Genetic engineering probiotics with high yield of D-pantothenic acid as well as construction method and application of genetic engineering probiotics
By carrying out metabolic engineering transformation of E. coli Nissle 1917, the anabolic pathway of pantothenic acid and the mRNA transcription level of key genes were enhanced, and the problem of low yield of D-pantothenic acid in wild-type strains was solved, and efficient production of D-pantothenic acid was achieved, which has important industrial application value.
Patent Information
- Application Number
- CN202510268919.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-06-06
AI Technical Summary
In the prior art, when using biofermentation method to produce D-pantothenic acid, the cellular economy of the wild-type strain is insufficient, resulting in limited biosynthesis pathways of D-pantothenic acid and low yield. The endotoxin produced by E. coli is complex, and it is difficult to isolate and purify, which hinders the factoryization process of D-pantothenic acid.
By starting with E. coli Nissle 1917, metabolic engineering combination transformation is carried out to transform the key genes in its metabolic pathway, enhance the anabolic pathway of pantothenic acid, and improve the mRNA transcription level of key genes in the EcN genome, thereby efficiently producing D-pantothenic acid.
The yield of D-pantothenic acid in shake flask fermentation was increased from 5 mg/L of wild EcN strain to 287 mg/L, which improved sugar uptake and metabolic capacity, and had important industrial application value.
Smart Images

Figure CN120098878A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of genetic engineering, and relates to a genetically engineered probiotic with high D-pantothenic acid production, a construction method and an application thereof, and in particular to a genetically engineered probiotic with high D-pantothenic acid production, which uses Escherichia coli Nissle 1917 as a starting strain and is transformed by metabolic engineering combination to enhance the pantothenic acid anabolism pathway, a construction method and an application thereof. Background Art
[0002] D-pantothenic acid (DPA), also known as vitamin B5, is a water-soluble vitamin. Pantothenic acid exists in two main configurations (D-type and L-type) in nature, and only the D-configuration pantothenic acid has biological activity. In the body, DPA mainly participates in the formation of coenzyme A (CoA) and acyl carrier protein (ACP), thus playing an important role in the synthesis of multiple metabolites such as protein metabolism and lipid metabolism. Therefore, DPA is widely used in the pharmaceutical industry, food industry, feed additives and other fields.
[0003] Escherichia coli is the most well-studied model prokaryote and has become an indispensable host in the production of proteins and biochemical metabolites. In particular, Escherichia coli Nissle 1917 (abbreviated as EcN) is a probiotic strain and a food-safe strain, making it a new favorite of synthetic biologists. EcN was first isolated from a fecal sample of a German soldier. EcN has anti-inflammatory, antibacterial, antagonistic and immunomodulatory activities, and inhibits the growth of pathogens, thereby positively affecting gastrointestinal homeostasis and maintaining gastrointestinal microbial balance. With the increasing concern about the biosafety of biochemical metabolites, the probiotic EcN has good prospects as a metabolic engineering host.
[0004] The main methods for synthesizing D-pantothenic acid include physical induced crystallization, chemical splitting, chemical synthesis and biosynthesis. The physical induced crystallization method is relatively mature, but this method can only produce calcium pantothenate and cannot be used to produce pantothenic acid derivatives, so its industrial application is relatively narrow. At present, the chemical splitting method is the most widely used synthesis method. This method uses a chiral splitting agent to split D-pantothenic acid, but it has problems such as difficult separation after splitting, difficult treatment of the reaction liquid after the reaction, and expensive chiral splitting agents. The chemical synthesis method is to react two precursor substances, D-pantothenic acid lactone and β-alanine, to obtain D-pantothenic acid, but this method has high requirements on equipment, and toxic substances will be produced during the precursor synthesis process, which is not in line with the concept of green development.
[0005] With the development of synthetic biology, gene editing tools are used to perform metabolic engineering to obtain genetically engineered strains with high yield of D-pantothenic acid, and then biofermentation is used to use cheap raw materials such as glucose and obtain D-pantothenic acid through the cell's own metabolic reaction. Compared with chemical methods, biofermentation has the advantages of being more environmentally friendly, low production cost, and high production efficiency. However, there are still defects in the production of D-pantothenic acid using biofermentation methods. However, due to the cell economy of the wild-type strain itself, the intracellular D-pantothenic acid biosynthesis pathway is limited by the competitive pathway and the supply of cofactors, which makes the wild-type strain unstable in the fermentation process, low yield, and lack of certain economic competitiveness in de novo synthesis, which hinders the industrialization of D-pantothenic acid. At the same time, Escherichia coli itself will produce complex and diverse endotoxins, which are not easy to remove during separation and purification. Therefore, it is considered to improve the metabolic pathway of D-pantothenic acid biosynthesis. The biosynthesis of D-pantothenic acid involves multiple metabolic pathways and genes, among which the pantothenic acid and β-alanine metabolic pathways involve the key synthetic precursors of D-pantothenic acid. Patent CN119162217A discloses a high-yield D-pantothenic acid genetic engineering strain, construction method and application. The application improves the synthesis titer of D-pantothenic acid by enhancing the biosynthesis of β-alanine. Not much research has been done on the pantothenic acid anabolic pathway. Pantothenic acid, as a key step in the anabolic pathway, is relatively weak. Pyruvate to acetolactate is not easily accumulated in D-pantothenic acid, resulting in insufficient supply of precursors for product synthesis, thereby reducing the metabolic conversion efficiency of the carbon source. In addition, the mRNA transcription level of key genes in the EcN genome is low, which ultimately leads to low production and yield in microbial fermentation, which is not conducive to industrial production.
[0006] Based on this, a systematic metabolic engineering strategy was used to construct a genetically engineered strain that can enhance the metabolic pathway of pantothenic acid synthesis, enhance the supply of precursors for product synthesis, promote the reaction balance, and improve the efficiency of D-pantothenic acid biosynthesis from simple carbon sources through complex metabolic pathways. This is to solve the metabolic pathway of D-pantothenic acid synthesis in Escherichia coli, develop new producers, and improve the production of D-pantothenic acid with weak sugar uptake metabolism, low yield and yield in microbial fermentation. Summary of the invention
[0007] In order to solve the technical problems existing in the above-mentioned biological fermentation method for producing D-pantothenic acid, the present invention provides a genetically engineered probiotic with high D-pantothenic acid production, a construction method and its application. The present invention uses Escherichia coli Nissle 1917 as a starting strain, and transforms key genes in its metabolic pathway through combined transformation of metabolic engineering, so that it can efficiently utilize substrates such as glucose in the fermentation preparation of D-pantothenic acid, enhance the pantothenic acid pathway for synthesizing pantothenic acid precursors, and improve the mRNA transcription level of key genes in the EcN genome, so as to efficiently produce D-pantothenic acid.
[0008] In order to achieve the above-mentioned purpose and other related purposes, the technical solution adopted by the present invention is as follows:
[0009] The present invention provides a genetically engineered probiotic with high D-pantothenic acid production, characterized in that it is constructed using Escherichia coli as a base bacterium, and the construction method thereof comprises at least one of the following steps:
[0010] (1) Overexpression of panB and panC genes from the genome of Chaetococcus spp.;
[0011] (2) Overexpression of the alsS gene from Bacillus subtilis;
[0012] (3) Knock out the CRP gene and CRA gene in the genome of the bottom bacteria.
[0013] Preferably, the base bacteria is Escherichia coli Nissle 1917. More preferably, the base bacteria is wild-type Escherichia coli Nissle 1917.
[0014] Preferably, the promoters of the panB gene, the panC gene and the alsS gene are all the strong promoter Trc.
[0015] Preferably, the nucleotide sequence of the strong promoter Trc is as shown in SEQ ID NO.1.
[0016] Preferably, the panB gene is a ketopantoate enzyme encoding gene, and its nucleotide sequence is shown in SEQ ID NO.2.
[0017] Preferably, the panC gene is a gene encoding pantothenate synthase, and its nucleotide sequence is shown in SEQ ID NO.3.
[0018] Preferably, the nucleotide sequence of the alsS gene is shown as SEQ ID NO.4.
[0019] Preferably, the CRP gene is a global transcriptional regulator activated by cAMP, and its nucleotide sequence is shown in SEQ ID NO.5.
[0020] Preferably, the CRA gene is a catabolite repressor or activator, and its nucleotide sequence is shown in SEQ ID NO.6.
[0021] The present invention also provides a method for constructing a genetically engineered probiotic that produces high levels of D-pantothenic acid, which is characterized by comprising at least one of the following steps:
[0022] 1) Using the plasmid expression system, the panB gene and panC gene were constructed into the pETDuet plasmid and regulated by P trcThe expression plasmid pETDuet-panB-panC obtained by promoter regulation was transferred into the chassis bacteria to obtain the genetically engineered bacteria DPA-1;
[0023] 2) Using the plasmid expression system, the alsS gene was constructed into the pETDuet plasmid and regulated by P trc The expression plasmid pETDuet-alsS obtained by promoter regulation was transferred into the chassis bacteria to obtain the genetically engineered bacteria DPA-2;
[0024] 3) Using the plasmid expression system, the alsS gene, panB gene and panC gene were constructed into the pETDuet plasmid and regulated by P trc The expression plasmid pETDuet-panB-panC-alsS obtained by promoter regulation was transferred into the chassis bacteria to obtain the genetically engineered bacteria DPA-3;
[0025] 4) Using EcN as the base strain, knocking out the CRP gene and the CRA gene, and obtaining the genetically engineered bacteria DPA-4 and DPA-5;
[0026] 5) Using DPA-4 as the base strain, the CRA gene was iteratively knocked out to obtain the genetically engineered strain DPA-6;
[0027] 6) Using DPA-6 as the chassis strain, the pETDuet-panB-panC expression plasmid was introduced into the chassis strain to obtain the genetically engineered strain DPA-7;
[0028] 7) Using DPA-4 and DPA-5 as chassis strains, the pETDuet-panB-panC-alsS expression plasmid was introduced into the chassis strains to obtain genetically engineered bacteria DPA-8 and DPA-9;
[0029] 8) Using DPA-6 as the chassis strain, the pETDuet-panB-panC-alsS expression plasmid was introduced into the chassis strain to obtain the genetically engineered strain DPA-10.
[0030] Preferably, in step 4), Escherichia coli Nissle 1917 is used as the chassis strain, and Red homologous recombination technology is used to knock out the CRP gene and CRA gene in the EcN genome.
[0031] Specifically, the present invention provides a genetically engineered probiotic with high D-pantothenic acid production, wherein the genetically engineered probiotic with high D-pantothenic acid production is constructed using EcN as a base bacteria, and the construction method thereof comprises the following steps:
[0032] (1) Using Escherichia coli Nissle 1917 as the base strain, the panB gene and panC gene derived from EcN were constructed into the pETDuet plasmid in the pantothenic acid synthesis branch pathway to obtain pETDuet-panB and pETDuet-panC recombinant plasmids; then using EcN as the base strain and the pETDuet-panB recombinant plasmid as the template, the panC gene derived from the EcN in the pantothenic acid synthesis branch pathway was further constructed into the pETDuet-panB plasmid to obtain the pETDuet-panB-panC expression plasmid, which was then introduced into the EcN base strain to obtain a genetically engineered bacterium that produces D-pantothenic acid, thereby obtaining the genetically engineered bacterium DPA-1;
[0033] (2) Using EcN as the chassis strain, the alsS gene from Bacillus subtilis was constructed into the pETDuet plasmid in the pantothenic acid synthesis branch pathway to obtain the pETDuet-alsS expression plasmid, which was then introduced into the EcN chassis strain to obtain a genetically engineered bacterium that produces D-pantothenic acid, thereby obtaining the genetically engineered bacterium DPA-2;
[0034] (3) The alsS gene, panB gene, and panC gene were selected from the pantothenic acid synthesis branch pathway, and they were tandemly constructed into the pETDuet plasmid to obtain the pETDuet-panB-panC-alsS expression plasmid, which was then introduced into the EcN chassis strain to obtain a genetically engineered bacterium that produces D-pantothenic acid, thereby obtaining the genetically engineered bacterium DPA-3;
[0035] (4) Using EcN as the base strain, the Red homologous recombination technology was used to knock out the cAMP-activated global transcriptional regulator CRP gene and the catabolite repressor or activator CRA gene to obtain the genetically engineered bacteria DPA-4 and DPA-5;
[0036] (5) Using DPA-4 as the base strain, Red homologous recombination technology was used to iteratively knock out the catabolite repressor or activator (CRA) gene to obtain the genetically engineered strain DPA-6;
[0037] (6) Using DPA-6 as the base strain, the pETDuet-panB-panC expression plasmid was introduced into the base strain to obtain the genetically engineered strain DPA-7;
[0038] (7) Using DPA-4 and DPA-5 as chassis strains, the pETDuet-panB-panC-alsS expression plasmid was introduced into the chassis strain to obtain genetically engineered strains DPA-8 and DPA-9;
[0039] (8) Using DPA-6 as the chassis strain, the pETDuet-panB-panC-alsS expression plasmid was introduced into the chassis strain to obtain the genetically engineered bacterium DPA-10.
[0040] The Trc promoter nucleotide sequence is shown in SEQ ID NO.1 and is derived from Ptrc99a, which is purchased from Addgene and has a product number of VT294. The nucleotide sequence of the panB gene regulated by the promoter Trc is shown in SEQ ID NO.2; the nucleotide sequence of the panC gene is shown in SEQ ID NO.3; and the nucleotide sequence of the alsS gene is shown in SEQ ID NO.4.
[0041] The present invention also provides an application of a genetically engineered probiotic bacteria with high D-pantothenic acid production in the preparation of D-pantothenic acid.
[0042] The present invention also provides an application of a genetically engineered probiotic constructed by the construction method of a genetically engineered probiotic with high D-pantothenic acid production in the production of D-pantothenic acid by shake flask fermentation.
[0043] Preferably, the application method is: inoculating the genetically engineered probiotics with high D-pantothenic acid production into a shake flask for fermentation and culturing at 28-37°C and 150-220rpm for 24-48h. After the fermentation is completed, the fermentation liquid is centrifuged to obtain the supernatant, which is then separated and purified to obtain D-pantothenic acid.
[0044] More preferably, the application method is: inoculate the seed culture solution with 1% inoculation amount into 500mL shake flask with 50mL liquid volume for fermentation culture, add 0.5gCaCO 3 Powder to adjust the pH of the fermentation broth, add 50 μL of metal salt mother solution to every 50 mL of fermentation medium, metal salt mother solution: 10 g / LCuCl 2 、10g / LFeSO 4 7H 2 O, 1g / LZnSO 4 7H 2 O, 0.2g / LCuSO 4 , 0.02g / LNiCl 2 7H 2 O. In addition, 610 μL of four-in-one supplement is added to the fermentation medium, which includes 100 g / L β-alanine, 5 g / L VVB 1 , 2g / LVB 12 , 1M β-D-thiogalactoside (IPTG). Ferment and culture for 24 to 48 hours at 28 to 37°C and 150 to 220 rpm. Centrifuge the culture solution and filter the supernatant with a 0.22 μm water filter to separate and purify D-pantothenic acid.
[0045] The precursors of D-pantothenic acid are mainly β-alanine and pantoic acid, so there are two metabolic pathways to synthesize D-pantothenic acid. In the pantothenic acid synthesis metabolic pathway, glucose enters the cell and generates pyruvate through the glycolysis pathway (EMP), and pyruvate then goes through the steps of (S)-2-acetolactate, (R)-2,3-dihydroxyisovalerate, α-ketoisovalerate, and ketopantoic acid to obtain pantothenic acid. In the β-alanine synthesis pathway, phosphoenolpyruvate is obtained after the EMP pathway, and phosphoenolpyruvate is synthesized into oxaloacetate under the action of phosphoenolpyruvate carboxylase, and then oxaloacetate is converted into L-aspartic acid, or oxaloacetate is synthesized into fumaric acid through the tricarboxylic acid cycle (TCA), and then fumaric acid is converted into L-aspartic acid, and L-aspartic acid is converted into β-alanine. The invention strengthens the synthesis of pantothenic acid precursor by adding exogenous β-alanine, and knocks out the cAMP-activated global transcription regulator CRP gene and the catabolite repressor or activator CRA gene, and finally obtains a genetic engineering strain with high D-pantothenic acid production.
[0046] Compared with the prior art, the beneficial effects of the present invention are mainly reflected in:
[0047] 1. The genetically engineered strain of the present invention enhances the pantothenate pathway for synthesizing pantothenic acid precursors by overexpressing the key genes panB and panC for D-pantothenic acid synthesis;
[0048] 2. The genetically engineered strain of the present invention enhances the accumulation of pyruvate into acetolactate by overexpressing the alsS gene derived from Bacillus subtilis;
[0049] 3. The genetically engineered strain of the present invention performs gene editing on the chassis strain EcN, and knocks out the catabolite repressor or activator (CRA) gene in its genome, so that it can better utilize glucose as a carbon source to synthesize D-pantothenic acid precursor pantothenic acid, and improve sugar uptake and metabolism capacity compared with the wild strain;
[0050] 4. The genetically engineered strain of the present invention performs gene editing on the chassis strain EcN, knocks out the cAMP-activated global transcription regulator (CRP) gene in its genome, and increases the mRNA transcription level of key genes in the EcN genome;
[0051] 5. Plasmids were used to express panB, panC and alsS genes; (6) under the condition of exogenous addition of β-alanine, the pathway for the synthesis of pantothenic acid, the precursor of D-pantothenic acid, was enhanced.
[0052] 6. Among the genetically engineered strains obtained after metabolic engineering, the best-performing genetically engineered strain produced D-pantothenic acid at a titer of 287 mg / L in shake flask fermentation, compared with 5 mg / L of the wild EcN strain. Therefore, the EcN genetically engineered strain provided by the present invention has important industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0053] Figure 1 A schematic diagram of the biosynthetic pathway of a genetically engineered bacterium that produces high levels of D-pantothenic acid provided by the present invention;
[0054] Figure 2 The HPLC chromatogram of D-pantothenic acid detected by high performance liquid chromatography (HPLC) in Example 2;
[0055] Figure 3 is the OD of the DPA-1 and DPA-2 genetically engineered bacteria in Example 3 600 Compared with the titer bar graph;
[0056] Figure 4 is the OD of the DPA-1 and DPA-3 genetically engineered bacteria in Example 4 600 Compared with the titer bar graph;
[0057] Figure 5 is the OD of the DPA-1 and DPA-7 genetically engineered bacteria in Example 7 600 Compared with the titer bar graph;
[0058] Figure 6 is the OD of the DPA-3, DPA-8 and DPA-9 genetically engineered bacteria in Example 8 600 Compared with the titer bar graph;
[0059] Figure 7 is the OD of the genetically engineered bacteria DPA-3, DPA-8, DPA-9 and DPA-10 in Example 9 600 Compare with the titer bar graph. DETAILED DESCRIPTION
[0060] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.
[0061] It should be noted that the process equipment or devices not specifically specified in the following embodiments are all conventional equipment or devices in the art.
[0062] In addition, it should be understood that one or more method steps mentioned in the present invention do not exclude the existence of other method steps before or after the combination step or the insertion of other method steps between these explicitly mentioned steps, unless otherwise specified; it should also be understood that the combination connection relationship between one or more devices / apparatuses mentioned in the present invention does not exclude the existence of other devices / apparatuses before or after the combination device / apparatus or the insertion of other devices / apparatuses between these explicitly mentioned two devices / apparatuses, unless otherwise specified. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, and is not intended to limit the order of arrangement of each method step or the scope of the present invention. Changes or adjustments in their relative relationships should also be regarded as the scope of the present invention without substantially changing the technical content.
[0063] In the present invention:
[0064] LB plate: 10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl and 2 g / L agar powder.
[0065] LB liquid medium: 10 g / L peptone, 5 g / L yeast powder and 10 g / L NaCl.
[0066] MS fermentation medium: 20 g / L glucose, 16 g / L (NH 4 ) 2 SO 4 , 2g / L KH 2 PO 4 , 0.5 g / L MgSO 4 , 2g / L yeast powder.
[0067] Metal salt mother solution: 10g / LCuCl 2 、10g / LFeSO 4 7H 2 O, 1g / LZnSO 4 7H 2 O, 0.2g / LCuSO 4 , 0.02g / LNiCl 2 7H 2 O.
[0068] Four-in-one supplement: 100g / L β-alanine, 5g / LVB 1 , 2g / LVB 12 , 1M β-D-thiogalactoside (IPTG).
[0069] The nucleotide sequences involved in the following embodiments are specifically: the nucleotide sequence of the Trc promoter is shown in SEQ ID NO.1 (derived from Ptrc99a, the plasmid was purchased from Addgene, and the product number is VT294); the nucleotide sequence of the panB gene is shown in SEQ ID NO.2, the nucleotide sequence of the panC gene is shown in SEQ ID NO.3, the nucleotide sequence of the alsS gene is shown in SEQ ID NO.4, the nucleotide sequence of the CRA gene is shown in SEQ ID NO.5, and the nucleotide sequence of the CRP gene is shown in SEQ ID NO.6.
[0070] The primers involved in the construction of the expression plasmid are shown in Table 1. The primers involved in the knockout of the CRP gene and the CRA gene are shown in Table 2. Escherichia coli Nissle 1917 (abbreviated as EcN) was purchased from Hangzhou Baosai Biotechnology Co., Ltd., product number T0023.
[0071] Table 1 Nucleotide sequences of primers
[0072]
[0073] Table 2 Nucleotide sequences of primers
[0074]
[0075]
[0076] Example 1
[0077] Preparation of EcN competent cells:
[0078] (1) Preparation of EcN competent cells for chemical transformation:
[0079] Take the bacteria in the glycerol tube and streak it on LB solid medium, invert and culture it at 37℃ overnight, pick a single colony from it, inoculate it into 10mL LB liquid medium, and culture it at 37℃, 180rpm, overnight; then take the overnight culture solution and transfer (1% inoculation volume) into 50mL LB liquid medium, and culture it at 37℃, 180rpm, for 2-3h, until OD 600 =0.5-0.6; transfer the bacterial solution to a 50 mL sterile centrifuge tube in a clean bench, centrifuge at 4°C, 4000 rpm, for 8 min, and discard the supernatant; then add 20 mL of pre-cooled 0.1 M CaCl 2 Solution, resuspend cells, and ice bath for 30 minutes; after the ice bath, centrifuge at 4°C, 4000 rpm, for 8 minutes, discard the supernatant, and add 1 mL of pre-cooled sterile CaCl according to the amount of bacteria. 2 + Glycerol solution (0.1 M CaCl 2, 15% glycerol), resuspend the cells, and dispense 100 μL of the cell resuspension into each 1.5 mL Eppendorf tube for immediate use or storage at -80°C for later use.
[0080] (2) Preparation of EcN competent cells by high voltage electroporation:
[0081] Take the bacteria in the glycerol tube and streak it on LB solid culture medium, invert and culture it at 30°C overnight, pick a single colony (containing pKD46 plasmid, pKD46 plasmid purchased from Youbao Biotechnology Co., Ltd., product number VT1692), inoculate it into 10mL SOB liquid culture medium, and add 10μL Amp (100mg / mL) resistance and 100μL arabinose (1M), culture at 30°C, 180rpm, for 10h, take 50μL of bacterial solution and transfer it to new 10mL SOB liquid culture medium, and add 10μL Amp (100mg / mL) resistance and 100μL arabinose (1M), culture at 30°C, 180rpm, for 16h; then take 1mL of bacterial solution and transfer it to 50mL SOB culture medium, and add 50μL Amp (100mg / mL) resistance and 500μL arabinose (1M), culture at 30°C, 180rpm, for 3-4h, until OD 600 =0.6~0.8; transfer the bacterial solution to a 50mL sterile centrifuge tube, centrifuge at 4℃, 4000rpm for 10min, and discard the supernatant. Then add 30mL of pre-cooled sterile water, resuspend the cells, centrifuge at 4℃, 4000rpm for 10min, discard the supernatant, repeat this step once; add 20mL10% glycerol, resuspend the cells, centrifuge at 4℃, 4000rpm for 8min, and discard the supernatant; add 1mL10% glycerol, resuspend the cells, and dispense 100μL of the cell resuspension into each 1.5mLEp tube, use immediately or store at -80℃ for later use. SOB medium: 20g / L peptone, 5g / L yeast extract, 0.5g / LNaCl, 2.5mMKCl, 10mMMgCl 2 .
[0082] Plasmid transformation:
[0083] (1) Chemical transformation method:
[0084] Take out the chemically transformed EcN competent cells and place them on ice for 5 minutes. After natural thawing, add 5 μL of the constructed expression plasmid in the clean bench, mix well, and place on ice for 30 minutes; then heat shock in a 42°C water bath for 90 seconds, and immediately place on ice for 3 minutes, then add 700 μL LB medium, and culture at 37°C or 30°C, 180rpm, for 1 hour; after the culture is completed, centrifuge at 6000rpm for 1 minute, retain a small amount of supernatant, resuspend and spread on the LB plate (resistance is the same as plasmid resistance), place the plate in an incubator at the corresponding temperature, and culture it upside down overnight.
[0085] (2) High-voltage electroporation method for competent transformation:
[0086] Take an electroporated EcN competent cell containing pKD46 plasmid and place it on ice for 5 minutes. After it thaws naturally, add 10μL of purified DNA fragments in a clean bench, mix well, and place it on ice for 1 minute; move it to a pre-cooled electroporation cup, place it on ice for 1 minute, and electroporate (this step must be completed quickly); after electroporation, add 700μL SOB liquid culture medium to the groove of the electroporation cup in the clean bench, absorb all the bacterial liquid, transfer it to a 1.5mL sterile Ep tube, and culture it at 30℃, 180rpm, and 3-4h; after the culture is completed, centrifuge at 6000rpm for 1min, retain a small amount of supernatant, resuspend it and spread it on an LB plate (the resistance is the same as the plasmid resistance), place the plate in a 37℃ incubator, and culture it upside down overnight.
[0087] Example 2
[0088] HPLC determination of D-pantothenic acid content, the detection method is as follows:
[0089] D-pantothenic acid content detection: The diluted fermentation broth supernatant was filtered through a 0.22 μm water filter membrane for high performance liquid chromatography (HPLC) detection. The detection conditions of D-pantothenic acid by high performance liquid chromatography are as follows: ① mobile phase composition: 95% ultrapure water, 4.9% acetonitrile, 0.1% phosphoric acid, filtered with a 0.22 μm microporous organic filter membrane and ultrasonicated to remove bubbles; ② chromatographic column model: C18 chromatographic column (250×4.6 mm, 5 μm, Agilent Technologies Co, Santa Clara, CA, USA); ③ detection parameters: injection volume 10 μL, column temperature 30°C, flow rate 1 mL / min, detection wavelength 200 nm, acquisition time 20 min; ④ HPLC method for determination of D-pantothenic acid content in fermentation broth Sample treatment: take 2 mL of fermentation broth, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute the supernatant with ultrapure water for an appropriate multiple, pass through a 0.22 μm water filter membrane, and keep the D-pantothenic acid content between 50 and 100 mg / L.
[0090] The HPLC chromatographic test results of D-pantothenic acid are as follows Figure 2 As shown. Figure 2 It can be seen that D-pantothenic acid will emit a peak at 16.3 minutes after HPLC detection.
[0091] Example 3
[0092] Construction and shake flask fermentation of DPA-1 and DPA-2 genetically engineered bacteria:
[0093] (1) Construction of plasmid pETDuet-panB:
[0094] Using the pETDuet plasmid as a template and X-pETDuet-F / X-pETDuet-R as primers for PCR amplification, the PCR product was digested with DpnI at 37°C for 1 hour and purified using a DNA purification kit to obtain the linearized vector plasmid fragment X-pETDuet. Using the EcN genome as a template and panB-F / panB-R as primers for PCR amplification, the PCR product was purified using a DNA purification kit to obtain the panB gene fragment. The target fragment and the vector were cloned in one step and then transformed into E.coli DH5α. Colony PCR and sequencing were performed to verify the correct pETDuet-panB recombinant plasmid.
[0095] (2) Construction of expression plasmid pETDuet-panB-panC:
[0096] Using pETDuet-panB plasmid as a template and X-pETDuet-BF / X-pETDuet-BR as primers for PCR amplification, the PCR product was digested with DpnI at 37°C for 1 hour and purified using a DNA purification kit to obtain the linearized vector plasmid fragment X-pETDuet-B. Using the EcN genome as a template and panC-F / panC-R as primers for PCR amplification, the PCR product was purified using a DNA purification kit to obtain the panC gene fragment. The target fragment and the vector were cloned in one step and then transformed into E.coli DH5α. Colony PCR and sequencing were performed to verify the correct pETDuet-panB-panC expression plasmid.
[0097] (3) Construction of expression plasmid pETDuet-alsS:
[0098] Using the pETDuet plasmid as a template and X-pETDuet-F / X-pETDuet-R as primers for PCR amplification, the PCR product was digested with DpnI and purified to obtain the linearized vector plasmid fragment X-pETDuet. Using the Bacillus subtilis genome as a template and alsS-F / alsS-R as primers for PCR amplification, the PCR product was purified using a DNA purification kit to obtain the alsS gene fragment. The target fragment and the vector were cloned in one step and then transformed into E. coli DH5α. Colony PCR and sequencing were performed to verify the correct pETDuet-alsS expression plasmid.
[0099] (4) Construction of DPA-1 and DPA-2 genetically engineered bacteria:
[0100] The successfully constructed pETDuet-panB-panC and pETDuet-alsS expression plasmids were introduced into EcN competent cells, and colony PCR and sequencing were performed to verify the correct DPA-1 and DPA-2 genetically engineered bacteria.
[0101] (5) Shake flask fermentation of DPA-1 and DPA-2 genetically engineered bacteria:
[0102] The constructed DPA-1 and DPA-2 genetically engineered bacteria were streaked from the glycerol tube onto the LB plate containing ampicillin resistance, and a single colony was picked and inoculated into 10 mL LB liquid culture medium containing ampicillin resistance. The bottom plate bacteria EcN was used as a control, and cultured at 37°C, 180rpm, for 10 to 12 hours. 1 mL of the bacterial liquid was transferred to a 500 mL shake flask with 50 mL MS fermentation medium, and one thousandth of a metal salt solution and 50 μL of ampicillin (100 mg / mL) resistance were added. 610 μL of a four-in-one additive was also added to the fermentation medium, and cultured at 30°C, 180rpm, for 48 hours. After the fermentation was completed, the fermentation broth was centrifuged to obtain the supernatant, and the D-pantothenic acid content was detected by HPLC, and the OD was detected by a spectrophotometer. 600 Determine the growth of the strain and the content of D-pantothenic acid. The results are as follows Figure 3 shown.
[0103] Depend on Figure 3 It can be seen that overexpression of panB and panC genes, the key genes for D-pantothenic acid synthesis in the EcN genome, and alsS gene, the key gene for D-pantothenic acid synthesis in the Bacillus subtilis genome, increased the production of D-pantothenic acid, and increased the D-pantothenic acid titer from 5 mg / L in the wild EcN strain to 162 mg / L, which indicates that enhancing the pantothenic acid pathway for the synthesis of D-pantothenic acid precursors helps to increase the production of D-pantothenic acid.
[0104] OD was measured by spectrophotometer 600Methods: After the shake flask fermentation, take 1 mL of fermentation liquid, centrifuge at 12000 rpm for 2 min, discard the supernatant, add 1 mL of ultrapure water, resuspend the cells, centrifuge at 12000 rpm for 2 min, discard the supernatant, add 800 μL of ultrapure water, resuspend the cells, add 200 μL of glacial acetic acid, let it stand for 10-15 min, and wait for the glacial acetic acid to react with CaCO 3 After sufficient reaction, dilute 10 times and measure OD with a spectrophotometer 600 .
[0105] Example 4
[0106] Construction of DPA-3 genetically engineered bacteria and shake flask fermentation:
[0107] (1) Construction of expression plasmid pETDuet-panB-panC-alsS:
[0108] Using the pETDuet-panB-panC plasmid as a template and X-pETDuet-BC-F / X-pETDuet-BC-R as primers for PCR amplification, the PCR product was digested with DpnI at 37°C for 1 hour and purified by a DNA purification kit to obtain the linearized vector plasmid fragment X-pETDuet-BC. Using the Bacillus subtilis genome as a template and alsS-F / alsS-R as primers for PCR amplification, the PCR product was purified by a DNA purification kit to obtain the fragment alsS gene. The target fragment and the vector were cloned in one step and then transformed into E.coliDH5α. Colony PCR and sequencing were performed to verify the correct pETDuet-panB-panC-alsS expression plasmid.
[0109] (2) Construction of DPA-3 genetically engineered bacteria:
[0110] The successfully constructed pETDuet-panB-panC-alsS expression plasmid was introduced into EcN competent cells, and colony PCR and sequencing were performed to verify that the correct DPA-3 genetically engineered bacteria were obtained.
[0111] (3) DPA-3 genetically engineered bacteria shake flask fermentation:
[0112] The constructed DPA-3 genetically engineered bacteria were streaked from the glycerol tube onto an ampicillin-resistant LB plate, and a single colony was picked and inoculated into 10 mL of ampicillin-resistant LB liquid culture medium. The DPA-1 genetically engineered bacteria were used as a control, and cultured at 37°C, 180 rpm, for 10 to 12 h. 1 mL of bacterial solution was transferred to a 500 mL shake flask containing 50 mL of MS fermentation medium, and one thousandth of a metal salt solution and 50 μL Amp (100 mg / mL) resistance were added. 610 μL of a four-in-one additive was also added to the fermentation medium, and cultured at 30°C, 180 rpm, for 48 h. After the fermentation was completed, the fermentation broth was centrifuged to obtain the supernatant, and the D-pantothenic acid content was detected by HPLC, and the OD was detected by a spectrophotometer. 600 Determine the growth of the strain and the content of D-pantothenic acid. The results are as follows Figure 4 shown.
[0113] Depend on Figure 4 It can be seen that the tandem overexpression of the key genes panB, panC and alsS for D-pantothenic acid synthesis did not significantly inhibit the growth of the DPA-3 strain, and at the same time increased the production of D-pantothenic acid, increasing the D-pantothenic acid titer from 164 mg / L in the DPA-1 strain to 212 mg / L. This suggests that the tandem overexpression of the three key genes can further enhance the pantothenic acid pathway for the synthesis of pantothenic acid precursors, helping to increase the production of D-pantothenic acid.
[0114] Example 5
[0115] Construction of DPA-4 and DPA-5 genetically engineered bacteria:
[0116] (1) Construction of ΔCRP and ΔCRA knockout fragments:
[0117] Using pKD4 plasmid as template (pKD4 plasmid was purchased from Ubao Biotechnology, product number VT1690), PCR amplification fragments were obtained using FRT-F and FRT-R as primers to obtain a fragment for providing kanamycin resistance and invertase recognition site FRT, which was purified by a DNA purification kit to obtain the DNA fragment pFRT-Kan-FRT. Using pFRT-Kan-FRT as template, PCR amplification was performed using CRP-F1 and CRP-R1 as primers, and the PCR product obtained after amplification was used as a template and PCR amplification was performed using CRP-F2 and CRP-R2 as primers. The PCR product was purified by a DNA purification kit to obtain pFRT-Kan-FRT with 50 bp nucleotide sequences upstream and downstream of the CRP gene at both ends, and finally the ΔCRP knockout fragment was obtained. Using pFRT-Kan-FRT as a template and CRA-F1 and CRA-R1 as primers for PCR amplification, the PCR product obtained after amplification was used as a template and CRA-F2 and CRA-R2 as primers for PCR amplification. The PCR product was purified by a DNA purification kit to obtain pFRT-Kan-FRT with 50bp nucleotide sequences upstream and downstream of the CRA gene at both ends, and finally the ΔCRA knockout fragment was obtained.
[0118] (2) Construction of EcN genetically engineered bacteria containing pKD46 plasmid and preparation of electroporation competent cells
[0119] The EcN strain of chassis bacteria was made into a chemical transformation competent state, and the pKD46 plasmid was introduced into the EcN competent cells by chemical transformation. Colony PCR and sequencing were performed to verify the correct EcN-pKD46 genetic engineering strain. The constructed EcN-pKD46 genetic engineering bacteria was made into a high-voltage electroporation competent state. The above has detailed the preparation methods of chemical transformation and electroporation competent states.
[0120] (3) ΔCRP and ΔCRA knockout fragments were introduced into EcN-pKD46 electroporation competent cells
[0121] The competent state of EcN-pKD46 high-voltage electroporation method was taken out, and 10 μL of purified ΔCRP and ΔCRA knockout fragments were added respectively in the clean bench and mixed evenly; it was moved to a pre-cooled electroporation cup, electroporated, 700 μL SOB liquid culture medium was added to the electroporation cup, all the liquid was aspirated, and transferred to a 1.5 mL sterile Ep tube, and cultured at 30°C, 180 rpm for 3-4 h; after the culture was completed, centrifuged at 6000 rpm for 1 min, a small amount of supernatant was retained, and the plate was resuspended and spread on an LB plate containing kanamycin resistance, and the plate was placed in a 37°C incubator (pKD46 is a temperature-sensitive plasmid, and the pKD46 plasmid can be eliminated at 37°C), inverted and cultured overnight, colony PCR, sequencing verified that kanamycin resistance and the reverse enzyme recognition site FRT successfully replaced the CRP gene and CRA gene in the EcN genome, and a genetically engineered bacterium was obtained.
[0122] (4) Genetically engineered bacteria were introduced into the pCP20 plasmid to eliminate the resistance gene
[0123] The genetically engineered strains that have successfully replaced the CRP gene and CRA gene in the EcN genome with the kanamycin resistance and the reverse enzyme recognition site FRT verified by sequencing were made into chemical transformation competent cells. The pCP20 plasmid (pCP20 plasmid was purchased from Youbao Biological Company, product number VT1693) was introduced into the competent cells by chemical transformation, and the DPA-4 and DPA-5 genetically engineered bacteria containing the pCP20 plasmid were obtained by inverted culture at 30°C, 180rpm, and sequencing verification. The DPA-4 and DPA-5 genetically engineered bacteria containing the pCP20 plasmid were inoculated into 10mL LB liquid culture medium, and cultured overnight at 37°C, 180rpm (pCP20 is a temperature-sensitive plasmid, and the pCP20 plasmid can be eliminated under 37°C), and finally the gene-deficient DPA-4 and DPA-5 genetically engineered bacteria were obtained.
[0124] Example 6
[0125] Construction of DPA-6 genetically engineered bacteria:
[0126] (1) Construction of DPA-4 genetically engineered bacteria containing pKD46 plasmid and preparation of electroporation competent cells
[0127] The DPA-4 genetically engineered bacteria were made into chemical transformation competent cells, and the pKD46 plasmid was introduced into the chemical transformation competent cells by chemical transformation. Colony PCR and sequencing were performed to verify the correct DPA-4-pKD46 genetically engineered strain, and the constructed DPA-4-pKD46 genetically engineered bacteria were made into high-voltage electroporation competent cells.
[0128] (2) Introducing the ΔCRA knockout fragment into electroporated competent cells and eliminating the pCP20 plasmid
[0129] Take out the DPA-4-pKD46 electroporation competent cell, add 10 μL of the purified ΔCRA knockout fragment in the clean bench, and mix well; move it to a pre-cooled electroporation cup, electroporate, add 700 μL SOB liquid culture medium to the electroporation cup, aspirate all the liquid, transfer to a 1.5 mL sterile Ep tube, and culture at 30°C, 180 rpm for 3 to 4 hours; spread it on an LB plate containing kanamycin resistance, place the plate in a 37°C incubator, invert and culture overnight, perform colony PCR, and sequence to verify that kanamycin resistance and the reverse enzyme recognition site FRT successfully replaced the CRA gene in the DPA-4 bacterial genome to obtain a genetically engineered bacterium.
[0130] The genetically engineered strains that have successfully replaced the CRA gene in the DPA-4 bacterial genome with kanamycin resistance verified by sequencing and the reverse enzyme recognition site FRT were made into chemical transformation competent cells. The pCP20 plasmid was introduced into the competent cells by chemical transformation, and the cells were inverted and cultured overnight at 30°C, 180rpm, and colony PCR and sequencing were performed to obtain the DPA-6 genetically engineered bacteria containing the pCP20 plasmid. The DPA-6 genetically engineered bacteria containing the pCP20 plasmid were inoculated into 10mL LB liquid culture medium, and cultured overnight at 37°C, 180rpm to finally obtain the gene-deficient DPA-6 genetically engineered bacteria.
[0131] Example 7
[0132] Construction of DPA-7 genetically engineered bacteria and shake flask fermentation:
[0133] (1) Construction of DPA-7 genetically engineered bacteria
[0134] The DPA-6 genetically engineered bacteria were made into chemical transformation competent cells, and the successfully constructed pETDuet-panB-panC expression plasmid was introduced into the DPA-6 chemical transformation competent cells. Colony PCR and sequencing were performed to verify the correct DPA-7 genetically engineered bacteria.
[0135] (2) DPA-7 genetically engineered bacteria shake flask fermentation:
[0136] The constructed DPA-7 genetically engineered bacteria were streaked from the glycerol tube onto an LB plate containing ampicillin resistance, and a single colony was picked and inoculated into a 10 mL LB liquid culture medium containing ampicillin resistance. The DPA-1 genetically engineered bacteria were used as a control, and cultured at 37°C, 180 rpm, for 8 to 12 h. 1 mL of bacterial liquid was transferred to a 500 mL shake flask containing 50 mL MS fermentation medium, and one thousandth of a metal salt solution and 50 μL Amp (100 mg / mL) resistance were added. 610 μL of a four-in-one additive was also added to the fermentation medium, and cultured at 30°C, 180 rpm, for 48 h. After the fermentation was completed, the fermentation broth was centrifuged to obtain the supernatant, and the D-pantothenic acid content was detected by HPLC, and the OD was detected by a spectrophotometer. 600 Determine the growth of the strain and the content of D-pantothenic acid. The results are as follows Figure 5 shown.
[0137] Depend on Figure 5 It can be seen that the growth of DPA-7 strain was significantly inhibited by knocking out the cAMP-activated global transcription regulator (CRP) gene and the catabolite repressor or activator (CRA) gene in the EcN genome using the Red homologous recombination method, but the production of D-pantothenic acid was increased, and the D-pantothenic acid titer increased from 161 mg / L to 209 mg / L, which indicates that knocking out the CRP gene and the CRA gene is beneficial to the synthesis of D-pantothenic acid by EcN.
[0138] Example 8
[0139] Construction and shake flask fermentation of DPA-8 and DPA-9 genetically engineered bacteria:
[0140] (1) Construction of DPA-8 and DPA-9 genetically engineered bacteria
[0141] The DPA-4 and DPA-5 genetically engineered bacteria were made competent for chemical transformation, and the successfully constructed pETDuet-panB-panC-alsS expression plasmid was introduced into the DPA-4 and DPA-5 competent cells. Colony PCR and sequencing were performed to verify that the correct DPA-8 and DPA-9 genetically engineered bacteria were obtained.
[0142] (2) Shake flask fermentation of DPA-8 and DPA-9 genetically engineered bacteria:
[0143] The constructed DPA-8 and DPA-9 genetically engineered bacteria were streaked from the glycerol tube onto the LB plate containing ampicillin resistance, and a single colony was picked and inoculated into 10 mL LB liquid culture medium containing ampicillin resistance. The DPA-3 genetically engineered bacteria was used as a control, and cultured at 37°C, 180 rpm, for 8 to 12 hours. 1 mL of bacterial liquid was transferred to a 500 mL shake flask with 50 mL MS fermentation medium, and one thousandth of a metal salt solution and 50 μL Amp (100 mg / mL) resistance were added. 610 μL of a four-in-one additive was also added to the fermentation medium, and cultured at 30°C, 180 rpm, for 48 hours. After the fermentation was completed, the fermentation broth was centrifuged to obtain the supernatant, and the D-pantothenic acid content was detected by HPLC, and the OD was detected by a spectrophotometer. 600 Determine the growth of the strain and the content of D-pantothenic acid. The results are as follows Figure 6 shown.
[0144] Depend on Figure 6 It can be seen that by knocking out the cAMP-activated global transcription regulator (CRP) gene or the catabolite repressor or activator (CRA) gene in the EcN genome using the Red homologous recombination method, the growth of both DPA-8 and DPA-9 strains was significantly inhibited, but the production of D-pantothenic acid was increased, and the D-pantothenic acid titer increased from 202 mg / L to 237 mg / L, which indicates that knocking out the CRP gene or CRA gene is beneficial to the synthesis of D-pantothenic acid by EcN.
[0145] Example 9
[0146] Construction of DPA-10 genetically engineered bacteria and shake flask fermentation:
[0147] (1) Construction of DPA-10 genetically engineered bacteria
[0148] The DPA-6 genetically engineered bacteria were made competent for chemical transformation, and the successfully constructed pETDuet-panB-panC-alsS expression plasmid was introduced into the DPA-6 competent cells. Colony PCR and sequencing were performed to verify that the correct DPA-10 genetically engineered bacteria were obtained.
[0149] (2) DPA-10 genetically engineered bacteria shake flask fermentation:
[0150] The constructed DPA-10 genetically engineered bacteria were streaked from the glycerol tube onto an LB plate containing ampicillin resistance, and a single colony was picked and inoculated into 10 mL of LB liquid medium with ampicillin resistance. The DPA-3, DPA-8 and DPA-9 genetically engineered bacteria were used as controls, and cultured at 37°C, 180 rpm, for 8 to 12 h. 1 mL of bacterial solution was transferred to a 500 mL shake flask containing 50 mL of MS fermentation medium, and one thousandth of a metal salt solution and 50 μL Amp (100 mg / mL) resistance were added. 610 μL of a four-in-one additive was also added to the fermentation medium, and cultured at 30°C, 180 rpm, for 48 h. After the fermentation was completed, the fermentation broth was centrifuged to obtain the supernatant, and the D-pantothenic acid content was detected by HPLC, and the OD was detected by a spectrophotometer. 600 Determine the growth of the strain and the content of D-pantothenic acid. The results are as follows Figure 7 shown.
[0151] Depend on Figure 7 It can be seen that the cAMP-activated global transcription regulator (CRP) gene and the catabolite repressor or activator (CRA) gene in the EcN genome were knocked out by the Red homologous recombination method to obtain a gene-deficient strain, and then the pETDuet-panB-panC-alsS expression plasmid was introduced. The growth of the DPA-10 strain was significantly inhibited, but the production of D-pantothenic acid was increased, and the D-pantothenic acid titer increased from 202 mg / L to 287 mg / L. This shows that overexpression of key genes and knockout of CRP and CRA genes are beneficial to EcN synthesis of D-pantothenic acid.
[0152] SEQ ID NO.1 (Trc gene):
[0153] TTGACAATTAATCATCCGGCTCGTATAATG
[0154] SEQ ID NO.2 (panB gene):
[0155] ATGAAACCAACCACGATTGCTTCATTGCAGAAATGCAAGCAGGATAAAAAGCGTTTTGCGACCATCA
[0156] CCGCTTACGACTACAGCTTCGCTAAACTGTTTGCCGAAGAAGGACTTAACGTCATGCTGGTAGGCGAT
[0157] TCACTGGGCATGACGGTTCAGGGGCATGACTCCACGCTACCGGTTACCGTTGCTGATATCGCCTATCA
[0158] CACCGCCGCTGTGCGCCGCGGTGCGCCAAACTGCCTTCTGTTAGCAGACCTGCCATTTATGGCGTATG
[0159] CCACGCCGGAACAAGCCTTTGAAAACGCCGCAACGGTAATGCGTGCCGGAGCCAACATGGTCAAAAT
[0160]
[0161] SEQ ID NO.3 (panC gene):
[0162] SEQ ID NO.4 (alsS gene):
[0163]
[0164]
[0165] SEQ ID NO.5 (CRP gene):
[0166]
[0167] SEQ ID NO.6 (CRA gene):
[0168]
[0169] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limitations of the present invention. In addition, the various modifications listed herein and the variations of methods and compositions in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications obvious to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.
Claims
1. A genetically engineered probiotic for high production of D-pantothenic acid, characterized in that: The method of constructing the system using Escherichia coli as the base bacteria includes at least one of the following steps: (1) Overexpression of panB and panC genes from the genome of Chaetococcus spp.; (2) overexpression of the alsS gene from Bacillus subtilis; (3) Knock out the CRP gene and CRA gene in the genome of the bottom bacteria.
2. The genetically engineered probiotic bacteria for high production of D-pantothenic acid according to claim 1, characterized in that: The bottom plate bacteria is Escherichia coli Nissle 1917.
3. The genetically engineered probiotic bacteria for high production of D-pantothenic acid according to claim 1, characterized in that: The promoters of the panB gene, the panC gene and the alsS gene are all the strong promoter Trc.
4. The genetically engineered probiotic bacteria for high production of D-pantothenic acid according to claim 3, characterized in that: The nucleotide sequence of the strong promoter Trc is shown in SEQ ID NO.
1.
5. The genetically engineered probiotic bacteria for high production of D-pantothenic acid according to claim 1, characterized in that: The nucleotide sequence of the panB gene is shown in SEQ ID NO.2, the nucleotide sequence of the panC gene is shown in SEQ ID NO.3; and the nucleotide sequence of the alsS gene is shown in SEQ ID NO.
4.
6. The genetically engineered probiotic bacteria for high production of D-pantothenic acid according to claim 1, characterized in that: The nucleotide sequence of the CRP gene is shown in SEQ ID NO.5; the nucleotide sequence of the CRA gene is shown in SEQ ID NO.
6.
7. The method for constructing a genetically engineered probiotic bacteria with high D-pantothenic acid production according to any one of claims 1 to 6, characterized in that: At least one of the following steps is included: 1) Using the plasmid expression system, the panB gene and panC gene were constructed into the pETDuet plasmid and regulated by P trc The expression plasmid pETDuet-panB-panC obtained by promoter regulation was transferred into the chassis bacteria to obtain the genetically engineered bacteria DPA-1; 2) Using the plasmid expression system, the alsS gene was constructed into the pETDuet plasmid and regulated by P trc The expression plasmid pETDuet-alsS obtained by promoter regulation was transferred into the chassis bacteria to obtain the genetically engineered bacteria DPA-2; 3) Using the plasmid expression system, the alsS gene, panB gene and panC gene were constructed into the pETDuet plasmid and regulated by P trc The expression plasmid pETDuet-panB-panC-alsS obtained by promoter regulation was transferred into the chassis bacteria to obtain the genetically engineered bacteria DPA-3; 4) Using EcN as the base strain, knocking out the CRP gene and the CRA gene, and obtaining the genetically engineered bacteria DPA-4 and DPA-5; 5) Using DPA-4 as the base strain, the CRA gene was iteratively knocked out to obtain the genetically engineered strain DPA-6; 6) Using DPA-6 as the chassis strain, the pETDuet-panB-panC expression plasmid was introduced into the chassis strain to obtain the genetically engineered strain DPA-7; 7) Using DPA-4 and DPA-5 as chassis strains, the pETDuet-panB-panC-alsS expression plasmid was introduced into the chassis strains to obtain genetically engineered bacteria DPA-8 and DPA-9; 8) Using DPA-6 as the chassis strain, the pETDuet-panB-panC-alsS expression plasmid was introduced into the chassis strain to obtain the genetically engineered strain DPA-10.
8. The method for constructing a genetically engineered probiotic bacteria that produces high levels of D-pantothenic acid as claimed in claim 7, characterized in that: In step 4), Escherichia coli Nissle1917 was used as the chassis strain, and Red homologous recombination technology was used to knock out the CRP gene and CRA gene in the EcN genome.
9. Use of the genetically engineered probiotic bacteria with high D-pantothenic acid production according to any one of claims 1 to 6 in the preparation of D-pantothenic acid.
10. The use according to claim 9, characterized in that The application method is: inoculating the genetically engineered probiotics with high D-pantothenic acid production into a shake flask for fermentation and culturing at 28-37°C and 150-220rpm for 24-48h. After the fermentation is completed, the fermentation liquid is centrifuged to obtain the supernatant, and then separated and purified to obtain D-pantothenic acid.
Citation Information
Patent Citations
High-yield D-pantothenic acid gene engineering strain, construction method and application
CN119162217A