Duck source chicken bacillus strain YJ922 and application thereof

Abstract

The invention relates to prevention of duck-origin chicken bacilli, in particular to a duck-origin chicken bacilli strain YJ922 and application thereof. The invention provides a duck source chicken bacillus strain YJ922, and the preservation number of the duck source chicken bacillus strain YJ922 is CGMCC (China General Microbiological Culture Collection Center) No.28290. The invention also provides a duck-origin chicken bacilli vaccine, which comprises the inactivated duck-origin chicken bacilli strain YJ922. The vaccine can effectively reduce the colonization quantity of duck-origin chicken bacilli in intestinal tracts and main viscera of chickens, so that the incidence probability of bacterial septicemia is reduced, and egg laying reduction, fertilization rate reduction and salpingitis diseases, caused by the duck-origin chicken bacilli, of the breeding chickens are prevented.

Description

Technical Field

[0001] The invention relates to the prevention of duck-derived Gallibacillus disease, and in particular to a duck-derived Gallibacillus strain YJ922 and application thereof. Background Art

[0002] Duck-derived Gallibacillus disease, once known as avian Gallibacillus disease, is a chronic, progressive, and contagious disease of laying hens, characterized by abdominal distension, decreased egg production, salpingitis, tubal cysts, oophoritis, and peritonitis. The disease is a new avian infectious disease in recent years and is common in chicken farms at home and abroad, seriously affecting the production performance of laying hens and causing great economic losses to the poultry industry. Kohlert and Mirle et al. also isolated Gallibacillus from laying hens with reproductive system diseases and believed that the pathogen was a potential pathogen for salpingitis, tubal cysts, and sepsis in laying hens, which in turn led to a decrease in egg production and egg quality; another study showed that some avian bacilli can cause endocarditis, sinusitis, or upper respiratory tract infections in chickens. In addition, the pathogen can also cause a higher mortality rate in chickens with immunosuppressive diseases. Since 2000, some large-scale breeding farms in my country have seen a decline in both egg production and hatching rates after artificial insemination of each batch of chickens after the start of production, and the trend has been getting worse, causing huge economic losses to poultry companies. Summary of the invention

[0003] In order to safely and effectively prevent duck-derived Gallibacillus disease and reduce economic losses in the poultry industry, the present invention provides a duck-derived Gallibacillus (Gallibacterium anatis) strain YJ922. Experiments have shown that the inactivated vaccine prepared using the strain YJ922 can effectively protect experimental chickens and prevent duck-derived Gallibacillus disease.

[0004] The duck-derived Gallinaceus strain YJ922 (also referred to as strain YJ922, YJ922 strain or YJ922) provided by the present invention has a deposit number of CGMCC No. 28290 in the China General Microbiological Culture Collection Center (CGMCC).

[0005] The present invention also provides a product comprising the duck-derived Gallinaria strain YJ922.

[0006] The product can be a solid bacterial agent or a liquid bacterial agent.

[0007] The product can be used in a toxicity test to detect the resistance of animals to duck-derived Gallibacillus infection.

[0008] The application of the duck-derived Gallinaceus strain YJ922 in the preparation of duck-derived Gallinaceus vaccine also falls within the protection scope of the present invention.

[0009] The present invention also provides a duck-derived Gallibacillus vaccine, which comprises the inactivated duck-derived Gallibacillus strain YJ922.

[0010] The duck-derived Gallibacillus vaccine may further comprise an immune adjuvant.

[0011] The immune adjuvant may be a veterinary immune adjuvant, such as Montanide GEL 02 produced by Seppic.

[0012] The present invention also provides a method for preparing a duck-derived Gallibacillus vaccine, which comprises: culturing the duck-derived Gallibacillus strain YJ922 to the mid-logarithmic growth phase, collecting the bacterial bodies and resuspending them in a phosphate buffer solution (PBS buffer), adding a formaldehyde solution to inactivate the bacterial bodies, and then mixing the completely inactivated bacterial bodies with an immune adjuvant to prepare the duck-derived Gallibacillus vaccine.

[0013] In the above method, the concentration of the phosphate buffer is 10-50 mM.

[0014] In the above method, formaldehyde with a final concentration of 0.3% to 0.5% is used to inactivate the bacterial cells of the duck-derived Gallinaceus strain YJ922 at a temperature of 2° C. to 8° C.

[0015] In the above method, the duck-derived Gallinaceus vaccine contains a concentration of 2.8×10 8 ~2.8×10 9 CFU / mL of inactivated bacteria of the duck-derived Gallinaceus strain YJ922.

[0016] The invention clinically isolates a highly pathogenic duck-derived Gallinaria strain YJ922, and performs molecular identification, antibiotic resistance and biochemical characteristic analysis; uses the strain YJ922 to perform a challenge experiment on SPF chickens via an oral route, establishes an animal experimental challenge model of duck-derived Gallinaria strain, and determines the minimum challenge dose and pathological characteristics; uses formaldehyde to inactivate the cultured strain YJ922 and then mixes it with an immune adjuvant to prepare an inactivated vaccine; immune challenge experiments prove that the vaccine can effectively reduce the colonization number of duck-derived Gallinaria strains in the intestines and major organs of chickens, thereby reducing the incidence probability of bacterial sepsis, and preventing the decrease in egg production, the decrease in fertilization rate and salpingitis in breeder chickens caused by duck-derived Gallinaria strains, and has good application prospects in large-scale poultry farming.

[0017] The patent deposit information of duck-derived Gallinaceus YJ922 provided by the present invention is as follows:

[0018] Biomaterial: YJ922

[0019] Taxonomic name: Gallibacterium anatis

[0020] Deposit date: August 29, 2023

[0021] Deposit number: CGMCC No.28290

[0022] Depository: China General Microbiology Center (CGMCC)

[0023] Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The morphology and molecular identification results of duck-derived Gallinaceus YJ922 are shown from left to right: the colony morphology of the YJ922 strain on sheep blood agar plate, the bacterial morphology under an optical microscope, and the agarose gel electrophoresis of the PCR product; duck-derived Gallinaceus YJ922 showed β-hemolysis on the sheep blood agar plate; under an optical microscope, duck-derived Gallinaceus YJ922 was in the shape of a small rod, and Gram staining was negative; in the electrophoresis diagram, lanes 1-4 were 16S rRNA and 23S rRNA gene fragments of duck-derived Gallinaceus YJ922 amplified by PCR using primers 16s (SEQ ID NO: 2) and 23s (SEQ ID NO: 3), with lengths of 790 bp and 1080 bp, respectively; lane M is a DNA Marker, and its molecular weights are 2000 bp, 1500 bp, 1000 bp, 750 bp, 500 bp, 250 bp, and 100 bp from top to bottom.

[0025] Figure 2 This is a diagram of the clinical lesions of important organs in chickens infected with duck-derived Gallibacillus infection.

[0026] Figure 3 The figure shows the YJ922 colonization level in the cecum of chickens in different treatment groups after oral administration of duck-derived Gallinaceus YJ922. The ordinate represents the logarithm of the total number of YJ922 bacteria colonized per milligram of cecal mucosal tissue (CFU value with base 10), and the values ​​are expressed as mean ± SD (n = 5). The abscissa represents the number of days after the second YJ922 challenge.

[0027] Figure 4 The figure shows the YJ922 colonization level in the spleen of chickens in different treatment groups after oral infection with duck-derived Gallobacterium YJ922 (7 days after the second infection). The ordinate represents the logarithm of the total number of YJ922 bacteria colonized per milligram of spleen tissue (CFU value with base 10), and the values ​​are expressed as mean ± SD (n = 5).

[0028] Figure 5The results of the determination of duck-derived Gallinaceus-specific serum IgG in chickens of different treatment groups; the ordinate represents the absorbance OD450 / 630nm value, and the values ​​are expressed as mean ± SD (n = 5); the abscissa represents the weekly serum collection and separation of chickens 1-7 weeks after the first immunization.

[0029] Figure 6 The results of total IgA in bile of different treatment groups are shown in Figure 1. The ordinate represents the total IgA content in bile (ng / ml), and the abscissa represents the number of days after the second immunization of the chickens. The values ​​in the figure are expressed as mean ± SD (n = 5).

[0030] Figure 7 The liver pathological sections of chickens in the challenge control group and the immune group (high dose group) are shown. Challenge control group: black arrows indicate hepatic sinus congestion and dilation, yellow arrows indicate round vacuoles, and red arrows indicate lymphocyte infiltration. Immune group: black arrows indicate round vacuoles, and yellow arrows indicate lymphocyte aggregation. 2.0x and 20.0x indicate magnification.

[0031] Figure 8 The results of cecal pathological sections of chickens in the challenge control group and the immune group (high dose group) are shown. Challenge control group: black arrows indicate loose and lightly stained cytoplasm, yellow arrows indicate epithelial cell shedding, red arrows indicate the gap between the mucosal epithelium and the lamina propria, blue arrows indicate widening of the intestinal gland spacing, and green arrows indicate capillary congestion and dilation. Immune group: black arrows indicate nuclear condensation, dark staining or fragmentation. 2.0x and 20.0x indicate magnification.

[0032] Fig. 9 The spleen pathological sections of the chickens in the challenge control group and the immunized group (high dose group) are shown. Challenge control group: black arrows indicate congestion. 2.0x and 20.0x indicate magnification.

[0033] Fig.10 Shown are eggs produced by birds in the challenge control group (upper row of pictures) and oviduct bleeding symptoms in birds in the challenge control group (lower row of pictures).

[0034] Sequence Description

[0035] SEQ ID NO: 1 is the nucleotide sequence of the 16S rRNA gene of the YJ922 strain;

[0036] SEQ ID NO: 2 is the nucleotide sequence of primer 16s;

[0037] SEQ ID NO: 3 is the nucleotide sequence of primer 23s;

[0038] SEQ ID NO: 4 is the nucleotide sequence of primer 27F;

[0039] SEQ ID NO:5 is the nucleotide sequence of primer 1492R. DETAILED DESCRIPTION

[0040] The following implementation plans are provided:

[0041] 1. A duck-derived Gallibacterium anatis strain YJ922, whose deposit number is CGMCC No.28290.

[0042] 2. A product comprising the duck-derived Gallinaceus strain YJ922 described in Embodiment 1.

[0043] 3. The product according to embodiment 2, which is a solid bacterial agent or a liquid bacterial agent.

[0044] 4. Use of the duck-derived Gallibacillus strain YJ922 described in Implementation Option 1 in the preparation of duck-derived Gallibacillus vaccine.

[0045] 5. A duck-derived Gallibacillus vaccine, comprising the inactivated duck-derived Gallibacillus strain YJ922 described in Embodiment 1.

[0046] 6. The duck-derived Gallibacillus vaccine described in Embodiment 5 further comprises an immune adjuvant.

[0047] 7. A method for preparing a duck-derived Gallibacillus vaccine, comprising: culturing the duck-derived Gallibacillus strain YJ922 described in Implementation Option 1 to mid-logarithmic growth, collecting the bacteria and resuspending them in phosphate buffer, adding formaldehyde solution to inactivate the bacteria, and then mixing the completely inactivated bacteria with an immune adjuvant to prepare a duck-derived Gallibacillus vaccine.

[0048] 8. The method for preparing a duck-derived Gallobacterium vaccine as described in Embodiment 7, wherein the concentration of the phosphate buffer is 10 to 50 mM.

[0049] 9. The method for preparing a duck-derived Gallibacillus vaccine as described in Embodiment 7, wherein the cells of the duck-derived Gallibacillus strain YJ922 are inactivated using formaldehyde at a final concentration of 0.3% to 0.5% at a temperature of 2°C to 8°C.

[0050] 10. The method for preparing a duck-derived Gallibacillus vaccine according to embodiment 7, wherein the duck-derived Gallibacillus vaccine contains a concentration of 2.8×10 8 ~2.8×10 9 CFU / mL of inactivated bacteria of the duck-derived Gallinaceus strain YJ922.

[0051] The technical solution of the present invention is described in detail below in conjunction with the embodiments and drawings. It should be understood that the following embodiments are only used for explanation and description and are not used to limit the scope of protection of the present invention.

[0052] The culture media and solutions used in the following examples are:

[0053] Sheep blood agar was purchased from Guangdong Huankai Microbiology Technology Co., Ltd.

[0054] Tryptic Soy Agar (TSA) and Tryptic Soy Broth (TSB) were purchased from Qingdao Haibo Biotechnology Co., Ltd.

[0055] 10 mM PBS buffer (pH 7.4): 2.7 mM KCl, 2.0 mM KH 2 PO 4 , 137 mM NaCl, 10 mM Na 2 HPO 4 .

[0056] If not otherwise specified, the reagents used in the following examples are all conventional reagents in the art, which can be obtained commercially or prepared according to conventional methods in the art, and the specifications are laboratory pure. If not otherwise specified, the experimental methods and conditions used in the following examples are all conventional experimental methods and conditions in the art, and reference can be made to relevant experimental manuals, known documents or manufacturer specifications. Unless otherwise defined, the meanings of all technical and scientific terms used herein are the same as those generally understood by those of ordinary skill in the art to which the present invention belongs.

[0057] Example 1: Isolation and identification of duck-derived Galibacterium anatis strains

[0058] 1. Isolation of Gallinaceus strains from ducks

[0059] The diseased materials used in this example were derived from the intestines, spleens, and bursae of dead chickens from chicken farms in Daxing, Changping, and other places in the suburbs of Beijing. The intestinal contents collected aseptically were diluted in gradients and inoculated on sheep blood agar plates, inverted and incubated in a 37°C incubator for 12 hours, and then observed and identified suspected colonies using polymerase chain reaction (PCR), and the strains were purified twice and stored. Figure 1 As shown in the figure, duck-derived Gallinaceus showed β-hemolysis on sheep blood agar plates, appeared as small rods under an optical microscope, and was Gram-negative. Figure 2 shown.

[0060] Based on the comparison of 16S rRNA genes of related avian Pasteurellaceae species, specific PCR primers for duck-derived Galibacterium anatis were selected, as shown in Table 1.

[0061] Table 1 PCR primers and amplification information used for identification of Gallinaceus from ducks

[0062]

[0063] Using the genomic DNA of the suspected duck-derived Gallinaceus colony as a template, PCR identification was performed using the two primer pairs shown in Table 1 (16s and 23s, 27F and 1492R), respectively.

[0064] Use primers 16s and 23s to establish a 50μL PCR reaction system: 35μL pure water, 5μL 10× PCR buffer, 1μL TaqDNA polymerase, 4μL 10mmol / L dNTPs, 2μL 10μM upstream primer, 2μL 10μM downstream primer, 1μL template DNA. The PCR reaction program is: 94℃ denaturation for 3min, followed by 30 cycles (94℃ denaturation for 1min, 54℃ annealing for 60s, 72℃ extension for 1min), and finally 72℃ extension for 7min. The amplified products obtained are 790bp and 1080bp.

[0065] Use 16S rRNA gene universal primers 27F and 1492R to establish a 50μL PCR reaction system: 35μL pure water, 5μL 10× PCR buffer, 1μL Taq DNA polymerase, 4μL 10mmol / L dNTPs, 2μL 10μM upstream primer, 2μL 10μM downstream primer, 1μL template DNA. The PCR reaction program is: 95℃ denaturation for 3min, followed by 30 cycles (95℃ denaturation for 15s, 55℃ annealing for 15s, 72℃ extension for 1min), and finally 72℃ extension for 5min. The amplified product obtained is 1400bp.

[0066] After the PCR reaction, the amplified product was recovered by gel excision and sequenced by Beijing Bomade Biotechnology Co., Ltd. The sequencing results were compared using NCBI BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). A duck-derived Gallinaceus (Galibacterium anatis) strain was successfully isolated and named YJ922.

[0067] The nucleotide sequence of the 16S rRNA gene of the YJ922 strain is as follows:

[0068] TAAGCTATCTACTTCTGGTACAACCCACTCCCATGGTGTGACGGGCGGTG

[0069] TGTACAAGGCCCGGGAACGTATTCACCGCGACATTCTGATTCGCGATTAC

[0070] TAGCGATTCCGACTTCATGGAGTCGAGTTGCAGACTCCAATCCGGACTAC

[0071] GATGCACTTTCTGAGTTTCGCTCCGTATCGCTACTTCGCCTCCCTCTGTA

[0072] TGCACCATTGTAGCACGTGTGTAGCCCTACTCGTAAGGGCCATGATGACT

[0073] TGACGTCATCCCCACCTTCCTCCAGCTTGTCACTGGCAGTCTCCTTTGAG

[0074] TCCCCGGCTTTACCCGCTGGTAACAAAGAATAAGGGTTGCGCTCGTTGCG

[0075] GGACTTAACCCAACATTTCACAACACGAGCTGACGACAGCCATGCAGCAC

[0076] CTGTCTCTAAGTTCTCGAAAGCACAAAGCTATCTCTAGCTCCTCCTTAGG

[0077] ATGTCAAGAGTAGGTAAGGTTCTTCGCGTTGCATCGAATTAAACCACATG

[0078] CTCCACCGCTTGTGCGGGCCCCCGTCAATTCATTTGAGTTTTAACCTTGC

[0079] GGCCGTACTCCCCAGGCGGTCGATTTATCACGTTTGCTTCGAGAGCCATA

[0080] CCTTTCGTACAACCCCCAAATCGACAGCGTTTACAGCGTGGACTACCAGG

[0081] GTATCTAATCCTGTTTGCTCCCCACGCTTTCGCACATGAGCGTCAGTATC

[0082] TTCCCAAGGGGCTGCCTTCGCCTTCGGTATTCCTCCACATCTCTACGCAT

[0083] TTCACCGCTACACGTGGAATTCTACCCCTCCCTAAAGTACTCTAGTACGC

[0084] CAGTATGAAATGCTGTTCCCAGGTTAAGCCCGGGGCTTTCACATCTCACT

[0085] TAACGTCCCGCCTGCGTGCCCTTTACGCCCAGTTATTCCGATTAACGCTC

[0086] GCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCT

[0087] TCTGTGGCTAACGTCAAATTAACGTGCTATTAACACGCCAACCTTCCTCA

[0088] CCACCGAAAGAACTTTACAACCCGAAGGCCTTCTTCATTCACGCGGCATG

[0089] GCTGCGTCAGGGTTCCCCCCATTGCGCAATATTCCCCACTGCTGCCTCCC

[0090] GTAGGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCTGGCCATCCTCTCA

[0091] GACCAGCTAGAGATCGTCGGCTTGGTAGGCCTTTACCCCACCAACTACCT

[0092] AATCTCACTTGGGTTCATCCCTTGGCAAGTGGTTTCCCACCCCTTTCATC

[0093] TCTCGATCCTATGCGGTATTAGCCATCGTTTCCAATGGTTATCCCCCTCC

[0094] AAAAGCCAGATCCCCAAGCCTTACTCACCCGTCCGCCACTCGTCAGCATT

[0095] GAAAGCAAGCTTTCAACCCGTTACCGTTCGACTTGCAT(SEQ ID NO:1)

[0096] 2. Drug resistance detection of duck-derived Gallinaceus YJ922

[0097] The Kirby-Barer disk diffusion method was used to screen the drug sensitivity of the YJ922 strain in accordance with the CLSI Identification Manual (2021 edition). The results of the drug sensitivity test showed that the YJ922 strain was sensitive to β-lactams and aminoglycosides, and was resistant to most quinolones, tetracyclines, lincosamides, and sulfonamides.

[0098] 3. Biochemical characteristics of duck-derived Gallinaceus YJ922

[0099] The YJ922 strain was subjected to biochemical tests and the results were determined using a bacterial microbiochemical reaction tube (Guangdong Huankai Microbiology Technology Co., Ltd.) according to the product instructions. The results of the biochemical tests are shown in Table 2. The YJ922 strain can decompose sugars such as glucose and sucrose; it cannot utilize starch and lactose; it can reduce nitrates; the MR-VP and ONPG tests are positive; it does not produce H 2 S; does not decompose urea; citrate, arginine decarboxylase, lysine decarboxylase tests are negative; has motility. The biochemical test results of strain YJ922 are consistent with the identification characteristics of duck-derived Gallinaceus (Galibacterium anatis).

[0100] Table 2 Biochemical test results of strain YJ922

[0101] Biochemical Project YJ922 strain Lysozyme + Mannitol + glucose + starch - Nitrates + MR-VP + power diffusion Citrate - gelatin - 3% Hydrogen Peroxide - sucrose + lactose - Urea - ONPG + Unsalted peptone water + Lysine - Ornithine - Arginine - Oxidase + Sorbitol - -Dulcitol - Salicin - Malonate + Hydrogen sulfide - Indigo - Potassium Cyanide -

[0102] The YJ922 strain was sent to the China General Microbiology Center (CGMCC) for preservation, with the preservation number CGMCC No.28290, the classification name Galibacterium anatis, and the preservation date of August 29, 2023.

[0103] Example 2: Establishment of duck-derived Gallinaria YJ922 oral challenge model

[0104] The specific pathogen-free (SPF) chickens used in this example were from Beijing Merial Experimental Animal Center. 40 14-day-old SPF chickens were randomly selected and divided into 4 groups (3 experimental groups and 1 control group), with 10 SPF chickens in each group. The YJ922 strain was inoculated in tryptone soy broth (TSB) medium and cultured at 37°C and 200rpm. A 6-8 hour culture of the YJ922 strain was taken, centrifuged at 10,000r / min for 5 minutes, the supernatant was discarded, and the cells were resuspended in 30mL of sterile 10mM PBS buffer (pH 7.4) for 10-fold gradient dilution to obtain 10 9 CFU, 10 7 CFU, 10 5 Three doses of YJ922 bacterial liquid (CFU) were used for oral challenge in three experimental groups.

[0105] The oral challenge method was: each chicken was orally administered 1 mL of YJ922 solution at a corresponding dose each time, and a second challenge with the same dose was performed 5 days after the first challenge. The challenge doses of the three experimental groups were 10 9 CFU YJ922 / pc, 10 7 CFU YJ922 / pc, 10 5 CFU YJ922 / bird. The control group used an equal volume of 10mM PBS buffer (pH 7.4) instead of YJ922 bacterial solution for the challenge experiment. After the challenge, the disease conditions of the chickens in the control group and the experimental group were observed and recorded. The occurrence of any two of the typical clinical symptoms such as (1) depression and loss of appetite, (2) diarrhea and (3) death was considered to be an illness. The results of the oral challenge experiment are shown in Table 3.

[0106] Table 3 Clinical manifestations of chickens in each group after challenge

[0107]

[0108] The YJ922 colonization sites in the main organs of the experimental group chickens were determined, and histopathological sections were prepared to determine the pathological changes in the intestines, spleen, liver, kidneys and other major organs, to determine the optimal challenge dose and evaluate the effectiveness of the challenge model. The pathogen isolation rates of the organs of each group of chickens after challenge are shown in Table 4. The results showed that the optimal challenge dose of duck-derived Gallinaceus YJ922 strain for chickens was 10 7 CFU / piece.

[0109] Table 4 Organ pathogen isolation rate of chickens in each group after challenge

[0110]

[0111] Example 3: Preparation and efficacy evaluation of duck-derived Gallibacillus YJ922 inactivated vaccine

[0112] 1. Preparation of whole-bacterial inactivated vaccines

[0113] The YJ922 strain was inoculated into a tryptone soy broth (TSB) medium and cultured at 37°C and 200 rpm. 200 mL of YJ922 bacterial solution cultured to the middle logarithmic growth period was taken, centrifuged at 10,000 r / min for 5 min, the supernatant was discarded and the bacterial cells were resuspended in 30 mL of sterile 10 mM PBS buffer (pH 7.4), a sample was taken, and after 10-fold gradient dilution, it was spread on a tryptone soy agar (TSA) medium for bacterial cell counting, and then a 10% formaldehyde solution (formaldehyde 100 mL, sodium dihydrogen phosphate 0.65 g, distilled water 900 mL) was added to make the final concentration of formaldehyde in the mixed solution 0.3% (v / v), and then the mixed solution was placed in a vortexer and inactivated at 4°C, 20 r / min for 48 hours. Dilute the inactivated YJ922 bacterial solution with an appropriate amount of sterilized 10mM PBS buffer (pH 7.4), and then store it at 2-8°C. Take 100μL of the inactivated YJ922 bacterial solution and spread it on the TSA plate, and inoculate it in 5mL TSB broth, place it in the incubator and culture it for 24h, then take it out. If there is no live bacteria growing in the culture plate and the culture solution, it is judged to be completely inactivated.

[0114] The completely inactivated YJ922 bacterial solution was diluted 10 times with sterile 10mM PBS buffer (pH 7.4), and then mixed with the immune adjuvant Montanide GEL 02 (Seppic) at a volume ratio of 1:10 to form inactivated vaccines with different antigen concentrations. The vaccines were used in SPF chicken immunization and challenge tests and stored at 2-8°C.

[0115] 2. SPF chicken immune challenge test

[0116] 130 14-day-old SPF chickens were purchased from Beijing Merial Laboratory Animal Center and randomly divided into 5 groups, including three immunization groups (low-dose group, medium-dose group and high-dose group), one challenge control group and one blank control group, with 26 chickens in each group. Chickens in the low-dose group were injected with YJ922 at a concentration of 2.8×10 7 CFU / mL of inactivated vaccine. Chickens in the medium-dose group were injected with YJ922 at a concentration of 2.8×10 8 CFU / mL of inactivated vaccine. Chickens in the high-dose group were injected with YJ922 at a concentration of 2.8×10 9CFU / mL of inactivated vaccine. The immunization method is: 0.25mL of inactivated vaccine was injected into the back muscle of each chicken for the first immunization, and the second immunization was performed two weeks later using the same immunization dose and route. The challenge control group and the blank control group were not immunized. Two weeks after the second immunization, all chickens in the immunization group and the challenge control group were orally administered 1mL of a 6-8 hour culture of duck-derived Gallinaceus YJ922 for the first challenge, with a challenge dose of about 10 7 CFU / chicken, and the same dose was used for the second challenge five days after the first challenge. On the 3rd, 7th and 14th days after the second challenge, five chickens were selected from each group, and the main organs of each group were collected after blood sampling and sacrifice, and the colonization number of duck-derived Gallinaria YJ922 in the cecal contents and spleen was detected respectively.

[0117] Live bacterial count of infected tissue in vivo: Take a 1.5mL EP tube, add 100μL PBS, and weigh it as M1. Take the cecum and spleen and place them in EP tubes containing 100μL PBS, homogenize them with an electric pestle, and weigh them as M2. Add 900μL PBS and shake to mix to make a suspension. Use PBS to dilute the suspension 10 times in series, take 10μL of each dilution sample and inoculate it on a sheep blood agar tetracycline screening plate, place it in a 37℃ incubator for 12h, calculate the colony count (CFU) at the lowest dilution multiple, and convert it to how many CFU per milligram of tissue. Total colony count / tissue mass = colony count × dilution multiple × 100 / tissue mass (mg), tissue mass (mg) = M2-M1. The mean and standard deviation method was used to perform statistical analysis on the data, and the statistical results were expressed as mean ± SD (n = 5).

[0118] The results showed that on the 7th and 14th days after the second challenge, the duck-derived Gallinaceus YJ922 colonization was detected in the cecal contents and spleen of all chickens in the challenge control group. The colonization levels of duck-derived Gallinaceus YJ922 in the high-dose and medium-dose groups of the immunized group and the blank control group were significantly lower than those in the challenge control group and the low-dose group of the immunized group ( Figure 3 and Figure 4 ). Therefore, the whole-bacterium inactivated vaccine prepared in this experiment can effectively inhibit the colonization of duck-derived Gallinariae YJ922 in the cecum of chickens, thereby reducing the probability of the pathogen circulating to the spleen through body fluids.

[0119] 3. Determination of antibody levels in immune chickens

[0120] 100 14-day-old SPF chickens were purchased from Beijing Merial Laboratory Animal Center and randomly divided into 5 groups, including three immunization groups (low-dose group, medium-dose group and high-dose group), one challenge control group and one blank control group, with 20 chickens in each group. Chickens in the low-dose group were injected with YJ922 at a concentration of 2.8×10 7CFU / mL of inactivated vaccine. Chickens in the medium-dose group were injected with YJ922 at a concentration of 2.8×10 8 CFU / mL of inactivated vaccine. Chickens in the high-dose group were injected with YJ922 at a concentration of 2.8×10 9 CFU / mL of inactivated vaccine. The immunization method is: 0.25mL of inactivated vaccine was injected into the back muscle of each chicken for the first immunization, and the second immunization was carried out two weeks later using the same immunization dose and route. Two weeks after the second immunization (6 weeks of age), all chickens in the immunization group, blank control group and challenge control group were orally administered with 1mL of 6-8 hour culture of duck-derived Gallinaceus YJ922 for the first challenge, with a challenge dose of about 10 7 CFU / individual, and a second challenge was conducted with the same dose 5 days after the first challenge.

[0121] Serum was collected and separated every week from 1 to 7 weeks after the first immunization. After the serum was separated, the level of serum IgG antibody specific to duck-derived Gallinariae YJ922 was determined by indirect ELISA. The determination method was as follows: the ultrasonically broken duck-derived Gallinariae YJ922 lysate (62.5 ng / μL) was used as the coating antigen and added to the ELISA plate, 100 μL per well, and coated overnight at 4°C; the ELISA plate was washed 3 times with PBST; the blocking solution (MedChemExpress, MCE) was added, 100 μL per well, and blocked at room temperature for 1 hour; after removing the blocking solution, all the separated serum samples were diluted 16,000 times with PBST and used as the primary antibody, 100 μL was added to each well, and incubated at 37°C for 1 hour; the ELISA plate was washed 3 times with PBST; HRP-labeled goat anti-chicken IgY (A16054, Invitrogen) was diluted 1:2500 with PBST as the secondary antibody, 100 μL was added to each well, and incubated at 37°C for 1 hour; the ELISA plate was washed 3 times with PBST; TMB substrate solution was added, 100 μL per well, reacted at room temperature for 30 minutes, and 1 M H 2 SO 4 50 μL of the solution was added to stop the color development; the OD of each well was measured using an ELISA instrument (Synergy H1, BioTek). 450 / 630nm The values ​​were used to compare the serum specific IgG antibody levels of different groups. The mean and standard deviation method was used for statistical analysis of the data, and the results were expressed as mean ± SD (n = 5). Figure 5 As shown, the serum specific IgG antibody levels of the high-dose groups in the immunization group reached the highest in the fifth week after the first immunization, and slowly decreased in the sixth and seventh weeks; the serum specific IgG antibody level of the medium-dose group slowly increased after the first immunization, and was equivalent to the IgG antibody level of the high-dose group in the sixth week; the low-dose group failed to produce an effective protective dose of serum specific IgG antibodies.

[0122] Before the challenge, 5 chickens in each group were killed and bile samples were collected. The level of total IgA antibody in bile secretion was determined using a chicken secretory immunoglobulin A (sIgA) ELISA kit (Shanghai Hengyuan Biotechnology Co., Ltd.). The mean and standard deviation method was used for statistical analysis of the data, and the results were expressed as mean ± SD (n = 5). Figure 6 As shown, there was no significant difference in the total amount of IgA secreted among the immunized group, the challenge control group and the blank control group.

[0123] The above test results show that the immunized chickens in the high-dose and medium-dose groups can produce specific antibodies to duck-derived Gallinaceus, which can effectively protect the experimental chickens and reduce the colonization of duck-derived Gallinaceus in the intestines and spleen.

[0124] Observation of histopathological damage:

[0125] On the 28th day after the second infection, the chickens in the immunized group and the infection control group were killed, and the cecum, spleen, and liver tissues were placed in 4% tissue fixative (4% paraformaldehyde PBS solution) and sent to a pathology section company for sectioning, hematoxylin and eosin staining (HE staining), and dehydration and sealing. Finally, image acquisition and analysis were performed under microscopy to compare the differences in the degree of organ damage in different groups, and the severely damaged organs were sectioned for pathological damage assessment.

[0126] like Figure 7 As shown in the figure, a large number of hepatic sinusoidal congestion and dilation (black arrows) were widely observed in the liver tissue of the challenge control group, mild fatty degeneration of hepatocytes was rare, and small round vacuoles (yellow arrows) were seen in the cytoplasm; lymphocyte infiltration (red arrows) was rare. Mild fatty degeneration of hepatocytes was widely observed in the liver tissue of the immune group (high-dose group), and small round vacuoles (black arrows) were seen in the cytoplasm; lymphocytes were locally aggregated (yellow arrows).

[0127] like Figure 8 As shown in the figure, in the intestinal tissue mucosa of the control group, multiple epithelial cells were observed to be hydropic degeneration, the cytoplasm was loose and lightly stained (black arrow), and epithelial cells were rarely shed (yellow arrow); a small amount of edema was seen, and gaps were seen between the mucosal epithelium and the lamina propria (red arrow), the connective tissue of the local lamina propria was loosely arranged, and the distance between the intestinal glands was widened (blue arrow); a small amount of capillary congestion and dilation (green arrow) was seen in the local lamina propria. In the immune group (high-dose group), a small amount of epithelial cells were observed to be necrotic and shed in the intestinal tissue mucosa, and the nuclei were condensed, darkly stained or fragmented (black arrow); the number of intestinal glands in the lamina propria was abundant, the muscle layer was evenly stained, the muscle fiber morphology and structure were normal and regularly arranged, and no obvious inflammation was seen.

[0128] like Fig. 9As shown in the figure, the red and white pulps of the spleen tissue of the control group were mixed, and the white pulp mainly included small lymphocytes, sheath arteries and a small number of lymph nodes; more congestion was seen locally in the red pulp (black arrows). The spleen tissue capsule of the immune group (high-dose group) was composed of dense connective tissue rich in elastic fibers and smooth muscle fibers with uniform thickness, without splenic trabecular structure; the red and white pulps were mixed, and the white pulp mainly included small lymphocytes, sheath arteries and a small number of lymph nodes, and the red pulp included venous sinuses and reticular splenic cords containing reticular cells, macrophages, lymphocytes and red blood cells, without obvious abnormalities.

[0129] The observation results showed that duck-derived Gallinaceus YJ922 can colonize in the cecum, spleen and liver and cause pathological damage. The antibodies produced by the immunized group (high-dose group) can effectively protect the experimental chickens and reduce the pathological damage of duck-derived Gallinaceus YJ922 to the cecum, spleen and liver.

[0130] Example 4: Clinical application of duck-derived Gallibacillus YJ922 inactivated vaccine

[0131] The whole-bacterium inactivated vaccine of duck-derived Gallibacillus sp. YJ922 strain was prepared according to the method in Example 3.

[0132] 60 healthy Beijing-style chickens aged 26 weeks (purchased from Beijing Luduole Agriculture Co., Ltd.) were evenly divided into 3 groups, 20 in each group, and kept in a closed room equipped with ventilation ducts and providing filtered air. The Beijing-style chicken feeding management plan was strictly implemented for lighting, ventilation, drinking water and feed. One week before the challenge, cloacal swab and throat swab samples were collected from each chicken for bacterial isolation, and all the test chickens were negative for Gallinarum.

[0133] The chickens started the experiment at 27 weeks of age and the experimental design was as follows.

[0134] Group 1 (immunized group): After two immunizations with the inactivated YJ922 vaccine, the duck-derived Gallinaria strain YJ922 was used for challenge. The details are as follows: For the first immunization, each chicken was injected with an inactivated vaccine into the back of the neck muscle, with an immunization dose of 0.5 mL (2.8 × 10 9 CFU / mL), and a second immunization was performed two weeks later using the same immunization dose and route; two weeks later (chickens were 31 weeks old) the first challenge was performed with duck-derived Gallinaria strain YJ922, with a challenge dose of 1×10 8 cfu / 2mL, the challenge method was oral, and a second challenge with the same dose was performed 5 days after the first challenge.

[0135] Group 2 (blank control group): no treatment.

[0136] Group 3 (challenge control group): At 31 weeks of age, the chickens were challenged for the first time with duck-derived Gallinaria strain YJ922 at a dose of 1×10 8cfu / 2mL, the challenge method was oral, and a second challenge with the same dose was performed 5 days after the first challenge.

[0137] The chickens were observed every day for clinical abnormalities, and the eggs from each group were collected and the number was recorded at 18:00 every afternoon. Cloacal swabs were collected from each group of chickens on the 7th and 14th days after the challenge for bacterial isolation. The experiment lasted for 60 days. After the experiment, all chickens were killed, autopsied, sampled, and isolated for bacteria.

[0138] Table 5 Experimental design

[0139] Experimental Grouping quantity deal with Challenge dose Attack method 1 group 20 2 times of immunity, 2 times of poison attack <![CDATA[1×10 8 cfu / 2ml]]> oral 2 groups 20 / / / 3 groups 20 Chickens were challenged twice at 31 weeks of age <![CDATA[1×10 8 cfu / 2ml]]> oral

[0140] The test results are as follows:

[0141] The feed reduction of test groups 1 and 3 reached a maximum of 15g / day on the second day after the second infection, which lasted for 2 to 3 weeks, and then began to recover slowly. At the same time, 90% of the chickens began to have diarrhea on the second day after the second infection. During the entire test, there were no abnormalities in test group 2.

[0142] The egg production of group 3 dropped dramatically from the 7th day after the second challenge. The daily egg production rate dropped from 87.5% to 100% to 15% to 45%. Some chickens even stopped laying eggs. As time went on, the daily egg production rate began to recover gradually, but it could not return to the level before the onset of the disease. Finally, the daily egg production rate was around 80%. In the middle and late stages of egg production, the eggshells of some chickens were of poor quality, thin and fragile ( Fig.10 ); The egg laying conditions of test group 1 and test group 2 were normal.

[0143] A large number of duck-derived Gallinaceus with a single colony morphology were isolated from the cloacal swabs of groups 1 and 3 on the 7th and 14th days after the challenge, and the duck-derived Gallinaceus of group 2 was negative. After the end of the experiment, all the experimental chickens were autopsied, and it was found that the chickens in group 3 had varying degrees of oviduct bleeding ( Fig.10 ), other organs were normal; the autopsy results of test group 1 and test group 2 were normal.

[0144] The results of the post-immunization challenge protection test showed that the prepared inactivated vaccine of duck-derived Gallinaceus YJ922 strain can provide good protection against the epidemic group of duck-derived Gallinaceus YJ922 strain.

Claims

1. A duck-derived Gallibacterium anatis strain YJ922, whose deposit number is CGMCC No.28290.

2. A product comprising the duck-derived Gallibacillus strain YJ922 according to claim 1.

3. The product according to claim 2, characterized in that The product is a solid bacterial agent or a liquid bacterial agent.

4. Use of the duck-derived Gallibacillus strain YJ922 according to claim 1 in preparing a duck-derived Gallibacillus vaccine.

5. A duck-derived Gallibacillus vaccine, comprising the inactivated duck-derived Gallibacillus strain YJ922 according to claim 1.

6. The duck-derived Gallibacillus vaccine according to claim 5, characterized in that The vaccine also contains an immune adjuvant.

7. A method for preparing a duck-derived Gallibacillus vaccine, comprising: The duck-derived Gallinaceus strain YJ922 of claim 1 is cultured to the mid-logarithmic growth stage, the bacteria are collected and resuspended in a phosphate buffer, a formaldehyde solution is added to inactivate the bacteria, and the completely inactivated bacteria are mixed with an immune adjuvant to prepare a duck-derived Gallinaceus vaccine.

8. The method for preparing a duck-derived Gallibacillus vaccine according to claim 7, characterized in that: The concentration of the phosphate buffer is 10-50 mM.

9. The method for preparing a duck-derived Gallibacillus vaccine according to claim 7, characterized in that: The bacterial cells of the duck-derived Gallinaceus strain YJ922 are inactivated using formaldehyde with a final concentration of 0.3% to 0.5% at a temperature of 2°C to 8°C.

10. The method for preparing a duck-derived Gallibacillus vaccine according to claim 7, characterized in that: The duck-derived Gallibacillus vaccine contains 2.8×10 8 ~2.8×10 9 CFU / mL of inactivated bacteria of the duck-derived Gallinaceus strain YJ922.

Images