Self-assembled ferritin nanoparticle recombinant protein SFT as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of vaccines, and particularly relates to a self-assembled ferritin nanoparticle recombinant protein SFT as well as a preparation method and application thereof. The recombinant protein SFT is formed by self-assembly of a SpyCatcher 003-Fel protein and a SpyTag003-TB10.4 protein, and the SpyCatcher 003-Fel protein and the SpyTag003-TB10.4 protein are used as Compared with a monomer TB10.4, the tuberculosis vaccine prepared by utilizing the self-assembled ferritin nanoparticle recombinant protein SFT has the advantages that the lymphocyte proliferation level is obviously improved by subcutaneous immunization of the SFT under the condition that an adjuvant is not used, and the tuberculosis vaccine has the capability of inducing T cell activation and can stimulate various TB related cell factors. The results show that the SFT is obviously superior to the traditional recombinant protein and vaccine, the variety of novel tuberculosis candidate vaccines is widened, and a nanoparticle capture platform is provided for other tuberculosis antigens in the future.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccines, and in particular relates to a self-assembled ferritin nanoparticle recombinant protein SFT and a preparation method and application thereof. Background Art

[0002] As the oldest vaccine, BCG (BCG) still plays a role in tuberculosis vaccines, although BCG shows superior protective effects in non-immunodeficient adolescents. However, it must be considered that the immune effect of BCG will gradually decline with age. More importantly, BCG, which is essentially a live attenuated vaccine, will be a fatal blow to immunodeficient people. For people with impaired innate immune systems, BCG vaccination is likely to cause BCG-disseminated diseases that are difficult to cure or even have a high mortality rate. This dilemma greatly limits the application of BCG in special populations, and tuberculosis (TB) is one of the main complications or causes of death in immunodeficient patients. In addition, even if Mycobacterium bovis loses some dangerous virulence factors during the passage process, vaccinating BCG to newborns or HIV patients with innate immune system defects will cause a fatal blow to these special groups. Using RD region antigens as supplementary vaccine targets for BCG is an effective mainstream strategy, but considering the inapplicability of BCG to immunodeficient people, the development of an antigen protein vaccine that exists in the BCG genome should also be taken seriously. Therefore, people are not optimistic about the BCG-style homologous booster strategy, and there is an urgent need to develop a booster vaccine with similar immunogenicity to BCG to provide a safer and more efficient new tuberculosis vaccine to turn the tide. Summary of the invention

[0003] The purpose of the present invention is to provide a self-assembled ferritin nanoparticle recombinant protein SFT and its preparation method and application. The recombinant protein SFT of the present invention is significantly superior to the traditional vaccine BCG and has the prospect of being applied to immunodeficient people.

[0004] The present invention provides a self-assembled ferritin nanoparticle recombinant protein SFT, wherein the recombinant protein SFT is self-assembled from SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein;

[0005] The nucleotide sequence encoding the SpyCatcher003-Fer protein is shown in SEQ ID NO.1; the nucleotide sequence encoding the SpyTag003-TB10.4 protein is shown in SEQ ID NO.2.

[0006] The present invention also provides a method for preparing the recombinant protein SFT, comprising the following steps:

[0007] Inserting the SpyCatcher003-Fer fragment into a prokaryotic expression vector to obtain a prokaryotic recombinant expression vector, and expressing the prokaryotic recombinant expression vector in a prokaryotic cell to obtain a SpyCatcher003-Fer protein; the nucleotide sequence of the SpyCatcher003-Fer fragment is shown in SEQ ID NO.1;

[0008] Inserting the SpyTag003-TB10.4 fragment into a eukaryotic expression vector to obtain a eukaryotic recombinant expression vector, and expressing the eukaryotic recombinant expression vector in eukaryotic cells to obtain the SpyTag003-TB10.4 protein; the nucleotide sequence of the SpyTag003-TB10.4 fragment is shown in SEQ ID NO.2;

[0009] The SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein are incubated to obtain the self-assembled ferritin nanoparticle recombinant protein SFT.

[0010] As a preferred embodiment, the basic skeleton of the prokaryotic expression vector includes a pET-28a vector, and the prokaryotic cell includes Escherichia coli BL21;

[0011] The basic skeleton of the eukaryotic expression vector includes a pcDNA3.4 vector, and the eukaryotic cell includes a HEK293F cell.

[0012] As a preferred embodiment, the molar ratio of the SpyCatcher003-Fer protein to the SpyTag003-TB10.4 protein is 1:4-8.

[0013] As a preferred embodiment, the incubation temperature is 2-6°C, and the incubation time is 10-14 hours.

[0014] As a preferred embodiment, the incubation buffer is 10 mM Na 2 HPO 4 , 2mM KH 2 PO 4 , 136 mM NaCl and 2.6 mM KCl.

[0015] The present invention also provides the use of the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method in the preparation of tuberculosis vaccine.

[0016] The present invention also provides a tuberculosis vaccine, which comprises the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method.

[0017] As a preferred embodiment, the tuberculosis vaccine is used at a concentration of 0.1 mg / mL, and the dosage of the tuberculosis vaccine is 150-250 μL / 20 g.

[0018] Beneficial effects: The present invention provides a self-assembled ferritin nanoparticle recombinant protein SFT, which is self-assembled from SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein. The tuberculosis vaccine prepared by the self-assembled ferritin nanoparticle recombinant protein SFT of the present invention, compared with monomeric TB10.4, subcutaneous immunization of SFT without the aid of an adjuvant significantly increased the level of lymphocyte proliferation, and has the ability to induce T cell activation, and can stimulate a variety of TB-related cytokines. Studies have shown that SFT's ability in all aspects is not inferior to or better than BCG. These results show that SFT is significantly superior to traditional recombinant proteins. At the same time, the present invention selects TB10.4 in the non-RD region shared with BCG as a target, and compared with the BCG vaccine using the RD region antigen as a target, it has the prospect of being applied to immunocompromised people. This helps to broaden the types of new tuberculosis candidate vaccines and provide a nanoparticle capture platform for other tuberculosis antigens in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0020] Figure 1 Schematic diagram of the assembly of pyCatcher003-Fer protein and SpyTag003-TB10.4 protein;

[0021] Figure 2 It is a schematic diagram of the construction of the recombinant expression plasmid in Example 1; A is a schematic diagram of the SpyTag003-TB10.4 recombinant plasmid and protein sequence; B is a schematic diagram of the SpyCatcher003-Fer recombinant plasmid and nanocarrier protein sequence;

[0022] Figure 3The preparation and immunogenicity analysis of the self-assembled ferritin nanoparticle tuberculosis vaccine in Example 2; wherein A is the coupling of SpyCatcher003-Fer and SpyTag003-TB10.4 at different ratios for 12 hours at 4°C; B is TEM observation of SpyCatcher003-Fer; C is TEM observation of SFT-NPs; D is DLS analysis of the particle size distribution of SpyCatcher003-Fer and SFT-NPs; E. NPs particle size and molecular weight of each protein;

[0023] Figure 4 The lymphocyte proliferation test results in Example 4;

[0024] Figure 5 The flow cytometry analysis of different immune group antigen-specific CD4 + T functional T cell frequency; A is CD4 + IFN-γ + T cell flow cytometry results; B is CD4 + IFN-γ + T cell test results statistical chart; C is CD4 + TNF-α + T cell flow cytometry results; D is CD4 + TNF-α + T cell test results statistical chart; E is CD4 + IL-2 + Tcells flow cytometry results; F is CD4 + IL-2 + Statistical chart of T cells test results;

[0025] Figure 6 The flow cytometry analysis of different immune group antigen-specific CD8 + T functional T cell frequency; A is CD8 + IFN-γ + T cell flow cytometry results; B is CD8 + IFN-γ + T cell detection results statistical chart; C is CD8 + TNF-α + T cell flow cytometry results; D is CD8 + TNF-α + T cell detection results statistical chart; E is CD8 + IL-2 + Tcells flow cytometry results; F is CD8 + IL-2 +Statistical chart of T cells test results;

[0026] Figure 7 The number of spot-forming cells (SFC) producing IFN-γ per million cells determined by ELISpot in Example 6; wherein A is a spot diagram of IFN-γ secretion detected by ELISpot; B is a statistical analysis of IFN-γ secretion of mouse spleen cells stimulated by TB10.4 and PPD respectively detected by ELISpot;

[0027] Figure 8 is the secretion level of tuberculosis-related cytokines in Example 7; wherein A is the secretion expression level of IFN-γ; B is the secretion expression level of TNF-α; C is the secretion expression level of IL-2; D is the secretion expression level of IL-4; E is the secretion expression level of IL-12; and F is the secretion expression level of IL-17;

[0028] Fig. 9 is the transcription level of tuberculosis-related cytokines in Example 8; wherein A is the transcription expression level of IFN-γ; B is the transcription expression level of TNF-α; C is the transcription expression level of IL-2; and D is the transcription expression level of IL-17;

[0029] Fig.10 A preliminary assessment of vaccine safety was performed using H&E staining as in Example 9 (scarbar, 50 μm). DETAILED DESCRIPTION

[0030] The invention provides a self-assembled ferritin nanoparticle recombinant protein SFT. The recombinant protein SFT is self-assembled from SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein.

[0031] In the present invention, Fer (NPs) can deliver antigens to immune cells after highly polymerizing. Compared with single soluble antigens that are too small, nanoparticles after highly polymerizing antigens are more easily recognized by cells and enter the draining lymph nodes to be taken up and presented by antigen presenting cells, inducing a higher intensity immune response through the multi-epitope binding sites on the surface of Fer. However, the nanoparticles obtained by chemical crosslinking are very susceptible to the influence of chemical crosslinking agents and mismatch, resulting in uneven display of antigens on the carrier surface. The properties of coupled Fer obtained by fusing heterologous antigen genes to nanocarriers are often unstable. The present invention uses the SpyCatcher003 / SpyTag003 system, which can spontaneously and irreversibly form a more highly stable isopeptide bond in a commonly used protein buffer environment in vitro. This feature combines the stability of its own physical and chemical properties, the convenience of "plug and play", the polymerizability of nanocarriers and the economy of genetic engineering, and greatly improves the connection efficiency and stability of the self-assembled ferritin nanoparticle recombinant protein SFT.

[0032] As a specific embodiment, the nucleotide sequence encoding the SpyCatcher003-Fer protein is shown as SEQ ID NO.1: 5’-ATGGGCCATCACCATCATCATCATGGCTCTTCCGTTACGACTTTGTCCGGTTTA AGCGGTGAGCAGGGCCCTAGTGGCGACATGACCACCGAAGAGGACAGTGCGACTCACATCAAATTCAGCAAGCGTGATGAAGACGGCCGCGAGTTGGCTGGCGCAACTATGGAGCTGCGCGACTCTTCCGGCAAAACCATCTCCACTTGGATTAGTGATGGTCATGTGAAAGACTTCTACTTGTACCCGGGCAAATACACGTTCGTTGAAACCGCGGCTCCTGACGGTTACGAAGTTGCTACCCCGATTGAGTTTACGGTCAATGAAGACGGCCAGGTTACCGTAGATGGTGAGGCAACCGAGGGTGACGCACATACTGGCGGCTCTGGTGGTAGTGGTGGCTCCGGCGGTAGCGAAAGTCAGGTGCGTCAGCAGTTTAGCAAAGACATTGAGAAGCTGTTGAATGAACAAGTTAACAAGGAGATGCAAAGCTCCAACTTGTATATGAGCATGAGTTCTTGGTGTTATACTCACAGTTTAGACGGCGCCGGCTTATTTTTATTTGATCACGCAGCGGAGGAATACGAACACGCTAAGAAGCTGATCATTTTCTTGAACGAGAACAATGTTCCAGTTCAATTGACGTCCATTTCCGCACCTGAGCACAAGTTCGAAGGTTTGACTCAGATTTTCCAAAAAGCATACGAACATGAGCAGCACATTTCCGAGTCCATTAACAATATTGTAGACCACGCCATTAAATCCAAGGATCATGCAACCTTCAACTTTTTACAGTGGTATGTCGCGGAGCAGCACGAAGAAGAAGTTTTGTTCAAAGATATCCTGGACAAAATTGAACTGATCGGCAACGAGAATCATGGTTTATACTTAGCGGACCAGTACGTAAAGGGTATTGCCAAAAGTCGCAAATCC-3’。

[0033] As a specific embodiment, the nucleotide sequence encoding the SpyTag003-TB10.4 protein is shown in SEQ ID NO.2: 5'-GCCACCATGAAGTGGGTCACCTTCATCAGCCTGCTGTTTCTGTTCAGCAGCGC CTACAGCATGTCCCAGATCATGTACAACTACCCCGCCATGCTGGGCCACGCCGGCGACATGGCCGGCTACGCCGGAACCCTGCAGAGCCTCGGCGCCGAGATCGCCGTGGAACAGGCTGCTCTGCAATCTGCCTGGCAGGGCGACACCGGCATCACCTACCAGGCTTGGCAGGCCCAGTGGAACCAGGCCATGGAAGAT CTGGTGCGGGCCTATCACGCCATGAGCTCTACACACGAGGCTAATACCATGGCCATGATGGCTAGAGATACAGCCGAGGCCGCCAAGTGGGGAGGCGGATCTGGCGGCAGCGGAGGCTCCGGCAGAGGCGTGCCTCACATCGTGATGGTGGACGCCTACAAAAGATACAAGGGCAGCCACCACCATCACCACCAC-3'.

[0034] The present invention also provides a method for preparing the recombinant protein SFT, comprising the following steps:

[0035] Inserting the SpyCatcher003-Fer fragment into a prokaryotic expression vector to obtain a prokaryotic recombinant expression vector, and expressing the prokaryotic recombinant expression vector in a prokaryotic cell to obtain a SpyCatcher003-Fer protein; the nucleotide sequence of the SpyCatcher003-Fer fragment is shown in SEQ ID NO.1;

[0036] Inserting the SpyTag003-TB10.4 fragment into a eukaryotic expression vector to obtain a eukaryotic recombinant expression vector, and expressing the eukaryotic recombinant expression vector in eukaryotic cells to obtain the SpyTag003-TB10.4 protein; the nucleotide sequence of the SpyTag003-TB10.4 fragment is shown in SEQ ID NO.2;

[0037] The SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein are incubated to obtain the self-assembled ferritin nanoparticle recombinant protein SFT.

[0038] The basic skeleton of the prokaryotic expression vector of the present invention includes a pET-28a vector; the prokaryotic cell includes Escherichia coli BL21. As a specific embodiment, for the prokaryotic expression vector, the vector used is a high-copy vector pET-28a of the prokaryotic expression system in genetic engineering, and Nco I and Xho I therein are selected as restriction sites. The sequence of Ferritin (GenBank: NP_223316) was obtained from the website www.ncbi.nlm.nih.gov, and the N-terminus was connected to SyCatcher003 through GSG-linker. The Nco I base recognition site was added to the N-terminus of each sequence and the corresponding protective base was added. To prevent frameshift mutation, GC was added after the Nco I base site so that the correctness of the target sequence would not be affected after enzyme cleavage; 6× histidine tags (histidine, His-tag) were exogenously added to the C-terminus of all protein sequences for protein purification; a stop codon and an Xho I restriction site were added to the C-terminus of each sequence; to ensure the rigidity and flexibility of the fusion protein structure, each subcomponent was connected with GSG-linker. The target sequence (as shown in SEQ ID NO.1) was inserted between the Nco I and Xho I multiple cloning sites of the pET-28a vector to obtain the pET-28a-SpyCatcher003-Fer plasmid vector.

[0039] The basic skeleton of the eukaryotic expression vector of the present invention includes a pcDNA3.4 vector; the eukaryotic cell includes a HEK293F cell. As a specific embodiment, the TB10.4 sequence (GenBank: NP_214802) is obtained from the website www.ncbi.nlm.nih.gov, and the C-terminus is connected to SpyTag003 through a GSG-linker. In order to promote protein secretion and exert correct biological functions, a signal peptide is added to the N-terminus of the sequence, and a 6×His-Tag is fused and expressed at the C-terminus. After codon optimization according to the mammalian protein expression system, the target sequence (as shown in SEQ ID NO.2) is sent to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis, and the target sequence is inserted between the EcoR I and BamH I multiple cloning sites of the eukaryotic expression vector pcDNA3.4 (Nanjing Zhongding Biotechnology Co., Ltd.) to construct a recombinant pcDNA3.4-SpyTag003-TB10.4 vector.

[0040] The molar ratio of the SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein of the present invention is 1:4-8. In a specific embodiment, the molar ratio can be 1:4, 1:5, 1:6, 1:7 or 1:8. As a specific embodiment, SpyCatcher003-Fer and SpyTag003-TB10.4 are incubated at different molar ratios to perform an in vitro coupling reaction. When the ratio is 1:6, the remaining amount of unconnected SpyCatcher003-Fer is the least, indicating that the molar ratio of 1:6 is a suitable molar ratio for constructing TB10.4 conjugated Fer.

[0041] The incubation temperature of the present invention is 2-6°C, and the incubation time is 10-14h. In a specific embodiment, the incubation temperature can be 2°C, 3°C, 4°C, 5°C or 6°C; in a specific embodiment, the incubation time can be 10h, 11h, 12h, 13h or 14h.

[0042] The incubation buffer of the present invention is 10mM Na 2 HPO 4 , 2mM KH 2 PO 4 , 136 mM NaCl and 2.6 mM KCl.

[0043] The present invention also provides the use of the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method in the preparation of tuberculosis vaccine. The present invention selects TB10.4 in the non-RD region shared with BCG as a target, and compared with the BCG vaccine using the RD region antigen as a target, it has the prospect of being applied to immunodeficient people.

[0044] As a specific embodiment, the present invention fuses Fer and monomeric antigen TB10.4 into the SpyCatcher003 / SpyTag003 coupling system, successfully expresses and purifies the corresponding soluble proteins using prokaryotic and eukaryotic expression systems, respectively, and successfully self-assembles into nanoparticles in a suitable buffer environment in vitro, preliminarily verifying that SpyCatcher003 / SpyTag003 is compatible with TB antigens, and this ability has application prospects for the development of new TB candidate vaccines.

[0045] As a specific embodiment, mice immunized with SFT showed strong immunogenicity, especially in inducing IFN-γ + / IL-2 +In terms of T cell and TB-related cytokine secretion, it showed significant advantages over monomeric antigens and no less than BCG. Therefore, SFT can mimic the immune protection effect similar to BCG, and the ability of SpyCatcher003 / SpyTag003 to be compatible with TB antigens, which was initially verified in this study, is promising for the development of new tuberculosis candidate vaccines.

[0046] The present invention also provides a tuberculosis vaccine, which comprises the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method.

[0047] As a specific embodiment, the present invention verifies the ability of SFT to promote lymphocyte proliferation. Compared with the TB10.4 monomeric antigen, SFT after Fer polymerization exhibits strong immunogenicity. In addition to inducing the most important Th1 type response, SFT also has the ability to efficiently induce IL-17. Regardless of whether specific antigen stimulation is used, this ability is significantly better than BCG and monomeric antigens. In the absence of antigen stimulation, SFT can still enhance the potential for Th1 cytokine mRNA expression.

[0048] The use concentration of the tuberculosis vaccine of the present invention is 0.1 mg / mL, and the dosage of the tuberculosis vaccine is 150-250 μL / 20g. In a specific embodiment, the dosage of the tuberculosis vaccine can be 150 μL / 20g, 155 μL / 20g, 160 μL / 20g, 165 μL / 20g, 170 μL / 20g, 175 μL / 20g, 180 μL / 20g , 185μL / 20g, 190μL / 20g, 195μL / 20g, 200μL / 20g, 205μL / 20g, 210μL / 20g, 215μL / 20g, 220μL / 20g, 225μL / 20g, 230μL / 20g, 235μL / 20g, 240μL / 20g, 245μL / 20g or 250μL / 20g.

[0049] As a specific embodiment, the safety of SFT was evaluated by HE staining, and the results showed that recombinant SFT did not cause systemic symptoms and toxic reactions of important organs in mice, confirming that SFT has good safety or tolerability in mice at this dose and in the context of a given immunization program.

[0050] In order to further illustrate the present invention, a self-assembled ferritin nanoparticle recombinant protein SFT and its preparation method and application provided by the present invention are described in detail below in conjunction with examples, but they should not be construed as limiting the scope of protection of the present invention.

[0051] Unless otherwise specified, the present invention has no special requirements for the preparation raw materials, and commercially available products known to those skilled in the art can be used.

[0052] The data in the examples are expressed as mean ± standard deviation (SD). Statistical analysis was performed using Tukey's multiple comparison test in SPSS Version 29.0. Data were visualized in GraphPad Prism software (version 9.0). Each group was compared pairwise. P<0.05 was considered statistically significant (****P<0.0001, ***P<0.001, **P<0.01, *P<0.05).

[0053] Example 1 Construction, expression and purification of recombinant vector

[0054] The antigen TB10.4 in the non-RD region common to BCG and Mtb (Mycobacterium tuberculosis) is selected as the target of the vaccine. The present invention needs to construct two prokaryotic expression plasmids pET-28a-SpyCatcher003-Fer (pET-28a-Fer), pET-28a-TB10.4 and a eukaryotic expression plasmid pcDNA3.4-SpyTag003-TB10.4 (pcDNA3.4-ST). Figure 2 Schematic diagram of expression plasmid. In order to effectively secrete the TB10.4 antigen in the nanoparticles in the eukaryotic system, the present invention introduces a signal peptide ( Figure 2 After the NPs gene (i.e., Ferritin or Fer) is coupled to SpyCatcher003, it is fused to the His-tag via the GSG linker ( Figure 2 (middle B).

[0055] 1. Construction, expression and purification of recombinant pET-28a-SpyCatcher003-Fer vector

[0056] For the prokaryotic expression plasmid, the plasmid used was the high-copy vector pET-28a (Kelei Biotechnology Co., Ltd.; KL-ZL-0061) of the prokaryotic expression system in genetic engineering, and Nco I and Xho I were selected as restriction sites. The Ferritin (GenBank: NP_223316) sequence was obtained from the www.ncbi.nlm.nih.gov website, and the N-terminus was connected to SyCatcher003 through GSG-linker ( Figure 2In B), the Nco I base recognition site is added to the N-terminus of each sequence and the corresponding protective base is added. To prevent frameshift mutations, GC is added after the Nco I base site so that the correctness of the target sequence is not affected after enzyme cleavage; a 6× histidine tag (histidine, His-tag) is exogenously added to the C-terminus of all protein sequences to facilitate protein purification; a stop codon and an Xho I restriction site are added to the C-terminus of each sequence; to ensure the rigidity and flexibility of the fusion protein structure, each subcomponent is connected with a GSG-linker. The target sequence (as shown in SEQ ID NO.1) was codon-optimized and sent to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis. The target sequence was inserted between the Nco I and Xho I multiple cloning sites of the pET-28a vector to obtain the pET-28a-SpyCatcher003-Fer plasmid vector.

[0057] The pET-28a-SpyCatcher003-Fer plasmid vector was transformed into the competent strain of Escherichia coli BL21 (DE3) and cultured at 37°C for 16 h. The positive strain was placed in 600 mL LB liquid medium with 50 μg / mL kanamycin and cultured on a constant temperature shaker at 37°C until OD 600 0.8. Add 0.2 mM isopropyl-β-D-1-thiogalactoside (IPTG) to the culture medium, incubate overnight at 16°C, collect the induced bacterial culture, and lyse the cells by ultrasonication. After centrifugation, load the supernatant into a nickel-nitrotriacetic acid (Ni-NTA)-Sepharose CI-6B affinity chromatography column, pre-equilibrated with Ni-NTA binding buffer. Wash with Ni-NTA binding wash buffer (20 mM Tris-HCl, 30 mM imidazole, 0.15 M NaCl, pH 8.0) to OD 280 When the baseline value is reached, the target protein is slowly eluted with Ni-IDA elution buffer (20 mM Tris-HCl, 250 mM imidazole, 0.15 M NaCl, pH 8.0), and the effluent is collected. The collected protein is added to a dialysis bag and dialyzed against phosphate buffered saline (PBS) overnight to obtain SpyCatcher003-Fer protein.

[0058] 2. Construction, expression and purification of recombinant pcDNA3.4-SpyTag003-TB10.4 vector

[0059] The TB10.4 sequence (GenBank: NP_214802) was obtained from www.ncbi.nlm.nih.gov and the C-terminus was linked to SpyTag003 via GSG-linker ( Figure 2In Figure A), in order to promote protein secretion and exert correct biological functions, a signal peptide was added to the N-terminus of the sequence, and 6×His-Tag was fused and expressed at the C-terminus. After codon optimization according to the mammalian protein expression system, the target sequence (as shown in SEQ ID NO.2) was sent to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis, and the target sequence was inserted between the EcoR I and BamH I multiple cloning sites of the eukaryotic expression vector pcDNA3.4 (Wenzhou Kemiao Biotechnology Co., Ltd.; KM107057) to construct a recombinant pcDNA3.4-SpyTag003-TB10.4 vector.

[0060] To express and purify SpyTag003-TB10.4, HEK293F cells (ATCC Cell Resource Center; CRL1573) were cultured to 2 × 10 6 cells / mL, the cell survival rate was greater than 95%. 6 Add 3 μg of polyethyleneimine (PEI) to the cell density of 1.5 cells / mL (Polysciences, USA), and then add RPMI-1640 medium containing 10% FBS and 10% 100× double antibody by volume, and transiently transfect 1 μg recombinant pcDNA3.4-SpyTag003-TB10.4 expression plasmid. After 6 days of culture, centrifuge at 5000g and 4°C for 15 minutes, resuspend the cells with lysis buffer (50mM Tris, 300mM NaCl, 20mM Imidazole, pH 8.0) and ultrasonically disrupt them, and collect the precipitate by centrifugation at 12000r / min for 15 minutes. Resuspend the cells with lysis buffer (50mM Tris, 300mM NaCl, 20mM Imidazole, pH 8.0) and ultrasonically disrupt them again, and collect the supernatant by centrifugation at 12000r / min for 15 minutes. Using a low-pressure chromatography system, the supernatant or the mixed system after incubation with the Ni column is slowly added to the purification column. Balance Ni-NTAHis-BindResin with Balance Buffer (50 mM Tris, 300 mM NaCl, 20 mM Imidazole, pH 8.0) at a flow rate of 0.5 mL / min until the OD of the effluent reaches 280The target protein was eluted with Washing Buffer (50 mM imidazole, 50 mM Tris, 300 mM NaCl, pH 8.0) and Elution Buffer (500 mM imidazole, 50 mM Tris, 300 mM NaCl, pH 8.0) at a flow rate of 1 mL / min to obtain SpyTag003-TB10.4 protein, which was collected and stored at -20°C.

[0061] 3. Construction, expression and purification of recombinant pET-28a-TB10.4 vector

[0062] After the pET28a vector was double-digested with Nco I / Xho I to become a linear vector, TB10.4 was connected to the linear pET28a by DNA ligase to form a recombinant plasmid; the construction method and expression purification were the same as "1. Construction, expression and purification of recombinant pET-28a-SpyCatcher003-Fer vector" in Example 1, and the TB10.4 protein was obtained after purification.

[0063] Example 2 Construction and characterization of the ratio of SpyCatcher003-Fer / SpyTag003-TB10.4

[0064] SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein were incubated in vitro at a molar ratio of 0:1, 1:0, 1:2, 1:4, 1:6, 1:8 and 1:10 at 4°C for 12 h (the incubation buffer was 10 mM Na 2 HPO 4 , 2mM KH 2 PO 4 , 136mM NaCl and 2.6mM KCl); take out the samples incubated at each ratio and centrifuge them at 4°C, 12000r / min for 15min, collect the supernatant; perform SDS-PAGE analysis and Coomassie Brilliant Blue staining on each sample to determine the optimal coupling ratio. At the same time, TEM and DLS were used to observe and detect the morphology and particle size distribution of the self-assembled nanoparticles. The protein obtained after self-assembly is the self-assembled ferritin nanoparticle tuberculosis vaccine (SFT).

[0065] SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein were incubated overnight at different molar ratios for in vitro coupling reaction. That is, SpyTag003-TB10.4 protein was incorporated into SpyCatcher003-Fer protein, as shown by a single band on the SDS-PAGE gel. Results ( Figure 3Figure A) shows that when the ratio is 1:6, the remaining amount of SpyCatcher003-Fer that is not connected to the SpyTag003-TB10.4 protein is the least, indicating that this ratio is a suitable molar ratio for constructing TB10.4-conjugated Fer. The morphology and size of SpyCatcher003-Fer protein and SFT (molar ratio of 1:6) were then analyzed by transmission electron microscopy (TEM) and DLS. Microscopic images showed that the two nanoparticles were uniformly dispersed and had the same morphology ( Figure 3 The size distribution of nanoparticles was measured by DLS ( Figure 3 D, SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein) confirmed that the size of the nanoparticles was uniform, and the corresponding diameters are listed in Figure 3 Middle E (TB10.4 protein, SpyCatcher003-Fer protein, SpyTag003-TB10.4 protein and SFT (molar ratio of 1:6) protein).

[0066] Example 3 Mouse immunization protocol

[0067] The animals used in this study were C57BL / 6 mice (6-8 weeks old, weighing 18-20 g, purchased from Jiangsu Jicui Pharmaceutical Co., Ltd.), and the mice were randomly divided into cages. The mice were placed in individual ventilated cages with an ambient temperature of 22-25°C, a relative humidity of 45%-65%, and a light / dark cycle of 12h / 12h. The animals were free to eat and drink throughout the experiment. The animal experiments involved in this invention were approved by the Animal Ethics Committee of Bengbu Medical University (Approval No.: Animal Ethics 2024502).

[0068] The mice were acclimated for one week before the experiment. SPF-grade C57BL / 6 female mice were randomly divided into 4 groups (6 mice in each group). All mice were injected subcutaneously in the neck. Commercial BCG dry powder (Shanghai Ruichu Biotechnology Co., Ltd.; R19023) was diluted to 10% with sterile saline. 4CFU / μL; before each immunization, the recombinant protein (SpyCatcher003-Fer protein, TB10.4 protein or SFT protein) was diluted to 0.1 mg / mL with sterile fresh PBS as needed; all mice were injected subcutaneously in the neck with 200 μL of immunogen (i.e. BCG dry powder or recombinant protein). The Fer group and the BCG group were injected only once at the beginning of the experiment, i.e. the Fer group was injected with diluted SpyCatcher003-Fer protein only at week 0, and the BCG group was injected with diluted BCG only at week 0; the TB10.4 group and the SFT group adopted the "homologous enhancement immunization" strategy of recombinant protein, i.e. the TB10.4 group was injected with diluted TB10.4 protein at weeks 0, 2, and 4, and the SFT group was injected with diluted SFT (molar ratio 1:6) protein at weeks 0, 2, and 4, and the immunogenicity was determined at week 6.

[0069] Example 4 Lymphocyte proliferation assay

[0070] The mice treated in Example 3 were euthanized 42 days after the first inoculation, and the spleens were collected aseptically to isolate the mouse spleen lymphocytes. The isolated spleen lymphocytes were diluted to 3×10 in RPMI-1640 medium containing 10% fetal bovine serum. 6 cells / mL, and 2×10 5 Cells / well were inoculated into 96-well plates, and 10 μL of TB10.4, PPD (PPD purchased from Harbin Pharmaceutical Bio-Vaccine, veterinary medicine 080078097) or ConA (Shanghai Maokang Biotechnology Co., Ltd.; MP6306) were added for stimulation. The stimulated cells were incubated at 37°C and 5% CO 2 Incubate in an incubator for 48 h, detect using a cell proliferation detection kit (Promega; G3582), and then continue to culture for 4 h. Read the OD within 10 min after the end of incubation. 490 SI is used to represent the proliferation response of individual mouse spleen lymphocytes: SI = (average OD of stimulation wells 490 Value - Average OD of blank control wells 490 value) / (mean OD of negative control wells 490 Value - Average OD of blank control wells 490 value).

[0071] The level of lymphocyte proliferation is an important indicator for the preliminary evaluation of cellular immunity, so the ability of SFT to promote cell proliferation was verified. The results showed that all groups showed similar trends regardless of the antigen stimulation. The Fer group showed the lowest proliferation ability. The cell proliferation level of the SFT immunized group after receiving antigen stimulation again was significantly higher than that of mice injected with only monomeric antigen TB10.4. The BCG group also acquired a proliferation ability comparable to that of Fer ( Figure 4 and Table 1). This also shows that although TB10.4 is a single antigen, after being coupled with SpyCatcher-Fer / SpyTag, it has the ability to stimulate cell proliferation similar to the most classic BCG.

[0072] Table 1 Lymphocyte proliferation test results

[0073]

[0074] Example 5 Flow cytometric analysis

[0075] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse spleen lymphocytes. 6 Cells / well were inoculated in a 24-well plate and incubated at 37°C and 5% CO with a final concentration of 15 μg / mL TB10.4 recombinant protein. 2 Incubate for 16 hours, add monensin at a final concentration of 1μL / well for 5 hours to block the secretion of cytokines to the extracellular space. Collect cells by centrifugation, wash with pre-cooled PBS, block Fc receptors with 1μL TruStain FcXTM PLUS labeled anti-mouse CD16 / 32 monoclonal antibody; use 2μL FITC labeled anti-mouse CD3ε, 1.5μL PE labeled anti-mouse CD4 and 1.5μL APC / FireTM 750 labeled anti-mouse CD8α mAb for surface staining; fix with FluoroFixTM Buffer, permeabilize the cell membrane with PermWashBuffer, and use 5μL APC anti-mouse IFN-γ, 1.5μL PE / Cy7 anti-mouse TNF-α and 1μL BrailiantViolet 421 anti-mouse IL-2 mAb for intracellular staining. Subsequently, wash the cells with PBS and resuspend them in FACS buffer. Use DxPAthena TM Flow cytometry was used for detection. Flowjo software was used to analyze antigen-specific CD4 + / 8 + IFN-γ + / TNF-α + / IL-2 + T cell frequency.

[0076] In order to further reflect the activation level of T lymphocytes and clarify the source of anti-tuberculosis factors, flow cytometry was used to analyze the CD4 + / CD8 + IFN-γ + / IL-2 + / TNF-α + T cells. Figure 5 , Figure 6 As shown in Tables 2 and 3, compared with the other three groups, TB10.4 nanoantigen induced the highest level of CD4 + / CD8 + IFN-γ + T cells, even in BCG, a small number of IFN-γ effector T cells were observed ( Figure 5 Middle A and Figure 6 (A) It is noteworthy that BCG has a significant effect on inducing both CD4 + T or CD8 + T cells showed the strongest ability to secrete TNF-α ( Figure 5 Medium B and Figure 6 (B) After antigen stimulation, the induction of CD4 + IL-2 + T cell capacity ( Figure 5 C) and trend with CD8 + IFN-γ + T cells are similar ( Figure 6 Middle A). Compared with other types of effector T cells, CD8 + IL-2 + The proportion of T cells was the lowest, and the negative group showed a higher secretion frequency similar to that of the BCG and TB10.4 groups, while SFT still maintained a relative peak value ( Figure 6 In conclusion, under a given immune background, BCG, as a widely recognized tuberculosis vaccine, showed the best effect in inducing cell secretion of TNF-α. However, regarding the frequency of other effector T cells, the induction efficiency of SFT was stronger than that of BCG. At the same time, the ability of the SFT immunization group to activate T cells to produce Th1-type cytokines after specific induction was significantly stronger than that of common subunit proteins. This advantage may be due to the fact that the traditional tuberculosis antigens were self-assembled into nanoparticles through the SpyCatcher / SpyTag system via Fer, which enhanced the immunogenicity of the monomeric antigens.

[0077] Table 2CD4 + IFN-γ + T, CD4 + TNF-α + T and CD4 + IL-2 + T cell test results

[0078]

[0079] Table 3CD8 + IFN-γ + T, CD8 + TNF-α +T and CD8 + IL-2 + T cell test results

[0080]

[0081]

[0082] Example 6 ELISpot assay

[0083] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse splenic lymphocytes. The number of antigen-specific immune cells secreting IFN-γ was detected using a commercial mouse IFN-γ pre-coated ELISPOT kit (Beijing Dakoway Biotechnology Co., Ltd.; DKW22-1000-096). First, the PVDF membrane was activated with a universal serum-free medium (Dakoway's ELISpot dedicated serum-free medium), and then 3×10 6 Cells were stimulated with recombinant TB10.4 or PPD at a final concentration of 15 μg / mL for 16 h. Untreated cell suspension was used as a negative control, and a mixture containing 500 ng / mL PMA (Sigma; P1585) and 10 ng / mL ionomycin (Beijing Dakoway Biotechnology Co., Ltd.; DKW-ST-PI) was used as a positive control. ELISpot plates were incubated at 37°C and 5% CO 2 The cells were incubated in the presence of 5% paraformaldehyde and then incubated in an environment for 16 h. The cells were then operated according to the instructions and the spot forming cells (SFC) secreting antigen-specific IFN-γ were observed. Finally, the number of SFCs was counted using an IRISTM ELISpot plate reader.

[0084] In addition to functional T cells, the role of multiple cytokines in TB immunity is also crucial. The results of ELISpot detection showed that only a minimum number of cells was observed in the Fer group, regardless of whether specific antigens were used as stimulants. When PPD was used as a stimulus, the TB10.4 monomer antigen immunization group obtained a larger number of spots, although there was no significant difference between the groups. Under the specific TB10.4 stimulation, the spots formed by the spleen cells of mice in the SFT vaccine group were generally higher than those in the BCG group, while the TB10.4 group had only a weak reaction. The classic advantages of BCG are self-evident. Compared with the TB10.4 monomer antigen, SFT after Fer polymerization has shown strong immunogenicity ( Figure 7 and Table 4).

[0085] Table 4 Statistical analysis of IFN-γ secretion of mouse spleen cells stimulated by TB10.4 and PPD respectively detected by ELISpot

[0086]

[0087]

[0088] Example 7 ELISA

[0089] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse splenic lymphocytes. The secretion levels of various TB-related cytokines in the culture supernatant of mouse splenic lymphocytes were detected using a commercial ELISA detection kit. 3×10 6 cells / well and 20 μL 15 μg / mL TB10.4 recombinant protein or 20 μL 15 μg / mL PPD at 37°C and 5% CO 2 Incubate for 24 h to detect IL-2, and incubate for 48 h to detect the secretion levels of IFN-γ, TNF-α, IL-4, IL-12, and IL-17. After the culture, the cell culture supernatant was collected and tested using a commercial ELISA kit (Jianglai Biotechnology; catalog numbers are JLW10967, JL10208, JL20266, JL20246, and JL20250). Within the first 15 min after the color development reaction, the OD was detected using a SpectraMax Mini microplate reader. 450 , and analyze the secretion levels of various cytokines.

[0090] In order to fully verify the ability of spleen lymphocytes of each group of mice to secrete TB immune-related cytokines under antigen stimulation, the present invention detected the secretion levels of multiple cytokines in the cell culture supernatant. The study found that when stimulated with specific antigens, the IFN-γ detected in the TB10.4 immune group was significantly higher than that in the BCG group, but contrary to the results detected by flow cytometry ( Figure 8 A and Table 5), which may be due to the quantification of IFN-γ derived from other cells. The concentrations of TNF-α and IL-2 in the supernatant of each group were basically consistent with the frequency of T cell-induced secretion ( Figure 8 Table B, Table 6 and Figure 8C, Table 7). This shows that on the one hand, when the body encounters tuberculosis antigen stimulation again, TNF-α mainly comes from T cells. On the other hand, it also confirms that BCG is the main motive for inducing the production of TNF-α. It also proves again that with the help of nanoparticle antigens, a stronger Th1-type immune response dominated by IFN-γ and IL-2 can be stimulated. IL-12 is a determining factor in the Th1 cell immune response and plays an important role in the immune response to tuberculosis. It participates in the establishment and maintenance of anti-tuberculosis immune response in many ways, such as regulating the Th1 / Th2 balance, inducing the production of IFN-γ, and promoting the differentiation of Th1 cells. The research of the present invention confirms this classic view. The secretion of IL-12 is similar to the production of Th1 cytokines. Nano TB10.4 antigen significantly enhances the immunogenicity of traditional antigens and promotes IFN secretion. IL-12 and IFN complement each other, making up for the disadvantage of monomeric antigens that are not as good as BCG to the greatest extent, and strengthening the ability of Th cells to polarize to Th1 cells ( Figure 8 E and Table 9). In addition, IL-4, a representative indicator of Th2 immune response, is considered to be an unfavorable factor in tuberculosis treatment. Only basal secretion of IL-4 was observed in all groups. Therefore, in terms of immunogenicity, the nanoparticles do not suppress Th1 responses by secreting IL-4 ( Figure 8 D and Table 8). Equally important, IL-17 plays a major role in the early stages of tuberculosis, however, the physiological significance of IL-17 is often overlooked in many vaccine immunological evaluations. The results showed that SFT, in addition to inducing the most important Th1 response, also has the ability to efficiently induce IL-17, which is significantly better than BCG and monomeric antigens ( Figure 8 F and Table 10).

[0091] Table 5 IFN-γ secretion expression level

[0092]

[0093]

[0094] Table 6 TNF-α secretion expression level

[0095]

[0096] Table 7 IL-2 secretion expression level

[0097]

[0098] Table 8 IL-4 secretion expression level

[0099]

[0100]

[0101] Table 9 IL-12 secretion expression level

[0102]

[0103] Table 10 IL-17 secretion expression level

[0104]

[0105] Example 8 Real-time fluorescence quantitative PCR

[0106] The mice treated in Example 3 were taken and the number of cells extracted by TRIzol was 10 7 The total RNA was analyzed by Nanodrop UV analyzer according to OD 260 / 280 and OD 260 / 230 Check the concentration and purity of RNA. One-Step gDNA Removal and cDNA Synthesis SuperMix (Full Gold; AE341-02) was used for cDNA synthesis; Green qPCR SuperMix (Full Gold; AQ601-01-V2) was used to perform qPCR to assess the transcription levels of cytokines IFN-γ, TNF-α, IL-2, and IL-17. The primer sequences are shown in Tables 11, 2 -ΔΔCT Methods The mRNA expression level was calculated.

[0107] Table 11 Primer sequences

[0108]

[0109]

[0110] At the same time, in order to understand the gene expression of cytokines, it is necessary to observe the mRNA transcription of IFN-γ, TNF-α, IL-2 and IL-17 when evaluating candidate vaccines, which provides a new perspective for evaluating the immunogenicity of candidate vaccines ( Fig. 9 In this study, the transcription of several cytokines was evaluated. Before specific stimulation with TB10.4, very similar transcriptional expression was observed in the BCG and SFT groups for TNF-α. For IFN-γ, IL-2, and IL-17, the SFT group had a significantly higher maximum transcriptional level than the other groups ( Fig. 9 and Table 12). Therefore, SFT may still have the potential to contribute to enhancing Th1 cytokine mRNA expression in the absence of antigen stimulation.

[0111] Table 12 IFN-γ, TNF-α, IL-2 and IL-17 transcriptional expression levels

[0112]

[0113]

[0114] Example 9 H&E staining

[0115] The hearts, livers, spleens, lungs, and kidneys of mice treated in Example 3 and first vaccinated 42 days later were fixed with 4% paraformaldehyde, dehydrated with gradient ethanol at different concentrations, embedded in paraffin, and uniformly cut into 6 μm slices. H&E staining was performed to evaluate the safety of the ferritin vaccine.

[0116] Embedding: Add liquid paraffin to the mold, place the tissue sample to be embedded in the paraffin, and ensure that the tissue is positioned regularly. Add a small amount of liquid paraffin, cool it down and freeze it to make it solid;

[0117] Section: 5 μm thickness; place the tissue sections on a glass slide and soak them in 37°C saline;

[0118] Dewaxing: Soak the tissue sample slices in xylene for 10 minutes, then replace with xylene and continue soaking for 10 minutes;

[0119] Hydration: Soak the tissue sample soaked in xylene in anhydrous ethanol for 5 minutes; then soak it in 95%, 85%, and 70% ethanol for 5 minutes each;

[0120] Hematoxylin staining, differentiation and anti-blueing: Soak the sections of the hydrated tissue samples in PBS solution for 5 minutes each time and wash 3 times; add 100μL of hematoxylin staining solution to each tissue section and stain for 10 minutes. Wash away the excess stain with distilled water, use 1% hydrochloric acid ethanol for differentiation, remove the excess stain, and rinse the tissue sections with double distilled water. Add the blueing solution to the tissue sections, wash with clean water after the anti-blueing is completed, and then wash with double distilled water;

[0121] Eosin staining and dehydration: Eosin was added to the sections and stained for 3 min, and then gradient dehydration was performed using 80%, 95% and anhydrous ethanol (80% ethanol dehydration for 5 s, 95% ethanol dehydration for 2 min, and anhydrous ethanol dehydration for 2 min).

[0122] Air-drying and sealing: Soak the dehydrated sections in xylene twice, 5 min each time, then air-dry the tissue sample sections and seal them with neutral gum; observe and take pictures under a microscope.

[0123] In order to verify whether SFT would cause drug-induced damage to important organs, the behavioral activities of mice were closely observed before and after vaccination, and the hearts, livers, spleens, lungs, and kidneys of mice in each group were removed after euthanasia after two rounds of immunization for pathological HE staining sections. No inflammatory reaction was observed at the injection site and its surroundings. During the entire experiment, all mice had normal breathing, eating, and drinking conditions, and their hair was in good condition. Therefore, the vaccine did not cause systemic adverse reactions in mice. After the experiment, the gross condition and pathological sections of each organ were observed continuously and carefully. The morphology of each organ was generally normal. Microscopy showed that the number, morphology, and structure of cells in each organ were normal, and there was no obvious inflammatory cell infiltration ( Fig.10 ). These results preliminarily indicate that recombinant SFT did not cause systemic symptoms and toxic reactions to important organs in mice, confirming that SFT has good safety or tolerability in mice at this dose and in the context of a given immunization program.

[0124] It can be seen that the present invention uses the SpyCatcher / SpyTag coupling system and self-assembled ferritin nanoparticles to prepare a tuberculosis vaccine targeting the non-RD region antigen TB10.4. The vaccine (SFT) consists of two parts, the SpyCatcher003-Fer vector and the SpyTag003-TB10.4, which are expressed in prokaryotic and eukaryotic systems, respectively, and the two are self-assembled in vitro into a tuberculosis nano vaccine candidate SFT. Compared with monomeric TB10.4, subcutaneous immunization of SFT without the aid of an adjuvant significantly increased the level of cell proliferation, and had the ability to induce T cell activation and stimulate a variety of TB-related cytokines, indicating that SFT's ability in all aspects is not inferior to or better than BCG. These results show that SFT is significantly superior to traditional recombinant proteins and may be able to simulate an immune protection effect similar to that of BCG in the future.

[0125] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A self-assembled ferritin nanoparticle recombinant protein SFT, characterized in that: The recombinant protein SFT is self-assembled by SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein; The nucleotide sequence encoding the SpyCatcher003-Fer protein is shown in SEQ ID NO.1; the nucleotide sequence encoding the SpyTag003-TB10.4 protein is shown in SEQ ID NO.

2.

2. The method for preparing the recombinant protein SFT according to claim 1, characterized in that: The following steps are involved: Inserting the SpyCatcher003-Fer fragment into a prokaryotic expression vector to obtain a prokaryotic recombinant expression vector, and expressing the prokaryotic recombinant expression vector in a prokaryotic cell to obtain a SpyCatcher003-Fer protein; the nucleotide sequence of the SpyCatcher003-Fer fragment is shown in SEQ ID NO.1; Inserting the SpyTag003-TB10.4 fragment into a eukaryotic expression vector to obtain a eukaryotic recombinant expression vector, and expressing the eukaryotic recombinant expression vector in a eukaryotic cell to obtain a SpyTag003-TB10.4 protein; the nucleotide sequence of the SpyTag003-TB10.4 fragment is shown in SEQ ID NO.2; The SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein are incubated to obtain the self-assembled ferritin nanoparticle recombinant protein SFT.

3. The preparation method according to claim 2, characterized in that: The basic skeleton of the prokaryotic expression vector includes a pET-28a vector, and the prokaryotic cell includes Escherichia coli BL21.

4. The preparation method according to claim 2, characterized in that: The basic skeleton of the eukaryotic expression vector includes a pcDNA3.4 vector, and the eukaryotic cell includes a HEK293F cell.

5. The preparation method according to claim 2, characterized in that: During the incubation, the molar ratio of the SpyCatcher003-Fer protein to the SpyTag003-TB10.4 protein is 1:4-8.

6. The preparation method according to claim 5, characterized in that: The incubation temperature is 2-6° C., and the incubation time is 10-14 hours.

7. The preparation method according to claim 5 or 6, characterized in that: The incubation buffer was 10 mM Na2HPO4, 2 mM KH2PO4, 136 mM NaCl and 2.6 mM KCl.

8. Use of the self-assembled ferritin nanoparticle recombinant protein SFT according to claim 1 or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method according to any one of claims 2 to 7 in the preparation of tuberculosis vaccine.

9. A tuberculosis vaccine, characterized in that: The tuberculosis vaccine comprises the self-assembled ferritin nanoparticle recombinant protein SFT according to claim 1 or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method according to any one of claims 2 to 7.

10. The tuberculosis vaccine according to claim 9, characterized in that The tuberculosis vaccine is used at a concentration of 0.1 mg / mL, and the dosage of the tuberculosis vaccine is 150 to 250 μL / 20 g.

Images