A high specific activity lipase mutant and its application

By performing Q164S single point mutation on lipase and expressing it in Pichia yeast, the specific vitality of lipase is significantly improved, the problem of insufficient specific vitality of existing lipase is solved, and its application in industrial fields such as oil processing is promoted.

CN120098960BActive Publication Date: 2025-09-02WEIFANG KANGDIEN BIOTECH LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510600060.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-12
Publication Date
2025-09-02
Estimated Expiration
2045-05-12

AI Technical Summary

Technical Problem

The specific vitality of existing lipases is insufficient, which limits its wide application in industrial fields such as oil processing.

Method used

By mutating the amino acid sequence of lipase, especially mutating the amino acid at position 164 of lipase from Gln to Ser, Q164S single point mutant is formed, and recombinantly expressed in Pichia cerevisiae, its specific vitality is improved.

Benefits of technology

The specific vitality of lipase mutants increased by 33.7%, reducing production costs and promoting their application in oil processing and other fields.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to the fields of genetic engineering and protein engineering, and specifically to a high-specific-activity lipase mutant and its applications. Compared to the wild-type, the mutant has a 33.7% increase in specific activity, which helps reduce production costs and promotes its widespread application in industries such as oil and fat processing.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and protein engineering, and in particular to a high-specific-activity lipase mutant and application thereof. Background Art

[0002] Lipases, also known as triacylglycerol acyl hydrolases, catalyze the hydrolysis of natural substrates, oils and fats, producing fatty acids, glycerol, and mono- or di-glycerides. Lipases are composed solely of amino acids, typically consisting of a single polypeptide chain. Their catalytic activity is determined by their protein structure. Lipases can be categorized as acidic, neutral, and alkaline lipases based on their structural and functional differences.

[0003] Lipases are widely found in plants, animals, and microorganisms. Among plants, the seeds of oilseed crops, such as castor beans and rapeseed, contain the most lipase. When these seeds germinate, lipases work synergistically with other enzymes to catalyze the breakdown of oils and fats into carbohydrates, providing the nutrients and energy necessary for rooting and germination. In animals, the pancreas and adipose tissue of higher animals contain the most lipases. Small amounts of lipase are found in intestinal fluids, supplementing the inadequacy of pancreatic lipase in fat digestion. Small amounts of butyrate glycerol esterase are also found in the gastric fluids of carnivores. In animals, various lipases control processes such as digestion, absorption, fat remodeling, and lipoprotein metabolism. Lipases are even more abundant in bacteria, fungi, and yeast. Because microorganisms are diverse, rapidly reproducing, and prone to genetic variation, they have a wider pH and temperature range, as well as substrate specificity, than their plant and animal counterparts. Furthermore, microbial lipases are generally secreted exoenzymes, making them suitable for large-scale industrial production and the acquisition of high-purity samples. Therefore, microbial lipases are an important source of lipase for industrial use.

[0004] As a highly efficient biocatalyst, lipase plays a vital role in oil and fat processing and fine chemicals. In oil and fat processing, lipase catalyzes hydrolysis reactions to break down triglycerides into fatty acids and glycerol, providing raw materials for industries such as food and detergents. Its transesterification function improves the physical properties of oils and fats, enabling its use in the production of specialized oils such as margarine and cocoa butter substitutes. It also catalyzes the transesterification of animal and vegetable oils with methanol in biodiesel production, promoting the development of green energy. In fine chemicals, lipase can selectively synthesize food emulsifiers such as monoglycerides and sucrose esters, participate in the resolution of chiral drug intermediates, and catalyze the synthesis of high-value-added products such as fragrance esters. Furthermore, lipase exhibits unique advantages in green chemical processes, replacing traditional chemical methods, reducing the use of organic solvents, improving reaction efficiency, and enhancing environmental friendliness. This gives it broad application prospects in industries such as food, energy, pharmaceuticals, and daily chemicals. Summary of the Invention

[0005] The present invention solves the problems of the prior art and provides a high specific activity lipase mutant and its application. The specific activity of the mutant is significantly improved compared with the wild type, which is conducive to its wide application in industrial fields such as oil processing.

[0006] One aspect of the present invention relates to a lipase mutant, which is obtained by mutating the 164th amino acid of the lipase with the amino acid sequence of SEQ ID NO: 1 from Gln to Ser.

[0007] The amino acid sequence of the lipase mutant is SEQ ID NO: 5.

[0008] The present invention also relates to a DNA molecule encoding the above lipase mutant.

[0009] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.

[0010] The present invention also relates to a host cell comprising the above-mentioned recombinant expression plasmid.

[0011] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed lipase mutant is significantly improved.

[0012] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris ).

[0013] The present invention also provides application of the lipase mutant in the field of oil and fat processing.

[0014] The present invention is based on the wild-type lipase PSL and provides a lipase mutant containing a Q164S single-point mutation, which has a specific activity increased by 33.7% to as high as 591 U / mg, achieving unexpected technical effects.

[0015] In summary, the specific activity of the lipase mutant provided by the present invention is significantly improved, which is beneficial to production costs and promotes its wide application in industrial fields such as oil processing. DETAILED DESCRIPTION

[0016] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example the methods described in MOLECMLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECMLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, on the basis of the technical solutions described in the present invention, adopt other conventional methods, experimental protocols and reagents in this area, and are not limited to the limitations of the specific embodiments of the present invention. For example, the present invention can select the following experimental materials and reagents:

[0017] Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vectors pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0018] Enzymes and kits: PCR enzyme and ligase were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kit and gel purification recovery kit were purchased from Omega, and GeneMorph II random mutagenesis kit was purchased from Beijing Bomeis Biotechnology Co., Ltd.

[0019] Culture medium formula:

[0020] Escherichia coli culture medium (LB medium): 0.5% yeast extract, 1% peptone, 1% NaCl, pH 7.0;

[0021] Yeast culture medium (YPD medium): 1% yeast extract, 2% peptone, 2% glucose;

[0022] Yeast screening medium (MD medium): 2% peptone, 2% agarose;

[0023] BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol;

[0024] BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol;

[0025] LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0026] LB-AMP plates: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0027] The present invention will be further described below in conjunction with the embodiments:

[0028] Example 1 Expression plasmid construction

[0029] Burkholderia cepacia ( Burkholderia cepacia The lipase gene from Pichia pastoris was codon-optimized based on the codon preference of Pichia pastoris. Six bases, GAATTC (an EcoR I restriction site), were added before the start codon ATG, and GCGGCCGC (a Not I restriction site) was added after the stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Bioengineering Co., Ltd. This lipase was named PSL. Its amino acid sequence is shown in SEQ ID NO: 1, and its encoding nucleotide sequence is shown in SEQ ID NO: 2.

[0030] The lipase gene was digested with restriction enzymes EcoRI and NotI (Fermentas). Simultaneously, the plasmid pPIC9K was digested with restriction enzymes EcoRI and NotI. The digestion products were purified using a gel purification kit and ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into DH5α Escherichia coli (Invitrogen) and selected with ampicillin. Several clones were sequenced (Invitrogen) to ensure accuracy.

[0031] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid miniprep kit (Omega) to obtain an expression plasmid, which was named pPIC9K-PSL.

[0032] Example 2 Screening of high specific activity lipase mutants

[0033] To further enhance the enzymatic activity of PSL, the applicant conducted protein structural analysis. This protein, a G11 family lipase, has a β-jellyroll structure. The applicant screened a large number of mutations in the enzyme using directed evolution.

[0034] 1.1 Design of PCR primers PSL-F1 and PSL-R1:

[0035] PSL-F1: GGC GAATTCATGGCTTCCAGAGATGGTCA (as shown in SEQ ID NO: 3, the underline indicates the restriction endonuclease EcoRI recognition site);

[0036] PSL-R1:ATA GCGGCCGC TTAGGCACATCTAGCTGCTCT (as shown in SEQ ID NO: 4, the underline indicates the restriction endonuclease NotI recognition site).

[0037] Using the PSL gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above-mentioned primers using the GeneMorph II Random Mutation PCR Kit. The PCR product was recovered from gel, digested with EcoRI and NotI, and ligated with the pET21a vector that had been digested with the same enzymes. The product was transformed into Escherichia coli BL21 (DE3), spread on LB-Amp plates, and cultured inverted at 37°C. After transformants appeared, they were picked one by one with a toothpick and transferred to a 96-well plate. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well of the plate. The cells were cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to obtain E. coli cell lysate containing lipase.

[0038] 30 μL of lysate was transferred to two new 96-well plates. 30 μL of substrate was added to one of the 96-well plates and the reaction was incubated at 37°C for 30 minutes. The resulting reducing sugars were then determined by the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other plate and allowed to stand for 10 minutes. Protein content was then determined by the Coomassie Brilliant Blue (Bradford) binding method. The enzyme activity and protein content of the different mutants were then calculated. Ultimately, the applicant identified a mutation site, Q164S, that significantly increased the specific activity of lipase from over 20,000 transformants.

[0039] Based on the above-mentioned wild-type lipase PSL, the present invention provides a mutant containing a single mutation site Q164S, the amino acid sequence of which is shown in SEQ ID NO:5.

[0040] Example 3 Expression of lipase in Pichia pastoris

[0041] 3.1 Expression plasmid construction

[0042] The gene sequences of lipase PSL and its mutants were optimized according to the codon preference of Pichia pastoris and synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction enzyme sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthetic sequence, respectively.

[0043] According to the method described in Example 1, the gene sequences of the synthesized lipase PSL and its mutants were double-digested with EcoRI and NotI, respectively, and then ligated with the pPIC-9K vector digested with the same enzymes overnight at 16°C. The clones were then transformed into Escherichia coli DH5a, plated on LB-Amp plates, and incubated upside down at 37°C. After transformants appeared, colony PCR was performed (reaction system: template-picked single clone, rTaq DNA polymerase 0.5 μL, 10× Buffer 2.0 μL, dNTPs (2.5 mM) 2.0 μL, 5'AOX primer (10 mM): 0.5 μL, 3'AOX primer: 0.5 μL, ddH2O 14.5 μL, reaction procedure: 95°C pre-denaturation for 5 min, 30 cycles of: 94°C for 30 sec, 55°C for 30 sec, 72°C for 2 min, 72°C for 10 min). Positive clones were verified by sequencing, and the correct recombinant expression plasmid was obtained.

[0044] 3.2 Construction of Pichia pastoris engineered strains

[0045] 3.2.1 Preparation of competent yeast

[0046] The Pichia pastoris GS115 strain was activated on a YPD plate and cultured at 30°C for 48 h. The activated GS115 monoclonal was inoculated into 6 mL of YPD liquid medium. The culture was carried out at 30°C and 220 rpm for about 12 h. The bacterial solution was then transferred to a conical flask containing 30 mL of YPD liquid medium and cultured at 30°C and 220 rpm for about 5 h. The bacterial density was detected by UV spectrophotometer. When the OD600 value was in the range of 1.1–1.3, 4 mL of bacteria were collected into sterile EP tubes by centrifugation at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The remaining supernatant was absorbed with sterilized filter paper and resuspended in 1 mL of pre-cooled sterile water. The bacteria were centrifuged at 4°C and 9000 rpm for 2 min, and the supernatant was gently discarded. The cells were washed again with 1 mL of sterile water and centrifuged at 4°C and 9000 rpm for 2 min. min, gently discard the supernatant, and resuspend the cells in 1 mL of pre-cooled sorbitol (1 mol / L); centrifuge at 4°C and 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the cells in 100-150 μL of pre-cooled sorbitol (1 mol / L).

[0047] 3.2.2 Transformation and screening

[0048] The recombinant expression plasmids constructed in 3.1 were linearized with Sac I. The linearized fragments were purified and recovered and transformed into Pichia pastoris GS115 by electroporation. The recombinant Pichia pastoris strains were screened on MD plates, and then multi-copy transformants were screened on YPD plates containing different concentrations of geneticin (0.5 mg / mL-8 mg / mL).

[0049] The resulting transformants were transferred to BMGY medium and cultured with shaking at 30°C and 250 rpm for 1 day. The culture was then transferred to BMMY medium and cultured with shaking at 30°C and 250 rpm. Expression was induced daily with the addition of 0.5% methanol for 4 days. The cells were then centrifuged at 9000 rpm for 10 minutes to remove the cells. The fermentation supernatants containing lipase PSL and its single-point mutant were obtained. The lipase activity and protein content in the fermentation supernatants were assayed according to the following methods, and the specific activity was calculated.

[0050] 1. Lipase activity determination method

[0051] (1) Definition of lipase activity unit

[0052] 1g solid enzyme powder (or 1mL liquid enzyme) hydrolyzes the substrate in 1min under certain temperature and pH conditions to produce 1μmol of titratable fatty acid, which is one unit of enzyme activity and is expressed in u / g (u / mL).

[0053] (2) Lipase activity determination method

[0054] Take two 100mL Erlenmeyer flasks, add 4.00mL of substrate solution and 5.00mL of phosphate buffer solution to the blank bottle (A) and the sample bottle (B) respectively, then add 15.00mL of 95% ethanol to bottle A and preheat it in a 40℃±0.2℃ water bath for 5min, then add 1.00mL of the enzyme solution to be tested to bottles A and B respectively, mix them immediately and start timing. After an accurate reaction of 15min, immediately add 15.00mL of 95% ethanol to bottle B to terminate the reaction and take out; add two drops of phenolphthalein indicator solution to each of the blank and sample solutions, titrate with sodium hydroxide standard solution until it turns slightly red and store for 30s. The titration end point is when it does not fade, and record the volume of sodium hydroxide standard solution consumed.

[0055] The formula for calculating lipase activity was: X1 = [(V1–V2) × C × 50 × n] / 0.05 × 1 / 15.

[0056] Where: X1——enzyme activity of sample, u / g;

[0057] V1——the volume of sodium hydroxide standard solution consumed when titrating the sample, mL;

[0058] V2——the volume of sodium hydroxide standard solution consumed when titrating the blank, mL;

[0059] c——concentration of sodium hydroxide standard solution, mol / L;

[0060] 50——1.00mL of 0.05mol / L sodium hydroxide solution is equivalent to 50μmol of fatty acid;

[0061] n——enzyme solution dilution multiple;

[0062] 0.05—conversion coefficient of sodium hydroxide standard solution concentration;

[0063] 1 / 15——reaction time 15min, calculated as 1min;

[0064] The experimental results obtained are expressed to the nearest integer.

[0065] The absolute difference between two independent determination results obtained under repeated conditions shall not exceed 2% of the arithmetic mean.

[0066] 2. Protein content determination method

[0067] The Coomassie Brilliant Blue (Bradford) binding assay for protein content determination is a hybrid method combining colorimetry and pigmentation. Coomassie Brilliant Blue G-250 appears brownish-red in acidic solutions and turns blue upon binding to protein. Within a certain protein concentration range, it conforms to Beer's law and can be measured colorimetrically at 595 nm. Substantial absorption occurs within 3-5 minutes and remains stable for at least 1 hour. Within the range of 10-1000 μg / mL, absorbance is directly proportional to protein concentration.

[0068] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, and allowed to stand for 10 minutes. The protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0069] 3. Specific activity calculation

[0070] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein.

[0071] The formula for calculating specific activity is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0072] See Table 1 for specific results.

[0073] Table 1 Comparison of specific activities of lipase mutants

[0074] lipase Specific activity (U / mg) Wild-type PSL 442 Q164S single point mutant 591

[0075] From the results in Table 1, it can be seen that compared with the wild-type lipase PSL, the lipase mutant containing the Q164S single point mutation provided by the present invention has a specific activity increased by 33.7%, achieving an unexpected technical effect.

[0076] In summary, the specific activity of the lipase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of the enzyme and promoting its wide application in the fields of oil and fat processing.

Claims

1. A lipase mutant, characterized in that: The amino acid sequence of the mutant is SEQ ID NO:

5.

2. A DNA molecule encoding the lipase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3, and the host cell is Pichia pastoris ( Pichia pastoris ).

Citation Information

Patent Citations

  • Lipase mutant

    CN118773165A

  • Lipase mutant

    CN119144581A