High-temperature resistant xylanase mutants

By directing the evolution of xylanase and introducing specific mutation sites, the heat resistance of xylanase has been improved, solving the problem of insufficient stability under high temperature conditions and enabling its effective application in high-temperature environments.

CN120098969BActive Publication Date: 2026-05-29QINGDAO VLAND BIOTECH GRP CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-06
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing xylanases are not stable enough under high temperature conditions, which limits their widespread application in the feed, food, paper and energy industries.

Method used

By using directed evolution technology to introduce mutation sites such as S15C, N43T, Q124E, and F179N into xylanase, its heat resistance was improved, and a heat-resistant xylanase mutant was constructed.

Benefits of technology

It significantly improved the thermal stability of xylanase, increasing its enzyme activity retention rate by 16.85%-67.85% and 9.9%-55.7% at 75℃ and 80℃, respectively, making it suitable for applications in high-temperature environments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004589223820000061
    Figure BDA0004589223820000061
  • Figure BDA0004589223820000062
    Figure BDA0004589223820000062
  • Figure BDA0004589223820000071
    Figure BDA0004589223820000071
Patent Text Reader

Abstract

The present application relates to the technical field of genetic engineering and protein engineering, and particularly relates to a high-temperature-resistant xylanase mutant and application thereof. The xylanase mutant containing S15C, N43T, Q124E and F179N mutation sites has significantly improved heat resistance. After 5 minutes of treatment at 75 DEG C, the enzyme activity retention rate is generally increased by 16.85% to 67.85%, and after 5 minutes of treatment at 80 DEG C, the enzyme activity retention rate is generally increased by 9.9% to 55.7%. Among them, the xylanase mutant containing F179N has the strongest heat resistance, and after 5 minutes of treatment at 75 DEG C and 80 DEG C, the enzyme activity retention rate is as high as 69.3% and 55.7% respectively. The high-temperature-resistant xylanase mutant provided by the present application can be widely applied in the field of feed production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of genetic engineering and protein engineering, specifically to a thermoresistant xylanase mutant and its applications. Background Technology

[0002] Xylan is a heteropolymer molecule whose backbone consists of multiple xylanose groups linked by xylosidic bonds. Its side chains are attached with various short substituents of different sizes, primarily O-acetyl, 4-O-methyl-D-glucuronic acid residues, and L-arabinose residues. These side chains are covalently or non-covalently linked to other structural polysaccharides in plant cells (such as lignin, cellulose, pectin, and dextran), forming the important cell wall. Xylan is mainly found in the secondary cell wall of plant cells, acting as a linker between lignin and other polysaccharides. Due to the differences in these side chains, xylan exhibits a wide range of structural variations, from linear xylan molecules linked only by β-1,4-glycosidic bonds to highly branched heteropolysaccharides. Research on xylanases began as early as the 1960s, and numerous different types and functions of xylanases have been isolated from microorganisms of various origins.

[0003] In practical production, wheat-based feeds often contain high levels of non-starch polysaccharides (NSPs) such as xylan, pectin, and cellulose, leading to reduced digestibility and utilization of nutrients in wheat by ruminants. It has been reported that adding exogenous enzyme preparations to diets based on wheat, bran, and soybean meal can disrupt plant cell walls, promote gastrointestinal development in livestock and poultry, improve nutrient digestion and absorption, and thus enhance growth and development. As a major cellolytic enzyme, xylanase plays a positive role in disrupting plant cell walls, eliminating anti-nutritional factors, reducing intestinal chyme viscosity, promoting growth and development in livestock and poultry, and maintaining intestinal health. In monogastric animals, xylanase can improve the physical and immune barrier functions of the piglet's intestine and increase the digestibility of in vitro nutrients. In aquatic animals, xylanase can improve the growth performance of grass carp, promote intestinal development, improve intestinal microbiota, and enhance resistance to enteritis.

[0004] The application of xylanase in the food industry mainly lies in its ability to break down natural food hemicellulose, such as cottonseed hulls, sugarcane bagasse, and corn husks, into xylooligosaccharides. The amount of xylan content varies among different plants; generally, harder materials contain more xylan than softer materials, accounting for 15%–30% of the dry weight in harder materials and 7%–10% in softer materials. Xylanase can degrade xylan into xylooligosaccharides. Xylooligosaccharides are poorly digestible, low in calories, and do not cause obesity. They have high bifidobacteria proliferation activity, acting as an activating factor for the growth of intestinal bifidobacteria and reducing the likelihood of tooth decay. Furthermore, xylooligosaccharides can be used to make foods with varying sweetness levels, serving as a therapeutic alternative to glucose for diabetics. The most effective method for producing xylooligosaccharides with the fewest side effects is using xylanase. Therefore, xylanase has enormous potential for application in the food industry.

[0005] Xylan in paper industry waste and agricultural waste can be converted into D-xylose monomers by xylanase. D-xylose can then be converted into valuable fuels by bacteria, yeast, and fungi. Given the global energy crisis, which will inevitably lead to a large demand for biological resources, xylanase has enormous potential for application in the energy industry.

[0006] In the past decade or so, with the continuous development and progress of biotechnology, especially the widespread application of genetic engineering and protein engineering, our understanding of xylanase has deepened. This has led to the screening of superior natural xylanase-producing strains, the purification of xylanase, and the analysis of its properties. To date, xylanase genes from many microorganisms have been isolated and cloned, and various xylanase products have been produced. Xylanase shows broad application prospects in the feed industry, pulp and paper industry, food industry, and energy industry, attracting widespread attention from scientists. Summary of the Invention

[0007] This invention addresses the problems of existing technologies by providing a xylanase mutant and its applications. The heat resistance of this xylanase mutant is significantly improved, laying the foundation for its widespread use in the feed industry.

[0008] The present invention provides a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution at at least one position selected from the group consisting of: 15, 43, 124, 179 compared with SEQ ID NO:1.

[0009] In some embodiments of the invention, the amino acid sequence of the mutant has at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identity with SEQ ID NO:1.

[0010] In some more specific embodiments, the amino acid sequence of the mutant has at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identity with SEQ ID NO:1.

[0011] In some embodiments of the present invention, the mutant comprises a substitution or combination of substitutions for at least one amino acid from the following group: S15C, N43T, Q124E, F179N, S15C / N43T, S15C / Q124E, S15C / F179N, N43T / Q124E, N43T / F179N, Q124E / F179N, S15C / N43T / Q124E, S15C / N43T / F179N, S15C / Q124E / F179N, N43T / Q124E / F179N, S15C / N43T / Q124E / F179N.

[0012] The present invention also relates to DNA molecules encoding the above-mentioned xylanase mutants.

[0013] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0014] The present invention also provides a host cell comprising the above-described recombinant expression vector.

[0015] The host cell was Trichoderma reesei.

[0016] The S15C, N43T, Q124E, and F179N mutant sites screened in this invention significantly improve the heat resistance of xylanase Xyn. Compared with the wild type, after treatment at 75℃ for 5 min, the enzyme activity retention rate of the mutants generally increased by 16.85%-67.85%, and after treatment at 80℃ for 5 min, the enzyme activity retention rate of the mutants generally increased by 9.9%-55.7%. Among them, the xylanase mutant containing F179N has the strongest heat resistance, with enzyme activity retention rates as high as 69.3% and 55.7% after treatment at 75℃ and 80℃ for 5 min, respectively. The heat-resistant xylanase mutants provided by this invention can be widely used in the field of feed production. Detailed Implementation

[0017] This invention discloses a xylanase mutant, its preparation method and application, the DNA molecule encoding the xylanase mutant, the vector, and the host cell. Those skilled in the art can refer to the content herein and appropriately modify the process parameters to achieve the desired result. The method and application of this invention have been described through preferred embodiments. Those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0018] This invention utilizes conventional techniques and methods used in the fields of genetic engineering and molecular biology, such as those described in *MOLECMLAR CLONING: ALABORATORY MANUAL, 3rd Ed.* (Sambrook, 2001) and *CURRENT PROTOCOLS IN MOLECMLAR BIOLOGY* (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can utilize other conventional methods, experimental protocols, and reagents based on the technical solutions described in this invention, without being limited to the specific embodiments of this invention.

[0019] Example 1: Screening of xylanase mutants

[0020] To improve the temperature tolerance of the wild-type xylanase Xyn (amino acid sequence SEQ ID NO:1, encoding nucleotide sequence SEQ ID NO:2) derived from *Trichoderma reesei*, the applicant performed structural analysis on the protein. This protein is a GHI1 family xylanase with a β-jelly roll structure, consisting of a right-handed semi-claw shape composed of folded sheets. Two catalytic residues are located in crevices formed by highly twisted β-sheets that can accommodate xylan sugar chains. Without disrupting the protein's secondary structure and active site, the applicant screened for numerous mutations in the enzyme using directed evolution technology.

[0021] Design PCR primers Xyn-F1 and Xyn-R1:

[0022] Xyn-F1: 5'—CGC GAATTC ACTATTCAACCTGGAACTGGATAC—3' (underlined is the ECORI restriction endonuclease recognition site);

[0023] Xyn-R1: 5'—CTC GCGGCCGC TTATGAGACTGTGATAGAGGCAG—3' (The underlined part is the NotI restriction enzyme recognition site).

[0024] Using the Xyn gene (SEQ ID NO: 2) as a template, PCR amplification was performed using the above primers and the GeneMorph II random mutagenesis PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and then ligated into the pET21a vector digested with the same enzymes. The resulting product was transformed into Escherichia coli BL21(DE3), plated on LB+Amp plates, and incubated upside down at 37°C. After the transformants appeared, they were picked one by one into a 96-well plate with a toothpick. 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well. The plate was incubated at 37°C and 220 rpm for about 6 h. After centrifugation, the supernatant was discarded, and the cells were resuspended in buffer. The cells were repeatedly frozen and thawed to break up the cell walls and obtain E. coli cell lysate containing xylanase.

[0025] 30 μL of lysis buffer was transferred to two new 96-well plates; one plate was incubated at 70 °C for 8 min; then 30 μL of substrate was added to both plates, and the plates were incubated at 37 °C for 30 min. The reducing sugars produced were measured using the DNS method, and the enzyme activity levels of different mutants after high-temperature treatment were calculated. Ultimately, the applicant obtained mutation sites that significantly improved the thermostability of the xylanase mutant Xyn without significantly affecting its enzyme activity and original enzymatic properties: S15C, N43T, Q124E, and F179N.

[0026] Based on the wild-type xylanase Xyn, this invention provides single-point mutants containing the mutation sites described above, namely S15C, N43T, Q124E, and F179N.

[0027] Example 2: Expression of xylanase in Trichoderma reesei

[0028] First, based on the codon preference of Trichoderma, the gene sequences of xylanase Xyn and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, KpnI and MluI, were added to the 5' and 3' ends of the synthesized sequences, respectively.

[0029] 2.1 Construction of expression vector

[0030] The synthesized plasmid was digested with restriction endonucleases KpnI (Fermentas) and MluI (Fermentas); simultaneously, plasmid pTGII was digested with restriction endonucleases KpnI and XbaI. The digestion products were purified using a gel purification kit, and the two digestion products were ligated using T4 DNA ligase (Fermentas). The ligation products were transformed into Trans5α Escherichia coli (Transgen), and selection was performed using ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen). After successful sequencing, the recombinant plasmid containing the xylanase gene was obtained.

[0031] Plasmids were purified from correctly sequenced E. coli clones using a plasmid medium-quantity preparation kit (Axygen).

[0032] 2.2 Protoplast Preparation

[0033] A suspension of host spores from the xylanase gene-deficient Trichoderma reesei was inoculated onto a PDA plate and cultured at 30°C for 6 days. After abundant sporulation, colonies of approximately 1 cm × 1 cm were excised and placed in a liquid culture medium containing 120 mL of YEG+U (0.5% yeast extract, 1% glucose, and 0.1% uridine) and cultured at 30°C with shaking at 220 rpm for 14–16 h. The mycelium was collected by filtration through sterile gauze and washed once with sterile water. The mycelium was then placed in an Erlenmeyer flask containing 20 mL of 10 mg / mL lyase solution (Sigma L1412) and incubated at 30°C with shaking at 90 rpm for 1–2 h. The progress of protoplast transformation was observed under a microscope.

[0034] Add 20 mL of pre-chilled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the Erlenmeyer flask, gently mix, filter through sterile Miracloth filter cloth, collect the filtrate, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add 5 mL of pre-chilled 1.2 M sorbitol solution to suspend the bacterial cells, centrifuge at 3000 rpm, 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-chilled 1.2 M sorbitol to suspend and dispense (200 μL / tube, protoplast concentration 10). 8 (units / mL).

[0035] 2.3 Expression vector transformation and strain validation

[0036] All the following operations were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added, the bottom of the tube was gently tapped to mix, and the tube was incubated on ice for 20 min. Next, 2 mL of 25% PEG was added, mixed, and incubated at room temperature for 5 min. Finally, 4 mL of PEG solution was added. 1.2M sorbitol was gently mixed and poured into the melted upper medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) and kept at 55°C. This mixture was then spread onto the prepared lower medium (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar) and incubated at 30°C for 5–7 days until transformants appeared. Transformants were then transferred to the lower medium for re-screening and incubated at 30°C for 2 days. Strains with smoother colony edges were considered positive transformants.

[0037] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube. Add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS). Vigorously shake with a bead mixer for 2 min. After incubating in a 65 °C water bath for 20 min, add 200 μL of 10 M NH4AC and incubate on ice for 10 min. Centrifuge at 13000 rpm for 10 min. Take the supernatant, add 2 volumes of anhydrous ethanol, and place at -20 °C for 30 min. Centrifuge at 13000 rpm for 10 min and discard the supernatant. Wash twice with 70% ethanol. Air dry, dissolve in water, and store at -20 °C.

[0038] Using the extracted genomic DNA from the transformants as a template, the target gene was amplified by PCR using primers MF and MR for verification.

[0039] MF: ATGGTCAGCTTTACCTCCCTCCTC;

[0040] MR:TTATCAGGAGACACAAATTGAAGC.

[0041] PCR amplification conditions were: 94℃ for 4 min; 94℃ for 40 s; 58℃ for 40 s, 72℃ for 1 min, 30 cycles; 72℃ for 7 min, 16℃; PCR amplification products were recovered using a gel extraction kit and sequenced for analysis.

[0042] Following the above method, the applicant constructed recombinant Trichoderma reesei engineered strains expressing xylanase Xyn and its mutants.

[0043] Example 3 Fermentation Verification

[0044] The engineered Trichoderma reesei strains constructed above were inoculated onto PDA solid plates and cultured at 30℃ for 6 days. After spore abundance, two 1 cm diameter mycelial blocks were inoculated into 250 mL Erlenmeyer flasks containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween-80, 0.018% trace elements). The flasks were cultured at 30℃ for 48 hours, followed by 25℃ for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing xylanase Xyn and the aforementioned mutant, respectively.

[0045] 3.1 Enzyme activity assay

[0046] (1) Definition of xylanase activity

[0047] Under conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a xylan solution with a concentration of 5 mg / ml is defined as one unit of enzyme activity, U.

[0048] (2) Method for determining xylanase activity

[0049] Take 2 ml of 1% xylan substrate (prepared with pH 5.5 acetate-sodium acetate buffer) and add it to a colorimetric tube. Equilibrate at 37°C for 10 min. Then add 2 ml of acidic xylanase enzyme solution, appropriately diluted with pH 5.5 acetate-sodium acetate buffer and equilibrated at 37°C. Mix well and incubate at 37°C for 30 min. After the reaction is complete, add 5 ml of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5 min, cool to room temperature with tap water, and dilute to 25 ml with distilled water. Mix well and use a standard blank sample as a blank control. Measure the absorbance A at 540 nm. E .

[0050] Enzyme activity calculation formula:

[0051]

[0052] In the formula: X D To dilute the xylanase activity in the enzyme solution, U / mL; A E A represents the absorbance of the enzyme reaction solution. B λ is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C0 is the intercept of the standard curve; M is the molar mass of xylose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme dilution factor; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0053] (3) Enzyme activity assay results

[0054] Enzyme activity was detected using the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant Trichoderma recombinant strain expressing xylanase Xyn and its mutant was 265-630 U / mL.

[0055] Example 4: Heat resistance analysis of xylanase

[0056] The crude enzyme solution obtained from fermentation in Example 3 was diluted to approximately 20 U / ml with an acetate-sodium acetate buffer solution at pH 5.5. After treatment at 75°C and 80°C for 5 min respectively, the remaining enzyme activity was measured. The enzyme activity retention rate was calculated as 100% of the enzyme activity of the untreated sample. The specific results are shown in Table 1.

[0057] Table 1 Comparison of heat resistance of xylanase mutants

[0058]

[0059]

[0060] As shown in Table 1, the S15C, N43T, Q124E, and F179N mutant sites screened in this invention significantly improve the thermostability of xylanase. Compared with the wild type, after treatment at 75℃ for 5 min, the enzyme activity retention rate of the mutants generally increased by 16.85%-67.85%, and after treatment at 80℃ for 5 min, the enzyme activity retention rate of the mutants generally increased by 9.9%-55.7%. Among them, the xylanase mutant containing F179N showed the strongest thermostability, with enzyme activity retention rates as high as 69.3% and 55.7% after treatment at 75℃ and 80℃ for 5 min, respectively, achieving unexpected technical results.

[0061] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A xylanase mutant, characterized in that, The mutant was obtained by mutating the 179th amino acid from Phe to Asn based on the xylanase shown in the amino acid sequence SEQ ID NO:

1.

2. A DNA molecule encoding the xylanase mutant of claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid as described in claim 3; the host cell is *Trichoderma reesei* (…). Trichoderma reesei ).

5. The application of the xylanase mutant of claim 1 in feed production.

Citation Information

Patent Citations

  • Perhydrolase enzyme

    CN103333870A

  • Method for producing xylanase at high yield from trichoderma reesei and application of xylanase

    CN112961788A