Saccharomyces cerevisiae, rubiae yeast liquid, rubiae and application of rubiae in fermented wheaten food
By using Saccharomyces cerevisiae CGMCC No. 32189 to prepare Lupin species, the problem of complex and difficult to control the preparation process of existing Lupin species is solved, rapid fermentation and yielding glycerin are achieved, and the flavor and shelf life of pasta are improved.
Patent Information
- Application Number
- CN202510277702.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-06-06
AI Technical Summary
During the preparation process, the existing Lupin species have problems such as long cultivation time, complex process, difficult to control, easy contamination of the final product, and unstable flavor, and are difficult to be used for large-scale production.
Saccharomyces cerevisiae is provided with storage number CGMCC No. 32189, used to prepare Lupin species. Through the fermentation process of the yeast, the fermentation speed of pasta is accelerated, the pH of the fermentation system is reduced, the flavor and taste of pasta is improved, and the storage time and taste period are extended.
It has achieved rapid fermentation of sugar and yielded glycerol, improved the yield and quality of Lupin species, simplified the preparation process, and extended the shelf life and tasting period of pasta.
Smart Images

Figure CN120098811A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of fermentation, and in particular to brewer's yeast, Lupin yeast liquid and Lupin yeast, and applications of the same in fermented pasta. Background Art
[0002] Bread is a food made from wheat flour and / or other cereal products through fermentation, baking and other processes. Most of the bread sold on the market is fermented and produced with active dry yeast, which is characterized by high efficiency, convenience and stable performance. However, due to the single active dry yeast product, the bread products produced have a single flavor and poor taste. In addition, bread is prone to aging and crumbing, and is easily contaminated, leading to microbial reproduction, and chemical preservatives are often added to extend the shelf life.
[0003] Lupin seed is a sourdough starter, usually made from processed grain products. Bread prepared with Lupin seed has the advantages of unique flavor, high nutritional value, good quality, and long shelf life, and has been increasingly recognized and sought after by consumers in recent years. However, since the preparation of Lupin seed is affected by multiple factors such as the type of raw materials or origin, it usually takes several days to start the seed to ensure the stability of the microbial strain, and it is also necessary to continue the seeding to ensure high microbial activity. There are problems such as long culture time, complex culture process, difficult to control preparation process, easy contamination of the final product, and unstable flavor, making Lupin seed difficult to use for large-scale production and limited to families and workshops.
[0004] Therefore, there is an urgent need to develop a strain that can improve the flavor and taste of fermented pasta, extend the shelf life and tasting period of fermented pasta, and a Lupin strain prepared from the strain. Summary of the invention
[0005] The purpose of the present invention is to overcome the above problems existing in the prior art and to provide a brewer's yeast, a Lupin yeast liquid and a Lupin yeast and their application in fermented pasta.
[0006] In order to achieve the above object, the present invention provides a Saccharomyces cerevisiae, the deposit number of which is CGMCC No.32189.
[0007] A second aspect of the present invention provides a bacterial agent, wherein the bacterial agent contains the brewer's yeast as described above.
[0008] The third aspect of the present invention provides a Lupin seed, which is obtained by fermenting the brewer's yeast as described above.
[0009] A fourth aspect of the present invention provides the use of the above-mentioned brewer's yeast in fermented pasta.
[0010] A fifth aspect of the present invention provides the use of the above-mentioned brewer's yeast in improving the taste of fermented pasta.
[0011] A sixth aspect of the present invention provides the use of the above-mentioned brewer's yeast in extending the shelf life of fermented pasta.
[0012] Through the above technical solution, the beneficial effects obtained by the present invention include at least:
[0013] (1) The brewer's yeast with a deposit number of CGMCC No. 32189 provided by the present invention and the prepared Lupin species fermentation broth can quickly decompose sugars in the system and produce high amounts of Lupin species and glycerol compared to Lupin species fermentation broth prepared by commercial yeast;
[0014] (2) The Lupin species and Lupin species fermentation liquid prepared using the brewer's yeast with the deposit number CGMCC No. 32189 provided by the present invention can accelerate the fermentation speed of pasta, reduce the pH of the fermentation system, improve the flavor and taste of pasta, and prolong the storage time and tasting period of pasta.
[0015] Biological Deposit
[0016] The strain provided by the present invention is classified and named as Saccharomyces cerevisiae, and was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (abbreviated as CGMCC) on October 12, 2024. Its deposit number is CGMCC No.32189, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figure 1 It is a colony morphology diagram of the brewer's yeast provided by the present invention;
[0018] Figure 2 The figure is a cell morphology diagram of the brewer's yeast provided by the present invention. DETAILED DESCRIPTION
[0019] The endpoints and any values of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, the endpoint values of each range and the individual point values, and the individual point values can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.
[0020] The inventor of the present invention isolated a strain that grows fast, ferments sugar quickly, and produces more glycerol from the epidermis of wheat fruits in the field of Getang Street, Jiangbei New District, Nanjing City, Jiangsu Province during the research process. Figure 1-2As shown, the colonies of the strain are shiny milky white dots with neat edges, uniform texture, and easy to pick; the cell morphology under the microscope is round and oval, and budding reproduction. The ITS1 / ITS4 of the isolated strain was cloned and sequenced (commissioned by Invitrogen Shanghai Trading Co., Ltd.), and the nucleotide sequence of its ITS1 / ITS4 gene is as follows. The ITS1 / ITS4 sequence of the strain is compared with the sequence of Saccharomyces cerevisiae, and the similarity between the ITS1 / ITS4 sequence of the strain and the sequence of Saccharomyces cerevisiae reaches 99.99%. The 16S rDNA of the strain is shown in SEQ ID No.1.
[0021] SEQ ID No.1:
[0022] GAAATTTAATAATTTTGAAATGGATTTTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAA TTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTTAACAAACACAAACAATTTTATCTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTC TTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAA TTGCTGGCCTTTTCATTGGATGTTTTTTTTTCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGtcTTAAAGTTTGACCTCAAATC
[0023] Based on the above findings, the present invention provides a first aspect of Saccharomyces cerevisiae, wherein the deposit number of the Saccharomyces cerevisiae is CGMCC No.32189.
[0024] A second aspect of the present invention provides a bacterial agent, wherein the bacterial agent contains the brewer's yeast as described above.
[0025] In order to ensure the activity of brewer's yeast in the bacterial agent, preferably, the bacterial agent contains a protective agent, and the protective agent can be selected from at least one of skim milk powder, maltodextrin, trehalose, dextran and glycerol.
[0026] Preferably, the bacterial agent contains a buffer, and the buffer can be selected from at least one of PBS buffer, citrate buffer and acetate buffer.
[0027] In the present invention, there is no particular limitation on the specific type of the fermentation agent, which can be any existing agent type in the art. According to a preferred embodiment of the present invention, the fermentation agent is at least one of a liquid fermentation agent, a semi-liquid fermentation agent and a solid fermentation agent.
[0028] In the present invention, there is no particular limitation on the specific content of the brewer's yeast contained in the fermentation bacteria. The content of the brewer's yeast in different types of fermentation bacteria may be the same or different.
[0029] Preferably, in terms of viable bacteria count, the content of the brewer's yeast in the aforementioned bacterial agent is 10 4 CFU / mL of bacterial agent or more, for example, the content of the brewer's yeast in the liquid fermentation bacterial agent is 10 6 CFU / mL or more, more preferably 10 7 -10 8 CFU / mL; in the semi-liquid fermentation agent, the content of the brewer's yeast is 10 7 CFU / mL or more, more preferably 10 7 -10 9 CFU / mL; in the solid fermentation agent, the content of brewer's yeast is 10 8 CFU / g or more, more preferably 10 9 -10 10 CFU / g.
[0030] In the present invention, 10 4 CFU / mL refers to 10 4 CFU / mL level, where 1×10 4 CFU / mL, 5×10 4 CFU / mL and 9.999×10 4 CFU / mL and so on are all 10 4 CFU / mL level, that is, 10 4 The CFU / mL level refers to 1×10 4 CFU / mL to less than 1×10 5 The CFU / mL range.
[0031] In the present invention, the bacterial agent can be prepared in any conventional manner in the art in any conventional culture medium, as long as it can be used for brewer's yeast fermentation, for example, it can be YPD medium, molasses medium, barley extract medium (wort medium), etc.
[0032] The third aspect of the present invention provides a Lupin seed, which is obtained by fermenting the brewer's yeast as described above.
[0033] In the present invention, Lubang seeds refer to fermented products of raw materials such as grains and processed products thereof, and the grains and processed products thereof generally refer to grain flour, which can be any type of grain used for (fermented) food preparation in the art, such as (grain) raw material flour used in conventional foods such as wheat, barley, and rice, and also such as rye, buckwheat, oats, corn, soybeans, and other grain raw material flours. According to the present invention, preferably, the raw materials used for the fermentation contain wheat flour and / or rice flour.
[0034] Preferably, the fermentation temperature is 30-35°C.
[0035] Preferably, the fermentation time is 2-5 hours.
[0036] According to some embodiments of the present invention, the pH of the Lupin seed product obtained by fermentation is preferably less than 5, and the total acid is preferably greater than 3 g / L.
[0037] According to the present invention, in order to obtain Lupin seeds with better fermentation effect, the method for preparing Lupin seeds may also include: inoculating the brewer's yeast or bacterial agent as described above into a culture medium containing flour and / or rice flour for fermentation, collecting the bacteria when the sugar content is lower than 2.5°P to obtain Lupin seed yeast liquid, and then activating the Lupin seed yeast liquid with salt water before fermenting.
[0038] According to one embodiment of the present invention, the temperature for preparing the Lupin yeast solution is 25-35°C.
[0039] Preferably, the fermentation raw material also contains a metal salt, and the metal salt is preferably sodium chloride.
[0040] A fourth aspect of the present invention provides the use of the above-mentioned brewer's yeast in fermented pasta.
[0041] According to the present invention, the fermented pasta preferably uses the Lupin species prepared by brewer's yeast as described above. Furthermore, in order to improve the taste, taste and shelf life of the pasta, the fermented pasta may also use the Lupin species yeast liquid as described above.
[0042] According to the present invention, the fermented raw materials used in the fermented pasta include wheat flour and / or rice flour.
[0043] According to the present invention, the method for fermenting pasta may include adding the brewer's yeast or bacterial agent as described above to the fermentation raw materials, but preferably, the brewer's yeast or bacterial agent is provided in the form of Lupin yeast liquid as described above.
[0044] It is understandable that in order to obtain a better fermentation effect, the method for fermenting pasta may also include adding other strains and / or bacterial agents. The strain may be a strain commonly used in the art for fermenting pasta, or a strain that is not commonly used for fermenting pasta but has a fermentation function. However, as long as the strain provided by the present invention is used, it falls within the protection scope of the present invention.
[0045] In the present invention, when fermenting pasta, the specific amount of the Lupin seed is not particularly limited, and it can be adjusted according to actual needs (such as the type of specific fermented bread, the characteristics of the fermentation raw materials, etc.), but in order to further control the fermentation cost and improve the fermentation effect, by weight, preferably, the amount of the Lupin seed is 30-50wt% of the fermentation raw material, for example, it can be 30wt%, 31wt%, 32wt%, 33wt%, 34wt%, 35wt%, 36wt%, 37wt%, 38wt%, 39wt%, 40wt%, 41wt%, 42wt%, 43wt%, 44wt%, 45wt%, 46wt%, 47wt%, 48wt%, 49wt% and 50wt% or the range formed by any two of the above values and the values within the range. In order to further improve the fermentation effect, the amount of the Lupin seed is preferably 35-45wt% of the fermentation raw material.
[0046] A fifth aspect of the present invention provides the use of the above-mentioned brewer's yeast in improving the taste of pasta.
[0047] A sixth aspect of the present invention provides the use of the above-mentioned brewer's yeast in extending the shelf life of pasta.
[0048] According to the present invention, the brewer's yeast provided by the present invention can not only improve the taste of freshly made pasta, but also maintain the taste of bread for a longer period of time by delaying the aging of bread.
[0049] According to the present invention, the brewer's yeast provided by the present invention can prolong the shelf life of pasta by inhibiting the reproduction of bacterial colonies (at least including molds).
[0050] The present invention will be described in detail below by way of examples. In the following examples, unless otherwise specified, the raw materials used in the present invention can be obtained commercially.
[0051] Solid malt extract: purchased from Huankai Microbiology Company, product number 021120;
[0052] Yeast nutrient salt: purchased from Green View Biological Company, product number CB2311;
[0053] Control yeast: Angel semi-dry yeast, purchased from Angel Yeast Co., Ltd.;
[0054] YPD liquid medium: 1wt% yeast powder, 2wt% peptone, 2wt% glucose, and the balance is water. Mix well and heat to dissolve. Autoclave at 121℃ for 15-20min to obtain YPD liquid medium. Add 10wt% agar powder before sterilization. After sterilization, cool to about 50℃ and pour into a plate. After cooling and solidification, obtain a YPD plate.
[0055] Wort medium: solid malt extract 10wt%, yeast nutrient salt 2wt%, the balance is water, keep warm at 80℃ for 30min, and sterilize at 121℃ for 15-20min;
[0056] Red Bengal agar medium: based on 1L of medium, peptone 5g, glucose 10g, potassium dihydrogen phosphate 1g, magnesium sulfate 0.5g, agar 15g, red Bengal 0.03g, chloramphenicol 0.1g, pH 7.2±0.2, the balance is water;
[0057] MRS medium: based on 1L of medium, peptone 10g, glucose 20g, potassium dihydrogen phosphate 2g, magnesium sulfate 0.2g, Tween 80 1g, manganese sulfate 0.04g, sodium acetate 5g, diammonium hydrogen citrate 2g, yeast powder 4g, beef powder 8g, pH 5.7±0.2, the balance is water;
[0058] Mixed culture medium: 14wt% wheat flour, 7wt% rice flour, 2wt‰ α-amylase, the balance is water, keep warm at 80°C for 30min, sterilize under high pressure at 121°C for 20min and set aside.
[0059] Example 1
[0060] The isolated strain was cultured on a YPD plate at 28±1℃ for 48 hours until colonies with a diameter of about 3 mm were grown. Figure 1 As shown, the colonies are shiny milky white dots with neat edges, uniform texture and easy to pick. Figure 2The cell morphology of the strain under the microscope is round or oval, and the cells of the strain are budding. Under the condition of pH=7, the strain was inoculated in YPD medium with a sugar concentration of 25wt% at temperatures of 20°C, 25°C, 30°C, 35°C, 40°C and 45°C to observe the growth of the strain. The results show that the strain can grow normally in the temperature range of 20-40°C; under the condition of pH=7, the strain was inoculated in YPD medium with glucose concentrations of 1wt%, 10wt%, 20wt%, 30wt%, 35wt% and 40wt%, cultured at 30°C and observed the production of the strain. The results show that the strain can grow normally at a sugar concentration of 1-30wt%. The above results show that the strain can tolerate a maximum temperature of 40°C and a sugar concentration of 30wt%.
[0061] The screened strains were physiologically and biochemically identified using the French Mérieux API identification system, and the identification results showed that the strain was Saccharomyces cerevisiae. The ITS1 / ITS4 of the isolated strain was cloned and sequenced (commissioned by Invitrogen Shanghai Trading Co., Ltd.), and the nucleotide sequence of its ITS1 / ITS4 gene is shown in SEQ ID No: 1. The ITS1 / ITS4 sequence of the strain of the present invention was compared with the sequence of Saccharomyces cerevisiae. The ITS1 / ITS4 sequence of the strain of the present invention and the sequence similarity of Saccharomyces cerevisiae reached 99.99%. It was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on October 12, 2024, and the deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 32189, hereinafter referred to as strain Y27.
[0062] Example 2
[0063] After strain Y27 was activated and cultured on a YPD plate at 30°C for 48 h, a single activated yeast was picked and inoculated into a centrifuge tube containing 20 mL of wort medium. The number of live yeast cells was about 10 6 CFU / mL, 30℃, 200rpm constant temperature shaker culture for 24h; after 10 times magnification culture for 3 rounds, inoculate into a 50L fermenter (containing 40L wort medium). Then the fermenter temperature is 30℃, ventilation and stirring culture, and samples are taken before and after inoculation, and every 8h during the culture process to measure the sugar content of the fermentation liquid. When the sugar content of the fermentation liquid drops to 2.5°P, the culture is terminated. After the end, cool down to 4℃ and transfer to a 10L sterile barrel, and naturally settle in a 4℃ cold storage for 48h until the number of yeast in the supernatant is less than 10 6 CFU / mL, remove the supernatant and obtain concentrated yeast, which is the yeast fermentation agent.
[0064] Example 3
[0065] The yeast fermentation agent obtained in Example 2 was inoculated into a 50 L fermentation tank (containing 40 L of mixed culture medium) at an inoculation rate such that the number of live yeast cells was 1 × 10 6 CFU / mL, fermentation tank temperature 30℃, ventilation and stirring culture, measure the sugar content of fermentation liquid every 8h, and end the culture when the sugar content drops to 2.5°P. After the end, cool down to 4℃ and transfer to a 10L sterile barrel, and let it settle naturally in a 4℃ cold storage for 48h until the yeast count in the supernatant is less than 10 6 / mL, remove the supernatant to obtain concentrated yeast, which is the Lupin yeast solution (stock solution) SC-L1.
[0066] In addition, a control group of control yeast was set up, and after the fermentation agent was prepared according to the method described in Example 2, Lupin yeast solution (stock solution) SC-L2 was prepared according to the method of this example.
[0067] During the fermentation process, the density meter Anton Paar Density Meter DMA 4500M was used to detect the change of sugar content (in °P) every 4-8 hours. The results are shown in Table 1. In addition, the methylene blue staining method was used to observe and analyze the yeast morphology under a microscope, measure the number of yeast cells and measure the activity of yeast. When the sugar content of the culture solution dropped to 2.5 °P or below and the yeast count reached 6×10 8 CFU / mL or more, and the cells have no budding, and the yeast cell activity is ≥99% when the culture is terminated. Yeast cell number determination method: Pipette 1mL of fermentation liquid into a 10mL graduated test tube, add 1mL of 0.2wt% methylene blue dye solution, mix well and add to the upper and lower counting chambers of the hemocytometer, let it stand for 2 minutes, and then detect the number of yeast cells under a 40x microscope. Live yeast is transparent and dead yeast is blue. Yeast cell activity is calculated based on the number of live yeast cells and total yeast cells, where yeast cell activity = number of live yeast / total number of yeast × 100%, in %.
[0068] Table 1
[0069] Group 0h 8h 16h 20h 24h SC-L1 9.8 8.8 5.8 2.5 2 SC-L2 9.8 9 6.8 5 2.5
[0070] As shown in Table 1, compared with the commercial control yeast, the strain Y27 provided by the present invention has a faster sugar reduction rate. The sugar content can be reduced to 2.5°P after culturing for 20 hours, reaching the end of fermentation. Microscopic examination results show that the yeast count at this time reaches 6×10 8 / mL, the yeast activity is 100%, and the yeast cells have no budding. In contrast, the sugar content of commercial yeast only drops to 5°P after 20 hours of cultivation, and the sugar content only drops to 2.5°P after 24 hours of cultivation.
[0071] Weigh the Lupin yeast solution (stock solution) and record its weight a. Take 1g of Lupin yeast solution (stock solution) and spread it on the YPD plate after gradient dilution. After culturing at 28℃ for 72h, calculate the number of viable yeast cells b (CFU / mL). According to the following formula, the yeast concentration that can be produced per kilogram of solid malt extract is 3×10 9 The weight of the finished Lupin yeast solution in CFU / mL (in kg / kg malt extract).
[0072] Finished Lupin yeast liquid weight = (a×b) / (3×10 9 × the weight of solid malt extract in the culture medium).
[0073] The yield of the finished product of the Lupin yeast solution (stock solution) SC-L1 was 2kg / kg malt extract, while the yield of the Lupin yeast solution (stock solution) SC-L2 was 1kg / kg malt extract. That is, the brewer's yeast Y27 provided by the present invention is more suitable for preparing Lupin seeds.
[0074] When the Lupin yeast solution was cultured to the end of fermentation, the fermentation solution was taken and filtered with a filter membrane with a pore size of 0.45 μm to obtain the test solution. The glycerol concentration in the test solution was detected by HPLC. Chromatographic column: Aminex HPX-87H (300 mm × 7.8 mm), column temperature: 65 ° C; mobile phase: 0.005 mol / L H 2 SO 4 , flow rate 0.6mL / min; the detector is a differential detector, and the injection volume is 20μL.
[0075] At the end of the culture, the glycerol concentration in the culture solution was 16.35 g / L, and the commercial control yeast was 3.26 g / L. Since glycerol in food has the effect of reducing water activity, it plays an important role in slowing down bread aging, inhibiting the growth of contaminating microorganisms and extending the shelf life of bread. Therefore, the yeast solution prepared by the yeast provided by the present invention is more suitable for fermenting bread due to its strong glycerol production ability.
[0076] Example 4
[0077] Preparation method of Lupin seed:
[0078] (1) Optimized Lupin seed L1: Add an equal weight of sodium chloride aqueous solution with a concentration of 2 wt% to the Lupin seed yeast solution (stock solution) SC-L1 prepared in Example 3, keep it warm at 35°C for 1.5 hours to activate it, and then add an equal weight of T55 flour, stir evenly, keep warm at 35°C and ferment until the pH is ≤4 and the total acid is ≥3g / L, to obtain the optimized Lupin seed L1, and record the pH and time used at this time. The prepared optimized Lupin seed can be stored for more than 3 months under refrigeration at 4°C.
[0079] (2) Commercially purchased Lupin strain L2: Prepared according to the optimized Lupin strain preparation method, except that the Lupin strain yeast solution (stock solution) SC-L1 was replaced by SC-L2.
[0080] (3) Natural Lupin Seed L3: Use rye flour and water in a weight ratio of 1:1, add 0.5wt% malt extract, stir evenly, ferment at 30℃ until the volume is 2-3 times larger and the pH is about 6.3, then add an equal weight of T55 flour and mix with water, and stir until there are no powder particles. Ferment at 30℃ until the pH is 4.1, move to the refrigerator for refrigeration, take out and stir once a day and measure its pH value. It is measured that the pH value decreases by about 0.1 every day. When the pH is less than 3.8, the natural Lupin Seed L3 is obtained, and the pH at this time and the time used are recorded.
[0081] pH determination method: 1 g of Lupin seed was mixed with 9 mL of sterile distilled water and homogenized for 2 min, and the pH value was determined using a pH meter.
[0082] Yeast number determination method: Take 25g of each of Lupin species L1, L2 and L3, respectively, and place them in a sterile homogenizing bag containing 225mL of physiological saline. Beat with a slapping homogenizer for 2 minutes to obtain a homogenous solution, and then dilute the homogenous solution 10 times in a gradient. Take 1mL of each gradient dilution in a sterile plate, add 20mL of sterilized Bengal red agar medium cooled to 46°C to the plate, and shake gently to mix the diluted homogenous solution with the medium. Place the plate in a constant temperature incubator at 28°C and culture for 5 days. Select the plate with a total colony count of 10CFU-150CFU, and record the number of "pink, round protrusions" colonies. The results are shown in Table 2.
[0083] Table 2
[0084] project L1 L2 L3 pH 3.68 3.74 3.78 Preparation time, h 3.5 4.5 96 Yeast count, CFU / g Lupin species <![CDATA[8×10 8 ]]> <![CDATA[5×10 8 ]]> <![CDATA[3×10 8 ]]>
[0085] Compared with the natural Lupin seed L3, the yeast provided by the present invention can prepare high-quality Lupin seed using ordinary flour, without using special flours such as rye flour that are high in cost and have limited varieties and origins. The pH drops to 3.68 after 3.5 hours of preparation time, and the yeast count can reach 8×10 8 Therefore, the yeast of the present invention has the characteristics of high activity, fast fermentation speed and fast acid production, so that the process of preparing the Lupin seed by the yeast can shorten the production cycle, improve the utilization rate of equipment and space, reduce labor intensity, reduce material loss rate and microbial contamination, and is very suitable for the standardized production of Lupin seed.
[0086] HS-SPME / GC-MS was used to analyze the volatile flavor substances. 3 g of Lupin seed was taken into a headspace bottle, 5 mL of saturated saline was added, and then 100 μL of trichloropropane (10 mg / L) internal standard solution was accurately added. The bottle stopper was quickly tightened and sealed, and shaken for testing.
[0087] Headspace solid phase microextraction (HS-SPME) conditions: extraction fiber, Carboxen / DVB / PDMS 50 / 30, 2 cm; extraction temperature, 40 °C, extraction time, shaking 15 min, extraction 30 min, shaking speed 250 r / min; analysis time was 5 min.
[0088] Gas chromatography-mass spectrometry (GC-MS) conditions: chromatographic column, DB-WAX 57CB (50m×0.25mm×0.2μm); injection temperature, 250°C, carrier gas, helium (99.999vol%); flow rate: 1mL / min, non-split injection; column temperature was 40°C, maintained for 3min, increased to 180°C at 4°C / min, maintained for 1min, then increased to 220°C at 10°C / min, and retained for 2min; interface temperature was 280°C; ion source temperature was wei9230°C; quadrupole temperature was 150°C; ionization mode was EI, 70eV, emission current was 200μA; scanning mode was full scan, and the mass range was 30-500.
[0089] Normal alkanes (C7-C40) were injected and analyzed under the same chromatographic conditions, and the retention index (RI) was calculated according to the following formula. The top 200 peaks in the GC-MS analysis of the sample were screened according to the peak area and matched to obtain substances with a matching degree of >80%, and the RI value of each substance in the sample was calculated. The RI literature value was retrieved in combination with the NIST 14 spectral library, and the calculated value was compared with the literature value. Compounds with an absolute value difference of less than 100 were determined to be the same compound.
[0090]
[0091] Where: n and n+1 are the carbon number of the n-alkanes before and after the target outflow; t is the retention time of the target; t n and t n+1 is the retention time of the corresponding normal alkanes.
[0092] The content of the determined compound was quantitatively analyzed according to the following formula:
[0093]
[0094] Where, X is the relative content of flavor compounds in the sample (mg / L); V i V is the volume of internal standard added to the sample (mL); s is the volume of sample solution added to the headspace bottle (mL); c i is the concentration of the internal standard solution (mg / L); i is the internal standard peak area intensity; I sis the peak area intensity of flavor compounds.
[0095] The aroma characteristics of volatile compounds reported in the literature were compared to screen flavor compounds, and the characteristic aroma compounds in Lupin species were determined using relative odor activity values (ROAV) as an indicator. If a compound has a ROAV ≥ 1, it indicates that it contributes to the flavor of the sample, where ROAV = relative content of volatile compounds / odor threshold.
[0096] It has been determined that Lupin L1 contains flavor components such as isopentanol, phenylethyl alcohol, methyl ethylbutyrate, ethyl hexanoate, ethyl octanoate and nonanal. In addition, there are also small amounts of acids, ketones and other substances.
[0097] Isoamyl alcohol is the main alcohol substance that contributes to the flavor of Lupin, providing a strong fermentation aroma to the sourdough. The ROAV of Lupin L1 isoamyl alcohol is greater than 900, the ROAV of Lupin L2 is between 400-700, and the ROAV of Lupin L3 is less than 145.
[0098] Esters are usually formed during the fermentation process or by the esterification reaction between low-level saturated fatty acids and alcohols, which can provide special flavors for sourdough and bread. The ester compounds with ROAV>1 in Lupin species L1 are methyl butyrate, ethyl caproate and ethyl caprylate, among which ethyl caproate ROAV>140000 has pleasant fruity, sweet and wine aromas. The ROAV of ethyl caproate in Lupin species L2 and L3 is less than 8000.
[0099] Lupin L1 also contains nonanal with ROAV>400. The production of nonanal may come from the fermentation of microorganisms, giving Lupin a pleasant rose and citrus aroma.
[0100] In addition, Lupin L1 also contains a small amount of acids, ketones and other substances. Among them, the main contributing acid substance is caproic acid, which gives Lupin a soft cheese aroma.
[0101] (4) Sensory evaluation
[0102] Twenty professionals engaged in baking-related industries served as judges (10 males and 10 females) to conduct sensory evaluations on the flavors of Lupin. The sensory scoring criteria are shown in Table 3, and the results are shown in Table 4.
[0103] Table 3
[0104]
[0105] Table 4
[0106] Sample name Wheat flavor Fermented taste Odor L1 8.00 8.67 8.67 L2 6.93 6.54 8.02 L3 6.67 7.00 7.33
[0107] Compared with the Lupin seed prepared by natural seed starting, the Lupin seed prepared by the yeast of the present invention has a better wheat flavor, a distinct fermentation aroma, a strong Ginjo aroma, and basically no peculiar smell.
[0108] Example 5
[0109] 40g of Lupin yeast solution (stock solution) SC-L1, SC-L2 and SC-L3 prepared in Example 3 were added to 500g of water and 20g of salt, fully mixed at 35°C, put into a dough mixer, 1000g of flour was added, and 400g of Lupin species L1, L2 and L3 prepared in Example 4 were added respectively, and doughs M1, M2 and M3 were obtained after stirring for 8-10min. 50g of dough was quickly placed in a 250mL measuring cylinder, pressed to make the inside of the measuring cylinder tight and without gaps, and the dough surface was ensured to be flat, and then placed in a 30°C constant temperature incubator for fermentation, and the number of measuring cylinder scales reached by the dough was recorded every 60min. The increase in the volume of the fermented dough in a 30°C constant temperature incubator within 180min was used as the fermentation power evaluation, and the increase in the volume of the dough (in mL) varied with the fermentation time as shown in Table 5. The control yeast addition amount was 1wt% of the flour.
[0110] Table 5
[0111] Dough serial number 0min 60min 120min 180min 240min 300min M1 0 43 66 86 95 98 M2 0 30 56 75 90 94 M3 0 32 50 68 84 91
[0112] It can be seen from Table 5 that the Lupin yeast liquid prepared by the strain provided by the present invention and the dough prepared by the Lupin strain have a fast fermentation time and a larger final volume increase value.
[0113] Example 6
[0114] To 500 g of water and 20 g of salt, 40 g of the Lupin yeast solution (stock solution) SC-L1 and SC-L2 prepared in Example 3 were added respectively, and the mixture was fully mixed at 35° C., and the mixture was put into a dough mixer, 1000 g of flour was added, and 400 g of the Lupin yeast L1 and L2 prepared in Example 4 were added respectively, and the dough was taken out after stirring for 8-10 min, and relaxed at room temperature for about 15 min. The dough was divided into blocks (about 80 g / dough), and after proofing for 1.5 h at 30° C. and a relative humidity of 85%, the dough was put into an oven, and the upper temperature was 190-200° C., the lower temperature was 180-190° C., and the time was 20 minutes, to obtain bread made with the yeast provided by the present invention (SC-L1+L1) and bread made with commercial yeast (SC-L2+L2), respectively.
[0115] After the baked bread has cooled for 1 hour, take the bread sample and cut it into 15mm thick slices with a slicer. Take the three slices in the middle of the bread and use the TPA mode of the texture analyzer to measure the hardness, adhesion, elasticity, cohesion, chewiness and recovery of the bread sample to evaluate its texture characteristics. Parameter settings: probe model P / 36, probe movement rate 1.0mm / s before test, probe movement rate 3.0mm / s during extrusion test, probe movement rate 3.0mm / s after extrusion, compression deformation 50%, induction force 5g, and the time interval between two compressions is 1s. The results are shown in Table 6.
[0116] Table 6
[0117]
[0118]
[0119] It can be seen from Table 6 that the hardness, adhesion and chewiness values of the bread made with the brewer's yeast provided by the present invention are smaller, and the elasticity, cohesion and resilience values are larger, indicating that the bread fermented with brewer's yeast CGMCC No. 32189 has a fluffy internal structure, uniform and dense pores, and good gas retention performance.
[0120] The sensory evaluation of the prepared bread was carried out according to the method of Example 4. The bread made with the brewer's yeast provided by the present invention had a strong cereal flavor, milk flavor and special ginjo aroma, and the bread tasted soft and chewy, refreshing and non-sticky.
[0121] Example 7
[0122] (1) Aging property test:
[0123] Bread staling is affected by many factors, such as the type of starch in the bread, the moisture content of the bread, etc. Bread staling occurs during the storage process of bread, and is manifested by the bread texture becoming tighter, the inner core becoming harder, the bread being easy to fall off, and the flavor being lost, etc. The change in starch crystallization rate can indirectly reflect the staling characteristics of bread.
[0124] The bread prepared in Example 6 was cut into slices with a thickness of 15 mm, stored in a ziplock bag, and placed in a refrigerator at a temperature of 4° C. The hardness value of the bread was measured according to the method of Example 6, and the starch crystallization rate was calculated by the following formula. The crystallization rate results are shown in Table 7.
[0125] R=(H t -H 0 ) / t×100%, where R is the starch crystallinity; H t is the hardness value of the bread on day t; H 0 is the initial hardness value of the bread; t is the number of days the bread is stored at 4°C; the unit is %.
[0126] Table 7
[0127] Group 0d 3d 6d 9d 12d 15d SC-L1+L1 0 0.67 0.67 3.77 6.18 8.94 SC-L2+L2 0 0.67 12.01 19.46 23.34 26.81
[0128] It can be seen from Table 7 that during the storage of bread, the starch crystallization rate gradually increases with the extension of storage time, but the crystallization rate of bread made by the strain provided by the present invention is much lower than that of the control group. The bread prepared by the yeast of the present invention exhibits better anti-aging properties.
[0129] (2) Shelf life test:
[0130] The total colony count detection method refers to GB 4789.2-2016 "National Food Safety Standard for Food Microbiological Inspection - Determination of Total Colony Count", and the mold detection method refers to GB 4789.15-2016 "National Food Safety Standard for Food Microbiological Inspection - Mold and Yeast Count" for determination.
[0131] The samples were stored at a temperature of 25±1°C and a relative humidity of 70±5%RH. Samples were taken every 3 days to determine the total number of colonies and the number of mold and yeast (in CFU / g). The results are shown in Table 8.
[0132] Table 8
[0133]
[0134] It can be seen from Table 8 that during the shelf life test, the total number of colonies and mold counts in the bread showed a trend of continuous increase. However, the total number of colonies and mold counts in the bread prepared by the yeast of the present invention increased more slowly than those in the control group. 5 If the CFU / g or mold count is greater than 100 CFU / g, the bread is considered to be spoiled and inedible. Therefore, the shelf life of bread prepared by the yeast of the present invention is greater than 15 days, and the shelf life of bread prepared by the control yeast is less than 6 days. The shelf life of bread prepared by the yeast of the present invention is longer than that of the control group.
[0135] The preferred embodiments of the present invention are described in detail above, but the present invention is not limited thereto. Within the technical concept of the present invention, the technical solution of the present invention can be subjected to a variety of simple modifications, including the combination of various technical features in any other suitable manner, and these simple modifications and combinations should also be regarded as the contents disclosed by the present invention and belong to the protection scope of the present invention.
Claims
1. A yeast Saccharomyces cerevisiae, characterized in that: The deposit number of the brewer's yeast is CGMCC No.32189.
2. A bacterial agent, characterized in that The bacterial agent contains the brewer's yeast according to claim 1.
3. The bacterial agent according to claim 2, wherein The bacterial agent contains a protective agent, and the protective agent is selected from at least one of skim milk powder, maltodextrin, trehalose, dextran and glycerol; And / or, the bacterial agent contains a buffer, and the buffer is selected from at least one of PBS buffer, citrate buffer and acetate buffer.
4. The bacterial agent according to claim 2 or 3, wherein The content of the brewer's yeast is 10 4 CFU / mL or above.
5. A Lupin species, characterized in that: The Lupin seed is obtained by fermenting the brewer's yeast according to claim 1.
6. The Lupin seed according to claim 5, wherein The raw materials used for the fermentation contain wheat flour and / or rice flour.
7. The Lupin seed according to claim 5 or 6, wherein The fermentation temperature is 30-35°C; And / or, the fermentation time is 2-5h.
8. Use of the brewer's yeast according to claim 1 in fermented pasta.
9. Use of the brewer's yeast according to claim 1 in improving the taste of pasta.
10. Use of the brewer's yeast according to claim 1 in extending the shelf life of pasta.