A broad-spectrum dual-target peptide against novel coronavirus and its application
By designing the dual-target polypeptide R1L25HR2 targeting coronavirus RBD and HR1, the problem of limited antiviral effects and prone to drug resistance in the prior art is solved, and efficient and safe inhibition of SARS-CoV-2 and its mutant strains are achieved.
Patent Information
- Application Number
- CN202510593361.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-08
- Estimated Expiration
- 2045-05-09
AI Technical Summary
There is a lack of polypeptide drugs that can target both the coronavirus RBD and HR1 targets in the prior art, resulting in limited antiviral effects and prone to drug resistance.
A dual-target polypeptide is designed to simultaneously target two key targets of the coronavirus, including the 12-amino acid R1 polypeptide and the 46-amino acid HR2 polypeptide, and connect through flexible linkers to form R1L15HR2, R1L25HR2, and R1L35HR2, which improves the antiviral effect and reduces the risk of drug resistance.
It significantly inhibits the infection process of SARS-CoV-2 and its mutant strains, especially the R1L25HR2 polypeptide has an IC50 of 78 nM on SARS-CoV-2, which is about 21 times that of HR2 polypeptide, and has broad-spectrum anti-novel coronavirus activity and shows good safety at the cellular level.
Smart Images

Figure CN120098150B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and specifically to a broad-spectrum dual-target polypeptide against the novel coronavirus and its application. Background Art
[0002] The virus particle is spherical, with spike structures arranged on its surface composed of four structural proteins: spike protein (S), nucleocapsid protein (N), membrane protein (M), and envelope protein (E). Among them, the trimeric S glycoprotein directly determines the host range and infection efficiency through conformational dynamic equilibrium and molecular interaction mechanisms.
[0003] The coronavirus spike protein plays a crucial role in viral invasion of target cells. The S protein comprises two functional subunits, S1 and S2. The receptor-binding domain (RBD) of the S1 subunit is responsible for recognizing and binding to the host cell receptor, angiotensin-converting enzyme-2 (ACE2), triggering protease cleavage and activation. Subsequently, the S2 subunit undergoes a series of conformational changes, prompting the heptad repeat sequence HR1 to form a trimeric coiled-coil structure, exposing its hydrophobic pocket. This allows the heptad repeat sequence to bind to HR2 to form a six-helix bundle (6-HB), ultimately driving fusion of the virus with the host cell membrane. Therefore, the RBD and HR1 regions are ideal targets for the development of viral entry inhibitors.
[0004] However, during the evolution of coronaviruses, the spike protein RBD and N-terminal domain (NTD) undergo frequent mutations. These mutations not only enhance the virus's immune evasion capabilities, allowing it to evade the host immune system, but may also lead to changes in its transmissibility and pathogenicity. Despite this, certain hidden sites within the spike protein trimer remain relatively conserved, remaining unchanged across different mutant strains. These highly conserved sites provide potential targets for the development of antiviral drugs.
[0005] Therefore, the development of broad-spectrum antiviral drugs that can effectively combat the virus and its mutants has become a key to preventing and treating infectious disease outbreaks. For example, patent application publication number CN115925826A discloses a peptide that has a strong inhibitory effect on both the original strain of the novel coronavirus and its various variants; another example is patent application publication number CN114437184A, which discloses a peptide that has a strong inhibitory effect on both the original strain of the novel coronavirus and its various variants.
[0006] However, peptide drugs that can simultaneously target both viral RBD and HR1 (heptad repeat sequence 1) have not been reported. Summary of the Invention
[0007] To address the shortcomings of the existing technology, the present invention aims to develop a dual-target peptide that can inhibit the novel coronavirus. This peptide drug acts simultaneously on two key viral targets, the RBD and HR1, to more effectively and synergistically inhibit the viral infection process. On the one hand, by targeting the RBD, the binding of the virus to the host cell is blocked, thereby hindering the virus's adsorption to the host cell surface and curbing its adsorption process. On the other hand, by targeting HR1, the formation of the viral 6-HB is interfered with, further inhibiting the fusion process between the viral envelope and the host envelope. This dual-target design strategy not only enhances the drug's antiviral efficacy but also helps reduce the risk of the virus developing drug resistance.
[0008] In order to achieve the above-mentioned purpose, the specific technical solutions of the present invention are as follows:
[0009] The present invention provides a broad-spectrum dual-target polypeptide against the novel coronavirus, comprising a polypeptide R1 targeting the novel coronavirus RBD and a polypeptide HR2 targeting the novel coronavirus HR1; the polypeptide R1 targeting the SARS-CoV-2 RBD consists of 12 amino acids, with a specific amino acid sequence of N-DVDVLIKYQFSF-C; the polypeptide HR2 targeting the SARS-CoV-2 HR1 consists of 46 amino acids, with a specific amino acid sequence of N-DVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQ-C, wherein N- represents the N-terminal direction and C- represents the C-terminal direction.
[0010] Preferably, the polypeptide R1 and the polypeptide HR2 are connected via a linker; the linker is a flexible linker (GGGGS) n , n=3-10, and n is an integer.
[0011] Further preferably, in the present embodiment, n=3, 5, or 7 are selected as examples, and the three dual-target peptides are named R1L15HR2, R1L25HR2, and R1L35HR2, respectively. The inhibitory activities of R1L15HR2, R1L25HR2, and R1L35HR2 against SARS-CoV-2 are 158, 43, and 174 nM, respectively.
[0012] Most preferably, R1L25HR2 inhibits the IC of SARS-CoV-2 50 The activity of HR2 peptide was 78 nM, which was about 21 times that of HR2 peptide.
[0013] The present invention also provides a nucleic acid molecule encoding the dual-target polypeptide.
[0014] Preferably, the gene sequences of R1L15HR2, R1L25HR2, and R1L35HR2 are shown as SEQ ID NOs. 5-7, respectively.
[0015] The present invention also provides a recombinant vector comprising the nucleic acid molecule.
[0016] The present invention also provides a host cell comprising the recombinant vector.
[0017] The present invention also provides a method for preparing the polypeptide, comprising designing and synthesizing a coding gene for the dual-target polypeptide, constructing a recombinant expression vector for the dual-target polypeptide, transforming the vector into Escherichia coli for expanded culture and induced expression, and separating and purifying the vector.
[0018] The present invention also provides the use of the dual-target polypeptide, the nucleic acid molecule, the recombinant vector or the host cell in the preparation of a drug for preventing or treating diseases caused by coronavirus infection.
[0019] In the above application, the disease caused by the coronavirus infection is a respiratory system infection. The respiratory system infection can be a respiratory tract infection and / or a lung infection.
[0020] In the above application, the coronavirus is the original strain of the new coronavirus and / or the mutant strain of the new coronavirus; the mutant strain of the new coronavirus is D614G, Beta, Delta and / or Omicron series mutant strains.
[0021] In a specific embodiment of the present invention, the Omicron series variants include BA.1, XBB, BQ.1, BQ.1.1, BF7, BA4 / 5, BA.2, EG.5.1, BA.2.86, JN.1 and KP.2, but are not limited thereto.
[0022] The present invention also provides a pharmaceutical composition, which contains the dual-target polypeptide, the nucleic acid molecule, the recombinant vector or the host cell, and a pharmaceutically acceptable carrier.
[0023] Preferably, the pharmaceutical composition is in the form of a nasal spray formulation, an oral formulation, or a parenteral formulation;
[0024] Further preferably, the oral preparation is selected from tablets, capsules, granules, suspensions and pills;
[0025] Further preferably, the parenteral preparation is an injectable or bolus preparation;
[0026] Preferably, the pharmaceutical composition is a vaccine composition.
[0027] Beneficial effects of the present invention:
[0028] The polypeptide provided by the present invention can simultaneously target the dual targets of the novel coronavirus RBD and HR1, especially R1L25HR2, which can effectively inhibit SARS-CoV-2 and its mutant strains and has broad-spectrum anti-novel coronavirus activity. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 Design of three bifunctional peptides, R1L15HR2, R1L25HR2, and R1L35HR2 (A) and their identification by SDS-PAGE (B) and immunoblotting (C);
[0030] Figure 2 represents the inhibitory activity of different peptides against SARS-CoV-2 pseudovirus; A represents the inhibitory activity of R1L15HR2, R1L25HR2, and R1L35HR2 against SARS-CoV-2 pseudovirus; B represents the inhibitory activity of R1L25HR2, R1, HR2 peptides, and a mixture of R1+HR2 against SARS-CoV-2;
[0031] Figure 3 for the binding of R1L25HR2 to SARS-CoV-2 RBD and HR1;
[0032] Figure 4 R1L25HR2 inhibits viral infection by acting on the virus rather than the target cells;
[0033] Figure 5 R1L25HR2 inhibits the entry of SARS-CoV-2 into target cells;
[0034] Figure 6 R1L25HR2 inhibits the process of SARS-CoV-2 adsorption to target cells;
[0035] Figure 7 R1L25HR2 inhibits SARS-CoV-2 D614G S protein-mediated cell-cell fusion activity;
[0036] Figure 8 is the inhibitory activity of R1L25HR2 against different mutant strains of SARS-CoV-2; AN represents the inhibitory activity of different mutant strains;
[0037] Figure 9 The effect of R1L25HR2 on the activity of target cells; A is the effect of R1L25HR2 on the activity of Caco-2 cells; B is the effect of R1L25HR2 on the activity of Calu-6 cells. DETAILED DESCRIPTION
[0038] Example 1
[0039] 1. Design of dual-target peptides
[0040] The broad-spectrum anti-novel coronavirus dual-target peptide is composed of peptides targeting SARS-CoV-2 RBD and HR1. The specific amino acid sequence is as follows Figure 1 As shown in Figure A, the following polypeptide structures are composed from the N-terminus to the C-terminus: RBD-targeting polypeptide R1, a glycine- and serine-rich linker (GGGGS) n, and HR1-targeting polypeptide HR2. The linker may contain n tandem repeats of the GGGGS sequence, where n can range from 3 to 10.
[0041] The present invention selected dual-target peptides R1L15HR2, R1L25HR2, and R1L35HR2 for subsequent experiments.
[0042] 2. Construction of recombinant vectors pET28a-R1L15HR2, pET28a-R1L25HR2, and pET28a-R1L35HR2
[0043] The following primers were designed (the underlined parts represent Nco I and Xho I restriction enzyme cutting site):
[0044] Nco I R1-L35 F:gaaggagatata CCATGG GCGATGTGGATGTGCTGATTAAATATCAGTTTAGCTTTGGCGGTGGCGGCAGTG,
[0045] 6 HIS Xho I HR2m R:ggtggtggtg CTCGAG CTGTTCATATTTGCCCAG;
[0046] Using the coding HR2 The plasmid pET28a-HR2 containing the gene (sequence shown in SEQ ID NO.4) was used as a template. R1 The gene sequence is shown in SEQ ID NO.3. PCR was used to amplify the R1L15HR2, R1L25HR2 and R1L35HR2 gene fragments (sequences shown in SEQ ID NO.5-7). The above gene fragments were ligated to the Nco I / Xho The pET28a linear vector was obtained by double enzyme digestion with I to obtain pET28a-R1L15HR2, pET28a-R1L25HR2 and pET28a-R1L35HR2 recombinant vectors.
[0047] 3. Expression and purification of R1L15HR2, R1L25HR2, and R1L35HR2
[0048] The obtained plasmids encoding R1L15HR2, R1L25HR2 and R1L35HR2 genes were transformed into Escherichia coli BL21 (DE3), and single clones were selected in LB medium and placed in 37 o C culture, and OD 600 Reach about 0.5. Add 0.5mM isopropyl-β-D-thiogalactopyranoside (IPTG) and incubate at 37 o C for 5 h. The cells were collected by centrifugation at 1,2000 × g for 3 min, suspended in lysis buffer (10 mM imidazole containing 0.1% Triton), disrupted by sonication, and centrifuged at 1,2000 × g for 10 min to collect the supernatant. The supernatant was then mixed with Ni-NTA at 4 o C binding for 30 min, and then use 20 mM, 30 mM, 50 mM and 100 mM imidazole to wash the impurities, and finally use 250 mM imidazole to elute the target protein. Finally, the purified protein was identified by SDS-PAGE and immunoblotting. The results are as follows: Figure 1 B and Figure 1 As shown in Figure C, all three peptides migrated to positions close to the expected molecular weight of the band.
[0049] Example 2
[0050] 1. Preparation of SARS-CoV-2 pseudovirus
[0051] 6.5 × 10 6 293T cells were plated in 10 cm cell culture plates to a cell density of approximately 80% before transfection. One hour before transfection, fresh culture medium was replaced with fresh medium. Transfection reagent (Transfection Reagentlipo2000, TR001) and the plasmid pNL4-3.Luc.RE expressing the Luciferase reporter gene and the plasmid pcDNA3.1-SARS-CoV-2-S expressing the SARS-CoV-2 S protein and its mutants (SARS-CoV-2 D614G, Beta, Delta, BA.1, XBB, BQ.1, BQ.1.1, BF7, BA4 / 5, BA.2, EG.5.1, BA.2.86, JN.1, and KP.2) were diluted in serum-free DMEM. The diluted transfection reagent was added dropwise to the diluted plasmid at a 1:1 ratio, mixed gently, and allowed to stand at room temperature for 20 minutes. The transfection working solution was added dropwise to the culture medium and allowed to stand at 37°C. oC 5% CO2 incubator. After 12 hours of transfection, discard the culture medium and replace with fresh cell culture medium. After 48-72 hours of transfection, collect the cell supernatant, centrifuge at 3000 × g for 10 minutes, aliquot, and store at -80 o CSave for future use.
[0052] 2. Pseudovirus inhibition test
[0053] Caco-2 cells were plated at 10 per well 4 Cells were plated in 96-well cell culture plates and cultured overnight to allow the cells to adhere to the wall and grow. R1L15HR2, R1L25HR2, R1L35HR2, HR2 and R1 peptides were diluted to the required experimental concentrations (R1L15HR2, R1L25HR2, R1L35HR2 starting concentrations of 3 μM, HR2 and R1 starting concentrations of 10 μM), and a 4-fold serial dilution was performed. Positive (SARS-CoV-2 pseudovirus + Caco-2 cells) and negative (Caco-2 cells) control wells were also set. SARS-CoV-2 pseudovirus was injected from -80 o After dissolving and mixing, add the diluted peptide drug and incubate at 37 o The mixture of peptide drug and SARS-CoV-2 pseudovirus was transferred into Caco-2 cells and incubated in a 37 o C overnight. Discard the peptide drug and pseudovirus, add an equal volume of fresh cell culture medium, and continue culturing for two days. Detect the luciferase enzyme activity (in relative light unit, RLU) according to the luciferase reporter gene assay kit, and calculate the IC of the peptide based on the result. 50 The inhibitory effect of peptide drugs on viruses was further evaluated.
[0054] The results are as follows Figure 2 As shown in Figure A, the inhibitory activities of R1L15HR2, R1L25HR2 and R1L35HR2 against SARS-CoV-2 were 158, 43 and 174 nM, respectively. The inventors then compared the inhibitory activities of R1L25HR2, R1, HR2 polypeptides and R1+HR2 mixture against SARS-CoV-2. The results showed that the R1 polypeptide alone had no significant inhibitory activity, while R1L25HR2 inhibited SARS-CoV-2 with an IC 50 was 78 nM, which is about 21 times that of HR2 peptide ( Figure 2 The above results indicate that the connection between peptides R1 and HR2 via a flexible linker (GGGGS) 5 can significantly enhance their anti-SARS-CoV-2 activity.
[0055] 3. Biofilm interferometry (BLI) affinity detection
[0056] First, the R1L25HR2 peptide was biotinylated using EZ-Link NHS-PEG12-biotin at a molar ratio of 1:3 (peptide:biotin). Unreacted biotin was then removed by ultrafiltration through a 3 kDa tube. The biotinylated R1L25HR2 peptide was diluted to 5 μg / ml in BLI buffer (0.02% Tween 20 in PBS). The peptides and proteins to be tested were then diluted two-fold for detection. Data were curve-fitted using ForteBio software, and k values were obtained. on 、k off and K D And other related parameters are shown in Table 1.
[0057] Table 1
[0058]
[0059] like Figure 3 As shown in Table 1, the affinities of R1L25HR2 to RBD and HR1 peptides were 5.02 nM and 0.85 nM, respectively. The results of this study indicate that after the N-terminus of the HR2 peptide was fused with the R1 peptide, it could target the SARS-CoV-2 RBD and HR1 targets, respectively, thereby enhancing its inhibitory activity against SARS-CoV-2.
[0060] 4. Washout experiment
[0061] Caco-2 cells were plated at 10 per well 4 The cells were plated in a 96-well cell culture plate and cultured overnight to allow the cells to adhere to the wall and grow. The experiment was divided into three groups. In the first group, the R1L25HR2 peptide was combined with SARS-CoV-2 at 37 o C in a carbon dioxide incubator for 30 min, and then the peptide and virus mixture was added to Caco-2 cells at 37 o In the second experiment, R1L25HR2 peptide was incubated with Caco-2 cells at 37 o After incubation in a carbon dioxide incubator at 37 °C for 30 min, the R1L25HR2 polypeptide was washed out with serum-free DMEM, and then SARS-CoV-2 was added to Caco-2 cells. o The third group of experiments was to culture DMEM with SARS-CoV-2 at 37 o C in a carbon dioxide incubator for 30 min, and then add the DMEM and virus mixture to Caco-2 cells. oCulture overnight at RT at RT. The next day, discard the supernatant and add an equal volume of fresh cell culture medium. Continue culturing for two more days. Measure luciferase activity (relative light units, RLU) using a luciferase reporter gene assay kit. Calculate the inhibitory effect for each experimental group based on the results.
[0062] The results are as follows Figure 4 It showed that R1L25HR2 was first incubated with target cells, then R1L25HR2 was washed away and added to SARS-CoV-2 to infect cells. At this time, R1L25HR2 had no obvious inhibitory effect on SARS-CoV-2; after R1L25HR2 was incubated with SARS-CoV-2 and then infected cells, it could significantly inhibit SARS-CoV-2 from infecting cells. This result shows that R1L25HR2 exerts its antiviral effect by acting on the virus.
[0063] 5. Time-of-addition experiment
[0064] Caco-2 cells were plated at 10 per well 4 The cells were plated in a 96-well cell culture plate and cultured overnight to allow the cells to adhere to the wall and grow. 1 μM R1L25HR2 peptide was added to the Caco-2 cells and incubated at 37 o The cells were placed in a carbon dioxide incubator at 37°C for 30 min, and then SARS-CoV-2 was used to infect Caco-2 cells. R1L25HR2 peptide was added 0, 1, 2, 4, 6, and 8 h after SARS-CoV-2 infection. o Culture overnight in a CO2 incubator at 4°C. The next day, discard the peptide drug and pseudovirus, add an equal volume of fresh cell culture medium, and continue culturing for two more days. Luciferase activity (relative light units, RLU) was measured using a luciferase reporter gene assay kit, and the inhibitory effect of the peptide was calculated based on the results.
[0065] The drug addition time measurement experiment was used to clarify the specific process of R1L25HR2 acting on virus-infected target cells. Figure 5 The results showed that when the R1L25HR2 peptide was added 2 hours after SARS-CoV-2 infected the target cells, its inhibitory activity was reduced to 80%. When the R1L25HR2 peptide was added 6 hours after the virus was infected, its inhibitory activity was only 40%. This result proves that R1L25HR2 acts in the early stage of virus entry into target cells.
[0066] 6. Virus adsorption inhibition test
[0067] Caco-2 cells were plated at 10 per well4 Cells were plated in 96-well cell culture plates and cultured overnight to allow the cells to adhere to the wall. 1 μM R1L25HR2 peptide was mixed with SARS-CoV-2 pseudovirus at 37 o Incubate at 4 °C for 30 min, and set up positive (SARS-CoV-2 pseudovirus + Caco-2 cells) and negative (Caco-2 cells) control wells. Rinse the cells with pre-chilled PBS, add the above samples to the cells, and incubate at 4 °C for 30 min. o C for 4 h. Discard the peptides and viruses, wash the cells twice with pre-cooled PBS, add 100 μl of complete culture medium, and incubate at 37 o C for 72 h. Luciferase activity (relative light unit, RLU) was measured using a luciferase reporter gene assay kit to analyze the inhibitory effect of the peptide drug on viral adsorption to target cells.
[0068] The mixture of R1L25HR2 peptide and SARS-CoV-2 pseudovirus was o C was incubated with Caco-2 cells to allow SARS-CoV-2 pseudoviruses to bind to the cell surface, unbound SARS-CoV-2 pseudoviruses were washed away, and the cells were then transferred to a 37 o C was further cultured. The results were as follows Figure 6 As shown, the fluorescence intensity of cells treated with R1L25HR2 polypeptide was significantly lower than that of cells not treated with polypeptide, indicating that R1L25HR2 can effectively block the process of virus adsorption to target cells.
[0069] 7. Cell-cell fusion inhibition assay
[0070] Caco-2 target cells were cultured at 10 4 37 cells / well were plated in 96-well plates. o C overnight, and the effector cells expressing EGFP and SARS-CoV-2 D614G S protein (293T / EGFP / D614G effector cells) were cultured at a rate of 2×10 4 / well and different concentration gradients of the peptide inhibitor to be tested were incubated at 37 o After incubation at 37°C for 30 min, target cells were added. o After culturing in a CO2 incubator at 4°C for 4-5 hours, examine the cell fusion status under a fluorescence microscope. If fusion is evident, fix the cells with 4% paraformaldehyde. Finally, calculate the fusion inhibitory activity of the test peptide based on the fusion status of each well.
[0071] The fusion inhibitory activity of R1L25HR2 was evaluated using S protein-mediated cell-cell fusion assay. Figure 7The results showed that the R1 peptide had no obvious S protein-mediated cell-cell fusion inhibitory activity at 50 μM, while the R1L25HR2 and HR2 peptides could completely inhibit S protein-mediated cell-cell fusion at 3 μM and 10 μM, respectively.
[0072] 7. Mutant pseudovirus inhibition test
[0073] The experimental procedures were the same as those for the pseudovirus inhibition assay, using R1L25HR2, HR2, and R1 peptides, and the mutant strains were those used in the preparation of the SARS-CoV-2 pseudovirus.
[0074] The inhibitory activity of the dual-target peptide R1L25HR2 was evaluated in a pseudovirus infection system with different mutant strains of SARS-CoV-2, such as Figure 8 A to Figure 8 The results of N in the assay showed that the R1 polypeptide had no significant inhibitory activity against the detected SARS-CoV-2 mutants, while both R1L25HR2 and HR2 had inhibitory activity against SARS-CoV-2 mutants, among which R1L25HR2 had better inhibitory activity, with an IC of 0.05 for SARS-CoV-2 D614G, Beta, Delta and Omicron series mutants. 50 The IC values of HR2 for inhibiting SARS-CoV-2 D614G, Beta, Delta and Omicron series mutants are between 5.3-253nM; 50 The range is between 0.3-5.2 μM. The above results indicate that R1L25HR2 has broad-spectrum anti-novel coronavirus activity.
[0075] 8. R1L25HR2 safety testing
[0076] R1L25HR2, HR2 and R1 peptides were serially diluted 4-fold in a 96-well plate, 100 μl per well, and added to target cells Caco-2 and Calu-6. o After culturing in a carbon dioxide incubator for 48 h, 5 μl of CCK-8 was added to each well and cultured for another 2 h. The OD 450 Cell viability was calculated based on the absorbance.
[0077] like Figure 9 A to Figure 9 As shown in Figure B, cells treated with different concentrations of R1L25HR2, R1, and HR2 showed no significant cytotoxicity. When R1L25HR2 and HR2 were incubated with cells at a high concentration of 100 μM, the viability of both Calu-6 and Caco-2 cells was above 90%, which was higher than the IC50 of R1L25HR2 for inhibiting SARS-CoV-2.50 It is about 20 times higher, indicating that it has good safety in inhibiting SARS-CoV-2 at the cellular level.
Claims
1. A dual-target peptide with broad spectrum anti-novel coronavirus SARS-CoV-2, characterized in that: The dual-target peptide comprises a peptide R1 targeting RBD in the novel coronavirus SARS-CoV-2 and a peptide HR2 targeting HR1 in the novel coronavirus SARS-CoV-2; The amino acid sequence of the polypeptide R1 is DVDVLIKYQFSF, and the amino acid sequence of the polypeptide HR2 is DVDLGDISGINASVVNIQKEIDRLNEVAKNLNESLIDLQELGKYEQ; The dual-target polypeptide comprises polypeptide R1, linker, and polypeptide HR2 from N-terminus to C-terminus; The linker is a flexible linker (GGGGS) n , n=3-10, and n is an integer.
2. The dual-target polypeptide according to claim 1, wherein n=3, 5 or 7.
3. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the dual-target polypeptide according to claim 1.
4. A recombinant vector, characterized in that The recombinant vector comprises the nucleic acid molecule according to claim 3.
5. A host cell, characterized in that The host cell comprises the recombinant vector according to claim 4.
6. Use of the dual-target polypeptide according to claim 1, the nucleic acid molecule according to claim 3, the recombinant vector according to claim 4, or the host cell according to claim 5 in the preparation of a drug for preventing or treating diseases caused by coronavirus infection; The coronavirus is the novel coronavirus SARS-CoV-2 and / or a variant strain of the novel coronavirus SARS-CoV-2; The novel coronavirus SARS-CoV-2 variant is at least one of the D614G, Beta, Delta and Omicron series variants; The Omicron series variants are BA.1, XBB, BQ.1, BQ.1.1, BF7, BA4 / 5, EG.5.1, BA.2.86, JN.1 or KP.
2.
7. The use according to claim 6, characterized in that The disease caused by the coronavirus infection is a respiratory system infection.
8. A pharmaceutical composition, characterized in that The pharmaceutical composition contains the dual-target polypeptide according to claim 1, the nucleic acid molecule according to claim 3, the recombinant vector according to claim 4 or the host cell according to claim 5, and a pharmaceutically acceptable carrier.
Citation Information
Patent Citations
Polypeptide for resisting novel coronavirus and application thereof
CN114437184A
Polypeptide for resisting novel coronavirus and application thereof
CN115925826A
Application of affinity peptide in preparation of anti-coronavirus drug
CN112876540A
Fusion lipopeptide for inhibiting coronavirus
WO2024213127A1