A self-assembled ferritin nanoparticle recombinant protein SFT and its preparation method and application

Abstract

The present invention belongs to the field of vaccine technology, and specifically relates to a self-assembled ferritin nanoparticle recombinant protein SFT, a preparation method thereof, and an application thereof. The recombinant protein SFT is self-assembled from the SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein. The tuberculosis vaccine prepared using the self-assembled ferritin nanoparticle recombinant protein SFT of the present invention, compared with monomeric TB10.4, significantly increased the level of lymphocyte proliferation after subcutaneous immunization with SFT without the aid of an adjuvant, and has the ability to induce T cell activation and can stimulate a variety of TB-related cytokines. These results show that SFT is significantly superior to traditional recombinant proteins and vaccines, which helps to broaden the types of new tuberculosis candidate vaccines and provide a nanoparticle capture platform for other tuberculosis antigens in the future.

Description

Technical Field

[0001] The present invention belongs to the technical field of vaccines, and in particular relates to a self-assembled ferritin nanoparticle recombinant protein SFT, a preparation method thereof, and an application thereof. Background Art

[0002] As the oldest vaccine, Bacillus Calmette-Guérin (BCG) continues to play a significant role in tuberculosis (TB) vaccination. While BCG demonstrates superior protection in adolescents without immunodeficiency, it's important to consider that BCG's immune effects gradually diminish with age. More importantly, BCG, essentially a live attenuated vaccine, can be devastating for immunocompromised individuals. For those with impaired innate immune systems, BCG vaccination carries a high risk of developing BCG-disseminated disease, which is difficult to cure and can even lead to a high mortality rate. This dilemma significantly limits BCG's use in these populations, where tuberculosis (TB) is a major complication and cause of death. Furthermore, even though Mycobacterium bovis loses some of its dangerous virulence factors during passage, administering BCG to neonates or HIV patients with impaired innate immune systems can be fatal. Using RD region antigens as supplemental BCG vaccine targets is a proven and effective mainstream strategy. However, given BCG's inapplicability to immunocompromised individuals, developing vaccines based on antigenic proteins present within the BCG genome is also a priority. Therefore, people are not optimistic about the BCG-style homologous boosting strategy, and there is an urgent need to develop a boosting vaccine with similar immunogenicity to BCG to provide a safer and more efficient new tuberculosis vaccine to turn the tide. Summary of the Invention

[0003] The present invention aims to provide a self-assembling ferritin nanoparticle recombinant protein (SFT), its preparation method, and its application. The recombinant protein SFT is significantly superior to the traditional BCG vaccine and has the potential to be applied to immunocompromised individuals.

[0004] The present invention provides a self-assembled ferritin nanoparticle recombinant protein SFT, wherein the recombinant protein SFT is self-assembled by SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein;

[0005] The nucleotide sequence encoding the SpyCatcher003-Fer protein is shown in SEQ ID NO.1; the nucleotide sequence encoding the SpyTag003-TB10.4 protein is shown in SEQ ID NO.2.

[0006] The present invention also provides a method for preparing the recombinant protein SFT, comprising the following steps:

[0007] Inserting the SpyCatcher003-Fer fragment into a prokaryotic expression vector to obtain a prokaryotic recombinant expression vector, and expressing the prokaryotic recombinant expression vector in prokaryotic cells to obtain the SpyCatcher003-Fer protein; the nucleotide sequence of the SpyCatcher003-Fer fragment is shown in SEQ ID NO.1;

[0008] The SpyTag003-TB10.4 fragment is inserted into a eukaryotic expression vector to obtain a eukaryotic recombinant expression vector, and the eukaryotic recombinant expression vector is expressed in eukaryotic cells to obtain the SpyTag003-TB10.4 protein; the nucleotide sequence of the SpyTag003-TB10.4 fragment is shown in SEQ ID NO.2;

[0009] The SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein are incubated to obtain the self-assembled ferritin nanoparticle recombinant protein SFT.

[0010] As a preferred embodiment, the basic skeleton of the prokaryotic expression vector includes a pET-28a vector, and the prokaryotic cell includes Escherichia coli BL21;

[0011] The basic skeleton of the eukaryotic expression vector includes a pcDNA3.4 vector, and the eukaryotic cells include HEK293F cells.

[0012] As a preferred embodiment, the molar ratio of the SpyCatcher003-Fer protein to the SpyTag003-TB10.4 protein is 1:4-8.

[0013] As a preferred embodiment, the incubation temperature is 2-6°C, and the incubation time is 10-14 hours.

[0014] As a preferred embodiment, the incubation buffer is 10 mM Na2HPO4, 2 mM KH2PO4, 136 mM NaCl and 2.6 mM KCl.

[0015] The present invention also provides the use of the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method in the preparation of tuberculosis vaccine.

[0016] The present invention also provides a tuberculosis vaccine, which comprises the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method.

[0017] As a preferred solution, the tuberculosis vaccine is used at a concentration of 0.1 mg / mL, and the dosage of the tuberculosis vaccine is 150-250 μL / 20 g.

[0018] Beneficial effects: The present invention provides a self-assembling ferritin nanoparticle recombinant protein SFT, which is self-assembled by SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein. The tuberculosis vaccine prepared by the self-assembling ferritin nanoparticle recombinant protein SFT of the present invention, compared with monomeric TB10.4, subcutaneous immunization of SFT without the aid of an adjuvant significantly increased the level of lymphocyte proliferation, and has the ability to induce T cell activation, and can stimulate a variety of TB-related cytokines. Studies have shown that SFT's capabilities in all aspects are not inferior to or better than BCG. These results show that SFT is significantly superior to traditional recombinant proteins. At the same time, the present invention selects TB10.4, which is a non-RD region shared with BCG, as a target. Compared with the BCG vaccine using the RD region antigen as a target, it has the prospect of application to immunocompromised people. This will help broaden the types of new tuberculosis candidate vaccines and provide a nanoparticle capture platform for other tuberculosis antigens in the future. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0020] Figure 1 Schematic diagram of the assembly of pyCatcher003-Fer protein and SpyTag003-TB10.4 protein;

[0021] Figure 2 Schematic diagram of the construction of the recombinant expression plasmid in Example 1; A is a schematic diagram of the SpyTag003-TB10.4 recombinant plasmid and protein sequence; B is a schematic diagram of the SpyCatcher003-Fer recombinant plasmid and nanocarrier protein sequence;

[0022] Figure 3 Preparation and immunogenicity analysis of the self-assembled ferritin nanoparticle tuberculosis vaccine in Example 2; A shows the coupling of SpyCatcher003-Fer and SpyTag003-TB10.4 at different ratios for 12 hours at 4°C; B shows TEM observation of SpyCatcher003-Fer; C shows TEM observation of SFT-NPs; D shows DLS analysis of the particle size distribution of SpyCatcher003-Fer and SFT-NPs; E shows the particle size of NPs and the molecular weight of each protein.

[0023] Figure 4The lymphocyte proliferation test results in Example 4;

[0024] Figure 5 The flow cytometry analysis of different immune group antigen-specific CD4 + T functional T cell frequency; A is CD4 + IFN-γ + T cell flow cytometry results; B is CD4 + IFN-γ + T cell detection results statistical chart; C is CD4 + TNF-α + T cell flow cytometry results; D is CD4 + TNF-α + T cell detection results statistical chart; E is CD4 + IL-2 + Tcells flow cytometry results; F is CD4 + IL-2 + Statistical chart of T cells detection results;

[0025] Figure 6 Flow cytometry analysis of different immune group antigen-specific CD8 + T functional T cell frequency; A is CD8 + IFN-γ + T cell flow cytometry results; B is CD8 + IFN-γ + T cell detection results statistical chart; C is CD8 + TNF-α + T cell flow cytometry results; D is CD8 + TNF-α + T cell detection results statistical chart; E is CD8 + IL-2 + Tcells flow cytometry results; F is CD8 + IL-2 + Statistical chart of T cells detection results;

[0026] Figure 7 The number of spot-forming cells (SFC) producing IFN-γ per million cells was determined by ELISpot in Example 6; A is a dot plot of IFN-γ secretion detected by ELISpot; B is a statistical analysis of IFN-γ secretion by mouse spleen cells stimulated by TB10.4 and PPD, respectively, by ELISpot;

[0027] Figure 8The tuberculosis-related cytokine secretion levels in Example 7; wherein A is the IFN-γ secretion expression level; B is the TNF-α secretion expression level; C is the IL-2 secretion expression level; D is the IL-4 secretion expression level; E is the IL-12 secretion expression level; and F is the IL-17 secretion expression level;

[0028] Figure 9 are the transcription levels of tuberculosis-related cytokines in Example 8; wherein A is the transcription expression level of IFN-γ; B is the transcription expression level of TNF-α; C is the transcription expression level of IL-2; and D is the transcription expression level of IL-17;

[0029] Figure 10 A preliminary evaluation of vaccine safety was performed using H&E staining as in Example 9 (scarbar, 50 μm). DETAILED DESCRIPTION

[0030] The present invention provides a self-assembled ferritin nanoparticle recombinant protein SFT. The recombinant protein SFT is self-assembled by SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein.

[0031] The Fer (NPs) in the present invention can highly polymerize the antigen and deliver it to immune cells. Compared with a single soluble antigen that is too small, the highly polymerized antigen nanoparticles are more easily recognized by cells and enter the draining lymph nodes to be taken up and presented by antigen-presenting cells, inducing a higher intensity immune response through the multiple epitope binding sites on the Fer surface. However, the nanoparticles obtained by chemical crosslinking are highly susceptible to the influence of chemical crosslinking agents, resulting in mismatching and uneven display of antigens on the carrier surface. The properties of the conjugated Fer obtained by fusing heterologous antigen genes to nanocarriers are often unstable. The present invention uses the SpyCatcher003 / SpyTag003 system, which can spontaneously and irreversibly form more highly stable isopeptide bonds in a commonly used protein buffer environment in vitro. This feature combines the stability of its own physical and chemical properties, the convenience of "plug and play", the polymerizability of nanocarriers, and the economy of genetic engineering, thereby greatly improving the connection efficiency and stability of the self-assembled ferritin nanoparticle recombinant protein SFT.

[0032] As a specific embodiment, the nucleotide sequence encoding the SpyCatcher003-Fer protein is shown in SEQ ID NO.1: 5'-ATGGGCCATCACCATCATCATCATGGCTCTTCCGTTACGACTTTGTCCGGTTTA AGCGGTGAGCAGGGCCCTAGTGGCGACATGACCACCGAAGAGGACAGTGCGACTCACATCAAATTCAGCAAGCGTGATGAAGACGGCCGCGAGTTGGCTGGCGCAACTATGGAGCTGCGCGACTCTTCCGGCAAAACCATCTCCACTTGGATTAGTGATGGTCATGTGAAAGACTTCTACTTGTACCCGGGCAAATACACGTTCGTTGAAACCGCGGCTCCTGACGGTTACGAAGTTGCTACCCCGATTGAGTTTACGGTCAATGAAGACGGCCAGGTTACCGTAGATGGTGAGGCAACCGAGGGTGACGCACATACTGGCGGCTCTGGTGGTAGTGGTGGCTCCGGCGGTAGCGAAAGTCAGGTGCGTCAGCAGTTTAGCAAAGACATTGAGAAGCTGTTGAATGAACAAGTTAACAAGGAGATGCAAAGCTCCAACTTGTATATGAGCATGAGTTCTTGGTGTTATACTCACAGTTTAGACGGCGCCGGCTTATTTTTATTTGATCACGCAGCGGAGGAATACGAACACGCTAAGAAGCTGATCATTTTCTTGAACGAGAACAATGTTCCAGTTCAATTGACGTCCATTTCCGCACCTGAGCACAAGTTCGAAGGTTTGACTCAGATTTTCCAAAAAGCATACGAACATGAGCAGCACATTTCCGAGTCCATTAACAATATTGTAGACCACGCCATTAAATCCAAGGATCATGCAACCTTCAACTTTTTACAGTGGTATGTCGCGGAGCAGCACGAAGAAGAAGTTTTGTTCAAAGATATCCTGGACAAAATTGAACTGATCGGCAACGAGAATCATGGTTTATACTTAGCGGACCAGTACGTAAAGGGTATTGCCAAAAGTCGCAAATCC-3'.

[0033] As a specific embodiment, the nucleotide sequence encoding the SpyTag003-TB10.4 protein is shown in SEQ ID NO.2: 5'-GCCACCATGAAGTGGGTCACCTTCATCAGCCTGCTGTTTCTGTTCAGCAGCGC CTACAGCATGTCCCAGATCATGTACAACTACCCCGCCATGCTGGGCCACGCCGGCGACATGGCCGGCTACGCCGGAACCCTGCAGAGCCTCGGCGCCGAGATCGCCGTGGAACAGGCTGCTCTGCAATCTGCCTGGCAGGGCGACACCGGCATCACCTACCAGGCTTGGCAGGCCCAGTGGAACCAGGCCATGGAAGAT CTGGTGCGGGCCTATCACGCCATGAGCTCTACACACGAGGCTAATACCATGGCCATGATGGCTAGAGATACAGCCGAGGCCGCCAAGTGGGGAGGCGGATCTGGCGGCAGCGGAGGCTCCGGCAGAGGCGTGCCTCACATCGTGATGGTGGACGCCTACAAAAGATACAAGGGCAGCCACCACCATCACCACCAC-3'.

[0034] The present invention also provides a method for preparing the recombinant protein SFT, comprising the following steps:

[0035] Inserting the SpyCatcher003-Fer fragment into a prokaryotic expression vector to obtain a prokaryotic recombinant expression vector, and expressing the prokaryotic recombinant expression vector in prokaryotic cells to obtain the SpyCatcher003-Fer protein; the nucleotide sequence of the SpyCatcher003-Fer fragment is shown in SEQ ID NO.1;

[0036] The SpyTag003-TB10.4 fragment is inserted into a eukaryotic expression vector to obtain a eukaryotic recombinant expression vector, and the eukaryotic recombinant expression vector is expressed in eukaryotic cells to obtain the SpyTag003-TB10.4 protein; the nucleotide sequence of the SpyTag003-TB10.4 fragment is shown in SEQ ID NO.2;

[0037] The SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein are incubated to obtain the self-assembled ferritin nanoparticle recombinant protein SFT.

[0038] The prokaryotic expression vector of the present invention comprises a pET-28a vector as its basic framework; the prokaryotic cell comprises Escherichia coli BL21. In a specific embodiment, the prokaryotic expression vector employs the high-copy vector pET-28a, a prokaryotic expression system used in genetic engineering, with Nco I and Xho I selected as restriction sites. The ferritin sequence (GenBank: NP_223316) was obtained from www.ncbi.nlm.nih.gov and ligated to SyCatcher003 at the N-terminus using a GSG-linker. An Nco I base recognition site was added to the N-terminus of each sequence, along with corresponding protective bases. To prevent frameshift mutations, a GC residue was inserted after the Nco I base site to ensure that the target sequence remained intact after enzyme digestion. A 6× histidine tag (His-tag) was exogenously added to the C-terminus of all protein sequences to facilitate protein purification. A stop codon and an Xho I restriction site were added to the C-terminus of each sequence. To ensure both rigidity and flexibility of the fusion protein structure, the subcomponents were connected using a GSG-linker. The target sequence (shown in SEQ ID NO. 1) was inserted between the Nco I and Xho I multiple cloning sites of the pET-28a vector to generate the pET-28a-SpyCatcher003-Fer plasmid vector.

[0039] The basic framework of the eukaryotic expression vector of the present invention includes a pcDNA3.4 vector; the eukaryotic cells include HEK293F cells. As a specific embodiment, the TB10.4 sequence (GenBank: NP_214802) was obtained from the website www.ncbi.nlm.nih.gov, and the C-terminus was linked to SpyTag003 via a GSG-linker. To promote protein secretion and exert correct biological function, a signal peptide was added to the N-terminus of the sequence, and a 6×His-Tag was fused to the C-terminus for expression. After codon optimization according to the mammalian protein expression system, the target sequence (as shown in SEQ ID NO. 2) was sent to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis. The target sequence was inserted between the EcoRI and BamHI multiple cloning sites of the eukaryotic expression vector pcDNA3.4 (Nanjing Zhongding Biotechnology Co., Ltd.) to construct a recombinant pcDNA3.4-SpyTag003-TB10.4 vector.

[0040] The molar ratio of the SpyCatcher003-Fer protein to the SpyTag003-TB10.4 protein described herein is 1:4-8. In specific embodiments, the molar ratio can be 1:4, 1:5, 1:6, 1:7, or 1:8. In a specific embodiment, SpyCatcher003-Fer and SpyTag003-TB10.4 were incubated at different molar ratios for in vitro coupling reactions. When the ratio was 1:6, the amount of unconjugated SpyCatcher003-Fer remaining was minimal, indicating that a molar ratio of 1:6 is suitable for constructing TB10.4-conjugated Fer.

[0041] The incubation temperature of the present invention is 2-6°C, and the incubation time is 10-14h. In a specific embodiment, the incubation temperature can be 2°C, 3°C, 4°C, 5°C or 6°C; in a specific embodiment, the incubation time can be 10h, 11h, 12h, 13h or 14h.

[0042] The incubation buffer of the present invention is 10mM Na2HPO4, 2mM KH2PO4, 136mM NaCl and 2.6mM KCl.

[0043] The present invention also provides the use of the self-assembling ferritin nanoparticle recombinant protein SFT, or the self-assembling ferritin nanoparticle recombinant protein SFT produced using the preparation method, in the preparation of a tuberculosis vaccine. This vaccine targets TB10.4, a non-RD region shared with BCG. Compared to BCG vaccines that target RD region antigens, this vaccine has the potential to be applied to immunocompromised individuals.

[0044] As a specific embodiment, the present invention fuses Fer and the monomeric antigen TB10.4 into the SpyCatcher003 / SpyTag003 coupling system, successfully expressing and purifying the corresponding soluble proteins using prokaryotic and eukaryotic expression systems, respectively, and successfully self-assembling into nanoparticles in a suitable buffer environment in vitro. This preliminarily verifies that SpyCatcher003 / SpyTag003 is compatible with TB antigens, a capability that has application prospects in the development of new TB vaccine candidates.

[0045] As a specific embodiment, mice immunized with SFT showed strong immunogenicity, especially in inducing IFN-γ + / IL-2 +The results showed that SpyCatcher003 / SpyTag003 exhibited significant advantages over monomeric antigens and comparable to BCG in stimulating T cell and TB-related cytokine secretion. Therefore, SFT can mimic BCG-like immune protection. Furthermore, the preliminary validation of SpyCatcher003 / SpyTag003's compatibility with TB antigens in this study holds great promise for the development of new TB vaccine candidates.

[0046] The present invention also provides a tuberculosis vaccine, which comprises the self-assembled ferritin nanoparticle recombinant protein SFT or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method.

[0047] As a specific embodiment, the present invention verifies the ability of SFT to promote lymphocyte proliferation. Compared with the TB10.4 monomeric antigen, SFT after Fer polymerization exhibits strong immunogenicity. In addition to inducing the most important Th1 type response, SFT also has the ability to efficiently induce IL-17. Regardless of whether specific antigen stimulation is used, this ability is significantly better than BCG and monomeric antigens. In the absence of antigen stimulation, SFT can still enhance the potential of Th1 cytokine mRNA expression.

[0048] The tuberculosis vaccine of the present invention has a concentration of 0.1 mg / mL, and the dosage of the tuberculosis vaccine is 150-250 μL / 20 g. In a specific embodiment, the dosage of the tuberculosis vaccine can be 150 μL / 20 g, 155 μL / 20 g, 160 μL / 20 g, 165 μL / 20 g, 170 μL / 20 g, 175 μL / 20 g, 180 μL / 20 g. , 185μL / 20g, 190μL / 20g, 195μL / 20g, 200μL / 20g, 205μL / 20g, 210μL / 20g, 215μL / 20g, 220μL / 20g, 225μL / 20g, 230μL / 20g, 235μL / 20g, 240μL / 20g, 245μL / 20g or 250μL / 20g.

[0049] As a specific embodiment, the safety of SFT was evaluated by HE staining, and the results showed that recombinant SFT did not cause systemic symptoms and toxic reactions in important organs in mice, confirming that SFT has good safety or tolerability in mice at this dose and in the context of a given immunization program.

[0050] To further illustrate the present invention, the following describes in detail a self-assembled ferritin nanoparticle recombinant protein SFT provided by the present invention, its preparation method, and application in conjunction with the examples. However, these examples should not be construed as limiting the scope of protection of the present invention.

[0051] Unless otherwise specified, the present invention has no special requirements for the raw materials, and commercially available products known to those skilled in the art can be used.

[0052] The data in the examples are expressed as mean ± standard deviation (SD). Statistical analysis was performed using Tukey's multiple comparison test in SPSS Version 29.0. Data were visualized using GraphPad Prism software (Version 9.0). Pairwise comparisons were performed between groups. P < 0.05 was considered statistically significant (**** P < 0.0001, *** P < 0.001, ** P < 0.01, * P < 0.05).

[0053] Example 1 Construction, expression and purification of recombinant vector

[0054] The antigen TB10.4 in the non-RD region shared by BCG and Mtb (Mycobacterium tuberculosis) was selected as the vaccine target. The present invention requires the construction of two prokaryotic expression plasmids pET-28a-SpyCatcher003-Fer (pET-28a-Fer) and pET-28a-TB10.4, and a eukaryotic expression plasmid pcDNA3.4-SpyTag003-TB10.4 (pcDNA3.4-ST). Figure 2 Schematic diagram of the expression plasmid. In order to effectively secrete the TB10.4 antigen in the nanoparticles in the eukaryotic system, the present invention introduces a signal peptide ( Figure 2 After the NPs gene (i.e., Ferritin or Fer) is coupled to SpyCatcher003, it is fused with the His-tag via a GSG linker ( Figure 2 Middle B).

[0055] 1. Construction, expression and purification of the recombinant pET-28a-SpyCatcher003-Fer vector

[0056] For prokaryotic expression plasmids, the high-copy vector pET-28a (Kelei Biotechnology Co., Ltd.; KL-ZL-0061) of the prokaryotic expression system in genetic engineering was used, and Nco I and Xho I were selected as restriction sites. The Ferritin (GenBank: NP_223316) sequence was obtained from www.ncbi.nlm.nih.gov and the N-terminus was ligated to SyCatcher003 via GSG-linker ( Figure 2In B), an Nco I base recognition site was added to the N-terminus of each sequence and corresponding protective bases were added. To prevent frameshift mutations, GC was added after the Nco I base site so that the correctness of the target sequence would not be affected after enzyme cleavage. A 6× histidine tag (His-tag) was exogenously added to the C-terminus of all protein sequences to facilitate protein purification. A stop codon and an Xho I restriction site were added to the C-terminus of each sequence. To ensure the rigidity and flexibility of the fusion protein structure, each subcomponent was connected with a GSG-linker. The target sequence (shown in SEQ ID NO.1) was codon-optimized and sent to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis. The target sequence was inserted between the Nco I and Xho I multiple cloning sites of the pET-28a vector to obtain the pET-28a-SpyCatcher003-Fer plasmid vector.

[0057] The pET-28a-SpyCatcher003-Fer plasmid vector was transformed into the competent strain of Escherichia coli BL21 (DE3) and cultured at 37°C for 16 h. The positive strain was placed in 600 mL LB liquid medium with 50 μg / mL kanamycin and cultured on a constant temperature shaker at 37°C until the OD 600 0.8. 0.2 mM isopropyl-β-D-1 mercaptogalactoside (IPTG) was added to the culture medium and incubated overnight at 16°C. The induced bacterial culture was collected and the cells were lysed by ultrasonication. After centrifugation, the supernatant was loaded onto a nickel-nitrotriacetic acid (Ni-NTA)-Sepharose CI-6B affinity chromatography column, pre-equilibrated with Ni-NTA binding buffer. Wash with Ni-NTA binding wash buffer (20 mM Tris-HCl, 30 mM imidazole, 0.15 M NaCl, pH 8.0) to an OD of 280 After reaching the baseline value, the target protein was slowly eluted with Ni-IDA elution buffer (20 mM Tris-HCl, 250 mM imidazole, 0.15 M NaCl, pH 8.0), and the effluent was collected. The collected protein was added to a dialysis bag and dialyzed against phosphate buffered saline (PBS) overnight to obtain the SpyCatcher003-Fer protein.

[0058] 2. Construction, Expression, and Purification of the Recombinant pcDNA3.4-SpyTag003-TB10.4 Vector

[0059] The TB10.4 sequence (GenBank: NP_214802) was obtained from www.ncbi.nlm.nih.gov and the C-terminus was linked to SpyTag003 via GSG-linker ( Figure 2In Figure A), to promote protein secretion and exert correct biological function, a signal peptide was added to the N-terminus of the sequence, and a 6×His-Tag was fused to the C-terminus. After codon optimization according to the mammalian protein expression system, the target sequence (shown in SEQ ID NO. 2) was sent to Nanjing Zhongding Biotechnology Co., Ltd. for synthesis and inserted into the eukaryotic expression vector pcDNA3.4 (Wenzhou Kemiao Biotechnology Co., Ltd.; KM107057) between the EcoR I and BamH I multiple cloning sites to construct the recombinant pcDNA3.4-SpyTag003-TB10.4 vector.

[0060] To express and purify SpyTag003-TB10.4, HEK293F cells (ATCC Cell Resource Center; CRL1573) were cultured to 2 × 10 6 cells / mL, the cell survival rate is greater than 95%. 6 Add 3 μg of polyethyleneimine (PEI) to the cell density of 10 cells / mL (Polysciences, USA) was then supplemented with RPMI-1640 medium containing 10% by volume FBS and 10% by volume 100× double-antibody. 1 μg of recombinant pcDNA3.4-SpyTag003-TB10.4 expression plasmid was transiently transfected. After 6 days of culture, cells were centrifuged at 5000g at 4°C for 15 minutes. Cells were resuspended in lysis buffer (50mM Tris, 300mM NaCl, 20mM Imidazole, pH 8.0) and sonicated. The precipitate was collected by centrifugation at 12000 rpm for 15 minutes. Cells were resuspended in lysis buffer (50mM Tris, 300mM NaCl, 20mM Imidazole, pH 8.0) and sonicated again. The supernatant was collected by centrifugation at 12000 rpm for 15 minutes. The supernatant or the mixture of the precipitate and Ni column incubation was slowly added to the purification column using a low-pressure chromatography system. Balance Ni-NTAHis-BindResin with Balance Buffer (50 mM Tris, 300 mM NaCl, 20 mM Imidazole, pH 8.0) at a flow rate of 0.5 mL / min until the OD value of the effluent is 280The target protein was eluted with Washing Buffer (50 mM imidazole, 50 mM Tris, 300 mM NaCl, pH 8.0) and Elution Buffer (500 mM imidazole, 50 mM Tris, 300 mM NaCl, pH 8.0) at a flow rate of 1 mL / min to obtain the SpyTag003-TB10.4 protein, which was collected and stored at -20°C.

[0061] 3. Construction, Expression and Purification of Recombinant pET-28a-TB10.4 Vector

[0062] After the pET28a vector was double-digested with Nco I / Xho I to form a linear vector, TB10.4 was ligated to the linearized pET28a using DNA ligase to form a recombinant plasmid. The construction method and expression purification were the same as those in "1. Construction, expression and purification of recombinant pET-28a-SpyCatcher003-Fer vector" in Example 1. After purification, the TB10.4 protein was obtained.

[0063] Example 2 Construction and characterization of the ratio of SpyCatcher003-Fer / SpyTag003-TB10.4

[0064] SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein were incubated in vitro at molar ratios of 0:1, 1:0, 1:2, 1:4, 1:6, 1:8, and 1:10 at 4°C for 12 h in a buffer containing 10 mM Na₂HPO₄, 2 mM KH₂PO₄, 136 mM NaCl, and 2.6 mM KCl. Samples incubated at each ratio were centrifuged at 12,000 rpm for 15 min at 4°C, and the supernatants were collected. The samples were analyzed by SDS-PAGE and Coomassie blue staining to determine the optimal conjugation ratio. The morphology and size distribution of the self-assembled nanoparticles were observed and analyzed by TEM and DLS. The resulting protein is a self-assembled ferritin nanoparticle tuberculosis vaccine (SFT).

[0065] SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein were incubated overnight at different molar ratios for in vitro coupling reaction. That is, SpyTag003-TB10.4 protein was incorporated into SpyCatcher003-Fer protein, as shown by a single band on SDS-PAGE gel. Results ( Figure 3Figure (A) shows that when the ratio is 1:6, the amount of SpyCatcher003-Fer remaining unattached to the SpyTag003-TB10.4 protein is minimal, indicating that this ratio is the appropriate molar ratio for constructing TB10.4-conjugated Fer. Transmission electron microscopy (TEM) and DLS were then used to analyze the morphology and size of the SpyCatcher003-Fer protein and SFT (molar ratio of 1:6). Microscopic images showed that the two nanoparticles were uniformly dispersed and had the same morphology ( Figure 3 The size distribution of the nanoparticles was measured by DLS ( Figure 3 D, SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein) confirmed that the size of the nanoparticles was uniform, and the corresponding diameters were listed in Figure 3 Middle E (TB10.4 protein, SpyCatcher003-Fer protein, SpyTag003-TB10.4 protein and SFT (molar ratio of 1:6) protein).

[0066] Example 3 Mouse Immunization Protocol

[0067] The animals used in this study were C57BL / 6 mice (6-8 weeks old, weighing 18-20 g, purchased from Jiangsu Jicui Pharmaceutical Co., Ltd.), and the mice were randomly divided into cages. The mice were placed in individual ventilated cages with an ambient temperature of 22-25°C, a relative humidity of 45%-65%, and a light / dark cycle of 12h / 12h. The animals had free access to food and water throughout the experiment. The animal experiments involved in this invention were approved by the Animal Ethics Committee of Bengbu Medical University (Approval No.: Lundongke 2024502).

[0068] The mice were acclimated for one week before the experiment. SPF-grade C57BL / 6 female mice were randomly divided into 4 groups (6 mice in each group). All mice were injected subcutaneously in the neck. Commercial BCG dry powder (Shanghai Ruichu Biotechnology Co., Ltd.; R19023) was diluted to 10% with sterile saline. 4CFU / μL; before each immunization, the recombinant protein (SpyCatcher003-Fer protein, TB10.4 protein, or SFT protein) was diluted to 0.1 mg / mL with sterile fresh PBS as needed. All mice received a subcutaneous injection of 200 μL of the immunogen (i.e., BCG dry powder or recombinant protein) in the neck. The Fer and BCG groups received a single injection at the beginning of the experiment: the Fer group received diluted SpyCatcher003-Fer protein only at week 0, and the BCG group received diluted BCG only at week 0. The TB10.4 and SFT groups used a "homologous boosting immunization" strategy using recombinant proteins: the TB10.4 group received diluted TB10.4 protein at weeks 0, 2, and 4, and the SFT group received diluted SFT (molar ratio 1:6) protein at weeks 0, 2, and 4. Immunogenicity was determined at week 6.

[0069] Example 4 Lymphocyte proliferation experiment

[0070] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse splenic lymphocytes. The isolated splenic lymphocytes were diluted to 3×10 in RPMI-1640 medium containing 10% fetal bovine serum. 6 cells / mL, and 2×10 5 Cells / well concentration was inoculated into 96-well plates, and 10 μL of TB10.4, PPD (PPD was purchased from Harbin Pharmaceutical Bio-Vaccine, veterinary medicine product number 080078097) or ConA (Shanghai Maokang Biotechnology Co., Ltd.; MP6306) was added for stimulation. The stimulated cells were incubated in a 37°C, 5% CO2 incubator for 48 h, and detected using a cell proliferation detection kit (Promega; G3582), and then cultured for another 4 h. The OD was read within 10 min after the incubation. 490 SI is used to express the proliferation response of individual mouse spleen lymphocytes: SI = (mean OD of stimulation wells) 490 Value - average OD of blank control wells 490 value) / (average OD of negative control wells 490 Value - average OD of blank control wells 490 value).

[0071] The level of lymphocyte proliferation is an important indicator for the preliminary evaluation of cellular immunity, so the ability of SFT to promote cell proliferation was verified. The results showed that all groups showed similar trends regardless of the stimulation of the antigen. The Fer group showed the lowest proliferation ability. The cell proliferation level of the SFT immunization group after receiving antigen stimulation again was significantly higher than that of mice injected with only monomeric antigen TB10.4. The BCG group also obtained a proliferation ability comparable to that of Fer ( Figure 4This also illustrates that although TB10.4 is a single antigen, it has acquired the ability to stimulate cell proliferation similar to the most classic BCG after being coupled with SpyCatcher-Fer / SpyTag.

[0072] Table 1 Lymphocyte proliferation test results

[0073]

[0074] Example 5 Flow cytometric analysis

[0075] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse splenic lymphocytes. 6 Cells were seeded per well in a 24-well plate and incubated with TB10.4 recombinant protein at a final concentration of 15 μg / mL at 37°C in 5% CO₂ for 16 h. Monensin was added at a final concentration of 1 μL / well for 5 h to block extracellular cytokine secretion. Cells were harvested by centrifugation, washed with ice-cold PBS, and Fc receptors were blocked with 1 μL TruStain FcX™ PLUS-labeled anti-mouse CD16 / 32 monoclonal antibody. Surface staining was performed with 2 μL FITC-labeled anti-mouse CD3ε, 1.5 μL PE-labeled anti-mouse CD4, and 1.5 μL APC / Fire™ 750-labeled anti-mouse CD8α mAbs. Cells were fixed with FluoroFix™ Buffer and permeabilized with PermWash Buffer. Intracellular staining was performed with 5 μL APC-labeled anti-mouse IFN-γ, 1.5 μL PE / Cy7 anti-mouse TNF-α, and 1 μL Brilliant Violet 421 anti-mouse IL-2 mAbs. Subsequently, the cells were washed with PBS and resuspended in FACS buffer and analyzed using DxPAthena TM Flow cytometry was used for detection. Flowjo software was used to analyze antigen-specific CD4 + / 8 + IFN-γ + / TNF-α + / IL-2 + T cell frequency.

[0076] In order to further reflect the activation level of T lymphocytes and clarify the source of anti-tuberculosis factors, flow cytometry was used to analyze the CD4 + / CD8 + IFN-γ + / IL-2 + / TNF-α + T cells. The results are as follows Figure 5 、 Figure 6As shown in Table 2 and Table 3, compared with the other three groups, TB10.4 nanoantigen induced the highest level of CD4 + / CD8 + IFN-γ + T cells, a small number of IFN-γ effector T cells were observed even in BCG ( Figure 5 China A and Figure 6 It is worth noting that BCG has a significant effect on the induction of CD4 + T or CD8 + T cells showed the strongest ability to secrete TNF-α ( Figure 5 Middle B and Figure 6 Middle B). After antigen stimulation, the CD4 + IL-2 + T cell capacity ( Figure 5 C) and trend with CD8 + IFN-γ + T cells are similar ( Figure 6 Middle A). Compared with other types of effector T cells, CD8 + IL-2 + The proportion of T cells was the lowest, and the negative group showed a high secretion frequency similar to that of the BCG and TB10.4 groups, while SFT still maintained a relative peak value ( Figure 6 (C) In summary, within a given immune context, BCG, a widely accepted TB vaccine, exhibited the best efficacy in inducing TNF-α secretion. However, SFT exhibited a higher induction efficiency than BCG in inducing the frequencies of other effector T cells. Furthermore, the SFT-immunized group exhibited significantly greater specificity in activating T cells to produce Th1 cytokines than standard subunit proteins. This advantage may be attributed to the enhanced immunogenicity of monomeric TB antigens after self-assembly into nanoparticles via the SpyCatcher / SpyTag system via Fer.

[0077] Table 2CD4 + IFN-γ + T, CD4 + TNF-α + T and CD4 + IL-2 + T cell test results

[0078]

[0079] Table 3CD8 + IFN-γ + T, CD8 + TNF-α + T and CD8 + IL-2+ T cell test results

[0080]

[0081]

[0082] Example 6 ELISpot assay

[0083] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse splenic lymphocytes. The number of antigen-specific immune cells secreting IFN-γ was detected using a commercial mouse IFN-γ pre-coated ELISPOT kit (Beijing Dakoway Biotechnology Co., Ltd.; DKW22-1000-096). First, the PVDF membrane was activated with a universal serum-free medium (Dakoway's ELISpot-specific serum-free medium), and then 3×10 6 Cells were stimulated with recombinant TB10.4 or PPD at a final concentration of 15 μg / mL for 16 hours. Untreated cell suspension served as a negative control, and a mixture containing 500 ng / mL PMA (Sigma; P1585) and 10 ng / mL ionomycin (Beijing Dakoway Biotechnology Co., Ltd.; DKW-ST-PI) served as a positive control. ELISpot plates were incubated at 37°C and 5% CO₂ for 16 hours. The plates were then operated according to the manufacturer's instructions and the number of spot-forming cells (SFCs) secreting antigen-specific IFN-γ was observed. Finally, the number of SFCs was counted using an IRISTM ELISpot plate reader.

[0084] In addition to functional T cells, the role of a variety of cytokines in TB immunity is also crucial. The results of ELISpot tests showed that only a minimum number of cells was observed in the Fer group, regardless of whether specific antigens were used as stimulants. When PPD was used as a stimulus, the TB10.4 monomeric antigen immunization group obtained a larger number of spots, although there was no significant difference between the groups. Under the specific TB10.4 stimulation, the spots formed by the spleen cells of the mice in the SFT vaccine group were generally higher than those in the BCG group, while the TB10.4 group had only a weak reaction. The classic advantages of BCG are self-evident. Compared with the TB10.4 monomeric antigen, it shows that SFT after Fer polymerization has strong immunogenicity ( Figure 7 and Table 4 ).

[0085] Table 4 Statistical analysis of IFN-γ secretion by mouse spleen cells stimulated by TB10.4 and PPD respectively by ELISpot

[0086]

[0087]

[0088] Example 7 Enzyme-linked immunosorbent assay

[0089] The mice treated in Example 3 were euthanized 42 days after the first vaccination, and the spleens were collected aseptically to isolate the mouse splenic lymphocytes. The secretion levels of various TB-related cytokines in the culture supernatant of mouse splenic lymphocytes were detected using a commercial ELISA kit. 3×10 spleen cells were used. 6 Cells / well were incubated with 20 μL 15 μg / mL TB10.4 recombinant protein or 20 μL 15 μg / mL PPD at 37°C, 5% CO2 for 24 h to detect IL-2, and for 48 h to detect IFN-γ, TNF-α, IL-4, IL-12, and IL-17 secretion levels. After the incubation, the cell culture supernatant was collected and detected using a commercial ELISA kit (Jianglai Biotechnology; catalog numbers JLW10967, JL10208, JL20266, JL20246, and JL20250). OD values ​​were measured using a SpectraMax Mini microplate reader within the first 15 min after the color reaction. 450 , and analyze the secretion levels of various cytokines.

[0090] In order to fully verify the ability of spleen lymphocytes of each group of mice to secrete TB immune-related cytokines under antigen stimulation, the present invention detected the secretion levels of multiple cytokines in the cell culture supernatant. The study found that when stimulated with specific antigens, the IFN-γ detected in the TB10.4 immune group was significantly higher than that in the BCG group, but this was contrary to the results detected by flow cytometry ( Figure 8 A and Table 5), which may be due to the quantification of IFN-γ derived from other cells. The concentrations of TNF-α and IL-2 in the supernatant of each group were basically consistent with the frequency of T cell secretion ( Figure 8 Table B, Table 6 and Figure 8C, Table 7). This shows that on the one hand, when the body encounters tuberculosis antigen stimulation again, TNF-α mainly comes from T cells. On the other hand, it also confirms that BCG is the main motivation for inducing the production of TNF-α. It also proves again that with the help of nanoparticle antigens, a more powerful immune response biased towards Th1 type with IFN-γ and IL-2 as the main components can be stimulated. IL-12 is a determinant of the Th1 cell immune response and plays an important role in the immune response to tuberculosis. It participates in the establishment and maintenance of anti-tuberculosis immune response in many ways, such as regulating the Th1 / Th2 balance, inducing the production of IFN-γ, and promoting the differentiation of Th1 cells. The research of the present invention confirms this classic view. The secretion of IL-12 is similar to the production of Th1 type cytokines. Nano TB10.4 antigen significantly enhances the immunogenicity of traditional antigens and promotes IFN secretion. IL-12 and IFN complement each other, making up for the disadvantage of monomeric antigens being inferior to BCG to the greatest extent, and strengthening the ability of Th cells to polarize to Th1 type cells ( Figure 8 E and Table 9). In addition, IL-4, a representative indicator of Th2 immune response, is considered an unfavorable factor in tuberculosis treatment. Only basal secretion of IL-4 was observed in all groups. Therefore, in terms of immunogenicity, the nanoparticles do not suppress the Th1 response by secreting IL-4 ( Figure 8 Equally important, IL-17 plays a major role in the early stages of tuberculosis. However, the physiological significance of IL-17 is often overlooked in many vaccine immunological evaluations. The results showed that SFT, in addition to inducing the most important Th1 response, also has the ability to efficiently induce IL-17, and this ability is significantly superior to BCG and monomeric antigens ( Figure 8 F and Table 10).

[0091] Table 5 IFN-γ secretion expression level

[0092]

[0093]

[0094] Table 6 TNF-α secretion expression level

[0095]

[0096] Table 7 IL-2 secretion expression level

[0097]

[0098] Table 8 IL-4 secretion expression levels

[0099]

[0100]

[0101] Table 9 IL-12 secretion expression level

[0102]

[0103] Table 10 IL-17 secretion expression level

[0104]

[0105] Example 8 Real-time fluorescence quantitative PCR

[0106] The mice treated in Example 3 were taken and the number of cells extracted by TRIzol was 10 7 The total RNA was analyzed by Nanodrop UV analyzer according to OD 260 / 280 and OD 260 / 230 Check the concentration and purity of RNA. cDNA synthesis was performed using One-Step gDNA Removal and cDNA Synthesis SuperMix (Full Gold; AE341-02); qPCR was performed using Green qPCR SuperMix (Full Gold; AQ601-01-V2) to assess the transcriptional levels of cytokines IFN-γ, TNF-α, IL-2, and IL-17. Primer sequences are shown in Tables 11, 2 -ΔΔCT Methods The mRNA expression level was calculated.

[0107] Table 11 Primer sequences

[0108]

[0109]

[0110] At the same time, in order to understand the gene expression of cytokines, it is necessary to observe the mRNA transcription of IFN-γ, TNF-α, IL-2 and IL-17 when evaluating candidate vaccines, which provides a new perspective for evaluating the immunogenicity of candidate vaccines ( Figure 9 In this study, the transcription of several cytokines was evaluated. Before TB10.4-specific stimulation, very similar transcriptional expression of TNF-α was observed in the BCG and SFT groups. For IFN-γ, IL-2, and IL-17, the SFT group exhibited significantly higher maximal transcriptional levels than the other groups ( Figure 9 and Table 12). Therefore, SFT may still have the potential to contribute to enhancing Th1 cytokine mRNA expression in the absence of antigen stimulation.

[0111] Table 12 IFN-γ, TNF-α, IL-2 and IL-17 transcriptional expression levels

[0112]

[0113]

[0114] Example 9 H&E staining

[0115] The hearts, livers, spleens, lungs, and kidneys of mice treated in Example 3, 42 days after the first vaccination, were fixed with 4% paraformaldehyde, dehydrated with gradient ethanol at different concentrations, embedded in paraffin, and uniformly cut into 6 μm slices. H&E staining was performed to evaluate the safety of the ferritin vaccine.

[0116] Embedding: Add liquid paraffin to the mold and place the tissue sample to be embedded in the paraffin, ensuring that the tissue is positioned regularly. Add a small amount of liquid paraffin and cool it down to freeze it until it becomes solid;

[0117] Section: 5 μm thickness; place the tissue sections on a glass slide and soak them in 37°C saline;

[0118] Dewaxing: Soak the tissue sample slices in xylene for 10 minutes, then replace the xylene and continue soaking for 10 minutes;

[0119] Hydration: Soak the tissue sample that has been soaked in xylene in anhydrous ethanol for 5 minutes; then soak it in 95%, 85%, and 70% ethanol for 5 minutes each;

[0120] Hematoxylin staining, differentiation, and anti-blueing: After hydration, sections of the tissue sample were washed with PBS solution for 5 minutes each time, three times. 100 μL of hematoxylin staining solution was added to each tissue section and stained for 10 minutes. Excess stain was washed off with distilled water, and differentiation was performed using 1% hydrochloric acid ethanol. Excess stain was removed, and the tissue sections were rinsed with double-distilled water. After anti-blueing, the blueing solution was added to the tissue sections. After anti-blueing, the sections were washed with clean water and then with double-distilled water.

[0121] Eosin staining and dehydration: Eosin was added to the sections and stained for 3 min. Dehydration was performed using 80%, 95%, and anhydrous ethanol in a gradient manner (80% ethanol dehydration for 5 s, 95% ethanol dehydration for 2 min, and anhydrous ethanol dehydration for 2 min).

[0122] Air-drying and mounting: Soak the dehydrated sections in xylene twice for 5 minutes each time, then air-dry the tissue sample sections and mount them with neutral gum; observe and photograph under a microscope.

[0123] In order to verify whether SFT would cause drug-induced damage to important organs, the behavioral activities of mice were closely observed before and after vaccination, and the hearts, livers, spleens, lungs, and kidneys of each group of mice were euthanized after two rounds of immunization for pathological HE staining sections. No inflammatory reaction was observed at the injection site and its surroundings. Throughout the experiment, all mice had normal breathing, eating, and drinking conditions, and their hair was in good condition. Therefore, the vaccine did not cause systemic adverse reactions in mice. After the experiment, the gross condition and pathological sections of each organ were continuously and carefully observed. The morphology of each organ was generally normal. Microscopy showed that the number and morphology of cells in each organ were normal and there was no obvious inflammatory cell infiltration ( Figure 10 These results preliminarily indicate that recombinant SFT did not cause systemic symptoms or toxic reactions in important organs in mice, confirming that SFT has good safety and tolerability in mice at this dose and under the given immunization schedule.

[0124] It can be seen that the present invention uses the SpyCatcher / SpyTag coupling system and self-assembled ferritin nanoparticles to prepare a tuberculosis vaccine targeting the non-RD region antigen TB10.4. The vaccine (SFT) consists of two parts, the SpyCatcher003-Fer vector and the SpyTag003-TB10.4, which are expressed in prokaryotic and eukaryotic systems respectively. The two parts self-assemble in vitro into the tuberculosis nano vaccine candidate SFT. Compared with monomeric TB10.4, subcutaneous immunization of SFT without the aid of an adjuvant significantly increased the level of cell proliferation, and has the ability to induce T cell activation and stimulate a variety of TB-related cytokines, indicating that SFT's ability in all aspects is not inferior to or better than BCG. These results show that SFT is significantly superior to traditional recombinant proteins and may be able to simulate an immune protection effect similar to BCG in the future.

[0125] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A self-assembled ferritin nanoparticle recombinant protein SFT, characterized in that: The recombinant protein SFT is self-assembled by SpyCatcher003-Fer protein and SpyTag003-TB10.4 protein; The nucleotide sequence encoding the SpyCatcher003-Fer protein is shown in SEQ ID NO.1; the nucleotide sequence encoding the SpyTag003-TB10.4 protein is shown in SEQ ID NO.

2.

2. The method for preparing the recombinant protein SFT according to claim 1, characterized in that: The following steps are involved: Inserting the SpyCatcher003-Fer fragment into a prokaryotic expression vector to obtain a prokaryotic recombinant expression vector, and expressing the prokaryotic recombinant expression vector in prokaryotic cells to obtain the SpyCatcher003-Fer protein; the nucleotide sequence of the SpyCatcher003-Fer fragment is shown in SEQ ID NO.1; Inserting the SpyTag003-TB10.4 fragment into a eukaryotic expression vector to obtain a eukaryotic recombinant expression vector, and expressing the eukaryotic recombinant expression vector in eukaryotic cells to obtain the SpyTag003-TB10.4 protein; the nucleotide sequence of the SpyTag003-TB10.4 fragment is shown in SEQ ID NO.2; The SpyCatcher003-Fer protein and the SpyTag003-TB10.4 protein are incubated to obtain the self-assembled ferritin nanoparticle recombinant protein SFT.

3. The preparation method according to claim 2, characterized in that The basic skeleton of the prokaryotic expression vector includes a pET-28a vector, and the prokaryotic cell includes Escherichia coli BL21.

4. The preparation method according to claim 2, characterized in that The basic skeleton of the eukaryotic expression vector includes a pcDNA3.4 vector, and the eukaryotic cells include HEK293F cells.

5. The preparation method according to claim 2, characterized in that During the incubation, the molar ratio of the SpyCatcher003-Fer protein to the SpyTag003-TB10.4 protein is 1:4-8.

6. The preparation method according to claim 5, characterized in that The incubation temperature is 2-6° C., and the incubation time is 10-14 h.

7. The preparation method according to claim 5 or 6, characterized in that: The incubation buffer was 10 mM Na2HPO4, 2 mM KH2PO4, 136 mM NaCl and 2.6 mM KCl.

8. Use of the self-assembled ferritin nanoparticle recombinant protein SFT according to claim 1 or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method according to any one of claims 2 to 7 in the preparation of a tuberculosis vaccine.

9. A tuberculosis vaccine, characterized in that The tuberculosis vaccine comprises the self-assembled ferritin nanoparticle recombinant protein SFT according to claim 1 or the self-assembled ferritin nanoparticle recombinant protein SFT prepared by the preparation method according to any one of claims 2 to 7.

Images