotype and mutant genotype of the maize heat-resistant gene ZmPTT1 (identifying heat-resistant maize plants) by using the molecular marker primers.
[0083] (1) Using the genomic DNA of the maize material to be tested as a template and the sequences shown in the above ZmPTT1-m2-F and ZmPTT1-m2-R as primers, PCR amplification was performed to obtain a nucleotide sequence containing a molecular marker as shown in SEQ ID No. 5.
[0084] (2) The PCR product obtained in step (1) is subjected to Sanger sequencing, and then the peak diagram is interpreted using BioEdit software. If the mutation site is base C, the corn material to be tested is a wild genotype; if the mutation site is base T, the corn material to be tested is a homozygous mutant genotype (the plant pollen is heat-resistant). Figure 6 shown.
[0085] The PCR reaction system is as follows (25 μL):
[0086]
[0087]
[0088] The reaction conditions were as follows: 98°C for 2 min; 98°C for 10 s, 55°C for 15 s, 72°C for 2 min, 30 cycles; 72°C for 5 min.
[0089] In summary, the present invention provides a maize ZmPTT1 mutant gene, wherein the mutant gene maize mutant gene ZmPTT1-m2 is a mutant gene maize mutant gene ZmPTT1-m2 in which the 1327th base is mutated from the wild-type cytosine deoxyribonucleotide (C) to a thymine deoxyribonucleotide (T), and the mutant gene maize mutant gene ZmPTT1-m2 has the function of conferring heat resistance to maize pollen, improving the tolerance of maize to heat stress, and thus improving the stress resistance of maize. The molecular marker of the single base mutation in the mutant gene maize mutant gene ZmPTT1-m2 of the present invention can provide a rapid identification method, provide a new target for molecular marker-assisted selection breeding, and greatly save the breeding cycle of crops.
Claims
1. A method for improving the heat tolerance of corn, It is characterized in that The method is to delete / change the function of the corn ZmPTT1 protein, and the amino acid sequence of the corn ZmPTT1 protein is shown in SEQ ID No.
2.
2. The method according to claim 1, It is characterized in that Methods for deleting / changing the function of the maize ZmPTT1 protein include terminating the translation or transcription of the maize ZmPTT1 protein or degrading the protein.
3. The heat-resistant maize mutant protein ZmPTT1-m2, It is characterized in that The maize mutant protein ZmPTT1-m2 is based on the amino acid sequence of maize ZmPTT1, and the amino acid at position 443 is mutated from Q to stop.
4. The maize mutant protein ZmPTT1-m2 according to claim 3, It is characterized in that The amino acid sequence of the maize mutant protein ZmPTT1-m2 is shown in SEQ ID No.
4.
5. Biomaterials, It is characterized in that The biological material is any one of the following A1) to A20): A1) a nucleotide sequence encoding the maize mutant protein ZmPTT1-m2 according to claim 4; A2) an expression cassette containing the maize mutant gene ZmPTT1-m2 described in A1); A3) a recombinant vector containing the maize mutant gene ZmPTT1-m2 described in A1); A4) a recombinant vector containing the expression cassette described in A2); A5) a recombinant microorganism containing the maize mutant gene ZmPTT1-m2 described in A1); A6) a recombinant microorganism containing the expression cassette described in A2); A7) a recombinant microorganism containing the recombinant vector described in A3); A8) a recombinant microorganism containing the recombinant vector described in A4); A9) a transgenic plant cell line containing the maize mutant gene ZmPTT1-m2 described in A1); A10) a transgenic plant cell line containing the expression cassette described in A2); A11) a transgenic plant cell line containing the recombinant vector described in A3); A12) a transgenic plant cell line containing the recombinant vector described in A4); A13) transgenic plant tissue containing the maize mutant gene ZmPTT1-m2 described in A1); A14) transgenic plant tissue containing the expression cassette described in A2); A15) transgenic plant tissue containing the recombinant vector described in A3); A16) transgenic plant tissue containing the recombinant vector described in A4); A17) transgenic plant organs containing the maize mutant gene ZmPTT1-m2 described in A1); A18) a transgenic plant organ containing the expression cassette described in A2); A19) a transgenic plant organ containing the recombinant vector described in A3); A20) A transgenic plant organ containing the recombinant vector described in A4).
6. Any of the following uses of the maize mutant protein ZmPTT1-m2 according to any one of claims 3 to 4: (1) Regulating plant heat tolerance; (2) Preparation of products for regulating plant heat tolerance; (3) Improve plant heat tolerance; (4) Preparation of products for improving plant heat resistance; (5) Plant breeding.
7. A SNP molecular marker that affects the heat tolerance of corn. It is characterized in that The nucleotide sequence containing the SNP molecular marker is shown in SEQ ID No.
5. The SNP molecular marker is located at position 311, and the mutant base is C.
8. Use of the molecular marker of claim 7 in preparing transgenic corn with heat resistance, if the 311th base is C, it is a wild type; if the 311th base is T, it is a mutant.
9. A specific primer pair for detecting the SNP molecular marker according to claim 7, It is characterized in that The nucleotide sequence of the specific primer pair is as follows: ZmPTT1-m2-F: GAAAGGGAAGGGCCTTGTCA ZmPTT1-m2-R: ACCGTTGAGCACTCTGATGG.
10. A reagent or kit containing the specific primer pair according to claim 9.
Citation Information
Patent Citations
Application of corn ZmNF-YC13 gene in corn heat resistance improvement and method of corn ZmNF-YC13 gene
CN116004662A
Application of ZmCCS gene to corn heat resistance improvement and method for improving corn heat resistance
CN116445538A
Gene for regulating and controlling corn drought stress resistance and application thereof
CN106480075A
Corn waxy gene mutant as well as molecular marker and application thereof
CN111996177A
Maize cytoplasmic male sterility (CMS) c-type restorer RF4 gene, molecular markers and their use
US20120090047A1