High specific activity xylanase mutant

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to a xylanase mutant. The mutant is a single-point mutant provided on the basis of wild type xylanase Xyn, and the specific activity of the mutant is generally improved by 12.4%-63.4%; wherein the specific activity of the xylanase mutant containing I128E single-point mutation is highest and reaches 1273.9 U / mg, so that the production cost of the xylanase is reduced, and wide application of the xylanase mutant in the field of feeds is promoted.

Description

Technical Field

[0001] The invention relates to the technical field of gene engineering and protein engineering, and in particular to a high specific activity xylanase mutant and application thereof. Background Art

[0002] Xylan is the main component of hemicellulose and is widely distributed. Its main chain is mainly composed of xylose polymerized, and its side chains contain a variety of substituents and a complex structure of heterogeneous polysaccharides. The hydrolases that degrade xylan mainly include β-1,4-endo-xylanase (EC 3.2.1.8) and β-xylosidase that act on the main chain, as well as arabinosidase, glucuronidase, galactosidase, etc. that hydrolyze the side chain groups, thereby improving the hydrolysis efficiency of xylan. Among them, the most important glycoside hydrolase is β-1,4-endo-xylanase. It is an O-glycoside hydrolase that can randomly cut the β-1,4 glycosidic bonds on the xylan main chain to generate oligoxylose, arabinoxylan and xylose.

[0003] Based on the amino acid similarity and the three-dimensional structure analysis of the enzyme, xylanases are mainly distributed in the GH10 and GH11 families. Based on the amino acid composition of xylanases and their three-dimensional structure analysis, it can be seen that glutamic acid, aspartic acid, tyrosine, tryptophan, glycine, and serine are very critical to their catalytic properties and alkali resistance and heat resistance. The xylanase protein subunits produced by bacteria are relatively simple, with a molecular weight range of 8 to 145KDa. The xylanase protein subunits produced by fungi are more complex, and the molecular weight varies greatly. Whether from fungi or bacteria, the optimum temperature of endo-type xylanases is generally between 40°C and 60°C. Generally, xylanases produced by bacteria have better thermal stability than xylanases produced by fungi. The pH range that xylanases produced by different microorganisms can tolerate is generally 3 to 10. The optimal pH value is generally 4 to 7. The isoelectric point of different xylanases varies between 3 and 10. Xylanases produced by different microorganisms vary greatly in structure and properties. Some xylanases contain only a single region, namely the catalytic region, while others have both a catalytic region and multiple non-catalytic regions. The molecular structure of multi-region xylanases contains a catalytic region (CD), a cellulose binding region (CBD), a xylan binding region (XBD), a linker sequence, a repeated sequence, a thermostable region (ThermostabilisingDomain) and other non-catalytic regions of unknown function. The catalytic region of xylanase bears the hydrolysis characteristics of the enzyme and serves as the basis for the classification of the enzyme. The amino acid composition of xylanases varies greatly in quantity, but the size of their catalytic regions tends to be consistent. Glutamic acid and aspartic acid at specific positions in the catalytic region are very critical to the catalytic properties. The functional regions in the xylanase molecule are connected by a linker sequence, and the length of this sequence varies greatly, generally 6 to 59 amino acids. The sequence may contain more serine residues or more proline residues. The homology between the connecting sequences of xylanases from different sources is generally not high. These connecting sequences connect different functional regions to form a flexible and stretchable hinge region. Many xylan molecules contain repeating sequences with a length of 20 to 150 amino acid residues. Repeating sequences are not necessary for the activity of the enzyme, and their role is still unclear. In addition, in some microorganisms (such as thermoanaerobic bacillus saccharolyticus and Clostridium thermocellum), there are certain segments that can increase the optimal action temperature of the corresponding enzyme, which can be called thermal stability zones. These regions have different physiological functions. The regions contained in different microorganisms vary greatly. Some have only one or several of them, while others contain all of the above regions.

[0004] Xylanase needs to meet the harsh conditions required in industrial production, which requires the enzyme to have good thermal stability, a wide range of pH adaptability and high specific activity. However, the amount of xylanase resources that can meet the requirements of industrial production obtained by screening natural xylanase-producing microorganisms is limited. Therefore, it is necessary to use genetic engineering and protein engineering methods to study the controllable transformation technology of natural strains to achieve the commercial production of xylanase. Summary of the invention

[0005] The present invention provides a xylanase mutant to solve the problems of the prior art. The xylanase mutant with significantly improved specific activity is finally obtained through a large number of mutation screenings based on xylanase Xyn, laying a foundation for its wide use in the feed field.

[0006] The present invention provides a xylanase mutant comprising an amino acid sequence having at least 90% identity with SEQ ID NO:1, and comprising an amino acid substitution compared to SEQ ID NO:1 at at least one position selected from the following group: 4, 6, 15, 43, 44, 46, 83, 94, 95, 99, 120, 121, 122, 123, 127, 128, 130, 131, 134, 172, 178, 179.

[0007] In some embodiments of the invention, the mutant comprises a substitution of at least one amino acid in the following group: P4D / S, T6Q, S15T, N43S, F44V, G46V / C, L83M, T94D, Y95W / F, T99A / D, Q120T / F / V, R121K, V122T / F / H / D / I, N123H / S / E, I127V, I128E / Q / D / M / V, T130D, A131T / K, Y134W / D / H / Q / S / T / M / N / P / A, I172V / M / T, Y178W / F / V, F179G / Q / H / D.

[0008] In some embodiments of the invention, the amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO:1.

[0009] In some more specific embodiments, the amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:1.

[0010] The present invention also relates to a DNA molecule encoding the above xylanase mutant.

[0011] The present invention also relates to a recombinant expression vector comprising the above DNA molecule.

[0012] The present invention also provides a host cell comprising the above recombinant expression vector.

[0013] The host cell is Trichoderma reesei

[0014] The single point mutants provided by the present invention based on the wild-type xylanase Xyn generally have a specific activity increased by 12.4%-63.4%; among them, the xylanase mutant containing the I128E single point mutation has the highest specific activity, reaching 1273.9U / mg. The mutants containing the S15T, N43S, Y95F / W, T99A / D, R121K, V122I, I128V / Q / D, Y134W / D, Y178F / V, and F179G / Q / H / D single point mutations not only have improved specific activity, but also significantly improved heat resistance. After being treated at 75°C for 5 minutes, the enzyme activity retention rate generally increased by 18.0%-63.5%, and after being treated at 80°C for 5 minutes, the enzyme activity retention rate generally increased by 11.2%-52.7%. Among them, the xylanase mutant containing the F179Q single point mutation has the strongest heat resistance, and its enzyme activity retention rate is as high as 65.2% and 52.7% after being treated at 75°C and 80°C for 5 minutes, respectively. The xylanase mutant provided by the present invention has significantly reduced production costs and strong heat resistance, which is conducive to wide application in the feed field. DETAILED DESCRIPTION

[0015] The present invention discloses a xylanase mutant, a preparation method and application thereof, a DNA molecule encoding the xylanase mutant, a vector, and a host cell. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired effect. The method and application of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present invention to achieve and apply the technology of the present invention.

[0016] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example MOLECMLAR CLONING:A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS INMOLECMLAR BIOLOGY (Ausubel, 2003) in the method of recording. These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, on the basis of the technical scheme recorded in the present invention, adopt other conventional methods, experimental schemes and reagents in this area, and are not limited to the limitation of specific embodiments of the present invention.

[0017] Example 1 Screening of xylanase mutants

[0018] In order to improve the enzymatic activity of wild-type xylanase Xyn (amino acid sequence SEQ ID NO: 1, encoding nucleotide sequence SEQ ID NO: 2) from Trichoderma reesei, the applicant screened a large number of mutations of amino acids near the active center and substrate channel of the enzyme using directed evolution technology.

[0019] Design PCR primers Xyn-F1, Xyn-R1:

[0020] Xyn-F1: 5'-CGC GAATTC ACTATTCAACCTGGAACTGGATAC—3' (the underline indicates the recognition site of restriction endonuclease ECORI);

[0021] Xyn-R1: 5'-CT CGCGGCCGC TTATGAGACTGTGATAGAGGCAG—3' (the underline indicates the recognition site of restriction endonuclease NotI).

[0022] The Xyn gene (SEQ ID NO: 2) was used as a template and PCR amplification was performed using the above primers using a GeneMorph II random mutation PCR kit (Bomais). The PCR product was recovered from the gel, digested with EcoRI and NotI, and ligated with the pET21a vector digested with the same enzymes, transformed into Escherichia coli BL21 (DE3), spread on an LB+Amp plate, and cultured inverted at 37°C. After transformants appeared, they were picked up one by one with a toothpick into a 96-well plate, 150 μl of LB+Amp medium containing 0.1 mM IPTG was added to each well, and the cells were cultured at 37°C and 220 rpm for about 6 hours. The supernatant was discarded after centrifugation, and the cells were resuspended in a buffer solution, and the cells were repeatedly frozen and thawed to obtain an Escherichia coli cell lysate containing xylanase.

[0023] Take out 30ul of lysate to two new 96-well plates respectively; add 30ul of substrate to one of the 96-well plates, react at 37°C for 30min, and determine the reducing sugar generated by DNS method; add 150ul of Coomassie Brilliant Blue solution to the other plate, let it stand for 10min, and determine the protein content by Coomassie Brilliant Blue (Bradford) binding method, and calculate the enzyme activity level and protein content of different mutants respectively. Finally, the applicant screened out mutation sites that could significantly improve the specific activity of Xyn without affecting its original enzymatic properties from more than 20,000 transformants: P4D, P4S, T6Q, S15T, N43S, F44V, G46V, G46C, L83M, T94D, Y95W, Y95F, T99A, T99D, Q120T, Q120F, Q120V, R121K, V122T, V122F, V122H, V122D, V122I, N123H, N123S , N123E, I127V, I128E, I128Q, I128D, I128M, I128V, T130D, A131T, A131K, Y134W, Y134D, Y134H, Y134Q, Y134S , Y134T, Y134M, Y134N, Y134P, Y134A, I172V, I172M, I172T, Y178W, Y178F, Y178V, F179G, F179Q, F179H, F179D.

[0024] The present invention provides a wild-type xylanase Xyn, comprising P4D, P4S, T6Q, S15T, N43S, F44V, G46V, G46C, L83M, T94D, Y95W, Y95F, T99A, T99D, Q120T, Q120F, Q120V, R121K, V122T, V122F, V122H, V122D, V122I, N123H, N123S, N123E, I127V, I128 E, I128Q, I128D, I128M, I128V, T130D, A131T, A131K, Y134W, Y134D, Y134H, Y134Q, Y134S, Y134T, Y134M, Y134N, Y134P, Y134A, I172V, I172M, I172T, Y178W, Y178F, Y178V, F179G, F179Q, F179H, F179D single point mutants of the mutation sites.

[0025] Example 2 Expression of xylanase in Trichoderma reesei

[0026] First, according to the codon preference of Trichoderma, the gene sequences of xylanase Xyn and its mutants were optimized. The optimized gene sequences were synthesized by Shanghai Jierui Bioengineering Co., Ltd., and two restriction sites, KpnI and MluI, were added to the 5' and 3' ends of the synthetic sequence respectively.

[0027] 2.1 Construction of expression vector

[0028] The synthesized plasmids were digested with restriction endonucleases KpnI (Fermentas) and MluI (Fermentas) respectively; the plasmid pTGII was digested with restriction endonucleases KpnI and XbaI at the same time; the digestion products were purified using a gel purification kit, and the two digestion products were connected using T4 DNA ligase (Fermentas); the ligation products were transformed into Trans5α Escherichia coli (Transgen), selected with ampicillin, and several clones were sequenced (Invitrogen) to ensure accuracy. After the sequencing was correct, the recombinant plasmid containing the xylanase gene was obtained.

[0029] Plasmids were purified from E. coli clones with correct sequencing results using a plasmid midi-prep kit (Axygen).

[0030] 2.2 Protoplast preparation

[0031] Take a spore suspension of the host fungus Trichoderma reesei U4 with a xylanase gene defect, inoculate it on a PDA plate, and culture it at 30°C for 6 days; after the spores are abundant, cut a colony of about 1 cm×1 cm and place it in a liquid culture medium containing 120 mL YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine), and culture it at 30°C and 220 rpm for 14-16 hours; collect the mycelium by filtering with sterile gauze, and wash it once with sterile water; place the mycelium in a conical flask containing 20 mL 10 mg / mL lytic enzyme solution (Sigma L1412), and act at 30°C and 90 rpm for 1-2 hours; and observe and detect the progress of protoplast transformation under a microscope.

[0032] Add 20 mL of pre-cooled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the above-mentioned conical flask, shake gently, collect the filtrate through sterile Miracloth filter cloth, and centrifuge at 3000 rpm and 4°C for 10 min; discard the supernatant, add 5 mL of pre-cooled 1.2 M sorbitol solution to suspend the bacteria, and centrifuge at 3000 rpm and 4°C for 10 min; discard the supernatant, add an appropriate amount of pre-cooled 1.2 M sorbitol to suspend and package (200 μL / tube, protoplast concentration is 108 / mL).

[0033] 2.3 Expression vector transformation and strain verification

[0034] The following operations were all performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution, and then 50 μL of 25% PEG (25% PEG, 50 mM Tris-Cl, 50 mM CaCl2) was added. The tube bottom was flicked to mix, and the mixture was placed on ice for 20 min. 2 mL of 25% PEG, mix well and place at room temperature for 5 minutes; add 4mL 1.2M sorbitol, mix gently and pour into the upper culture medium (0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose) melted and maintained at 55°C; mix gently and spread on the prepared lower culture medium plate (2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar), and culture at 30°C for 5-7 days until transformants grow. Pick the transformants to the lower culture medium plate for rescreening, culture at 30°C for 2 days, and the strains with smoother colony edge morphology are positive transformants.

[0035] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube, add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS); shake vigorously with a bead beater for 2 min; after 65 ° C water bath for 20 min, add 200 μL 10M NH 4 AC, ice bath for 10 minutes; centrifuge at 13000rpm for 10 minutes; take the supernatant, add 2 times the volume of anhydrous ethanol, and place at -20℃ for 30 minutes; centrifuge at 13000rpm for 10 minutes, discard the supernatant; wash twice with 70% ethanol; dry, dissolve in water, and store at -20℃.

[0036] The above-extracted transformant genomic DNA was used as a template and primers MF and MR were used to perform PCR amplification of the target gene for verification.

[0037] MF:ATGGTCAGCTTTACCTCCCTCCTC;

[0038] MR:TTATCAGGAGACACAAATTGAAGC.

[0039] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 40 s; 58°C for 40 s, 72°C for 1 min, 30 cycles; 72°C for 7 min, 16°C; the PCR amplification products were recovered using a gel recovery kit and sequenced.

[0040] According to the above method, the applicant constructed and obtained engineered strains of Trichoderma reesei that recombinantly expressed xylanase Xyn and its mutants.

[0041] Example 3 Fermentation Verification

[0042] The engineered strains of Trichoderma reesei constructed above were inoculated on PDA solid plates and cultured at 30°C for 6 days. After the spores were abundant, two mycelium blocks with a diameter of 1 cm were inoculated into a 250 mL Erlenmeyer flask containing 50 mL of fermentation medium (1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH 4 ) 2 SO 4 , 0.09% MgSO 4 , 2% KH 2 PO 4 , 0.04% CaCl 2 , 0.018% Tween-80, 0.018% trace elements), cultured at 30°C for 48 hours, and then cultured at 25°C for 48 hours. The fermentation broth was centrifuged to obtain fermentation supernatants containing xylanase Xyn and the mutants.

[0043] 3.1 Enzyme activity assay

[0044] (1) Definition of xylanase activity

[0045] Under the conditions of 37°C and pH 5.5, the amount of enzyme required to release 1 μmol of reducing sugar from a 5 mg / ml xylan solution per minute is one enzyme activity unit U.

[0046] (2) Xylanase activity determination method

[0047] Take 2 ml of 1% xylan substrate (prepared with pH 5.5 acetic acid-sodium acetate buffer), add it to a colorimetric tube, balance at 37°C for 10 minutes, then add 2 ml of acid xylanase solution appropriately diluted with pH 5.5 acetic acid-sodium acetate buffer and balanced at 37°C, mix well at 37°C, and react for 30 minutes. After the reaction is completed, add 5 ml of DNS reagent and mix well to terminate the reaction. Then boil in a boiling water bath for 5 minutes, cool to room temperature with tap water, add distilled water to make up to 25 ml, mix well, use the standard blank sample as a blank control, and measure the absorbance value A at 540 nm. E .

[0048] Enzyme activity calculation formula:

[0049]

[0050] Where: X D is the activity of xylanase in the diluted enzyme solution, U / mL; AE is the absorbance of the enzyme reaction solution; A B is the absorbance of the enzyme blank solution; K is the slope of the standard curve; C 0 is the intercept of the standard curve; M is the molar mass of xylose, 180.2 g / mol; t is the enzymatic reaction time, min; N is the enzyme solution dilution multiple; 1000 is the conversion factor, 1 mmol = 1000 μmol.

[0051] (3) Enzyme activity assay results

[0052] The enzyme activity was detected according to the above method, and the results showed that the enzyme activity of the fermentation supernatant of the recombinant strain of Trichoderma reesei expressing xylanase Xyn and its mutants constructed above was 530-1039 U / mL.

[0053] 3.2 Protein content determination

[0054] (1) Determination method:

[0055] The Coomassie Brilliant Blue (Bradford) binding method for determining protein content is a composite method that combines colorimetry with pigmentation. Coomassie Brilliant Blue G-250 is brownish red in acidic solution, and turns blue when combined with protein. It conforms to Beer's law within a certain protein concentration range and can be measured colorimetrically at 595nm. A large amount of absorption is achieved in 3 to 5 minutes and is stable for at least 1 hour. In the range of 10 to 1000 μg / mL, the absorbance is proportional to the protein concentration.

[0056] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, and allowed to stand for 10 minutes. The protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0057] (2) Protein content determination results

[0058] The xylanase protein content in the fermentation supernatant of the wild type and mutant Trichoderma reesei engineered bacteria was detected according to the above method. The results showed that the protein content of the fermentation supernatant of the recombinant Trichoderma reesei strain expressing xylanase Xyn and its mutants constructed above was 0.625-0.835 mg / mL.

[0059] 3.3 Calculation of specific activity

[0060] "Specific Activity" refers to the number of enzyme activity units per unit weight of protein, usually expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0061] The specific activity calculation formula is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0062] The xylanase specific activity of the fermentation supernatant of the engineered strain of Trichoderma reesei expressing wild-type xylanase Xyn and its mutants was calculated respectively.

[0063] The specific calculation results are shown in Table 1.

[0064] Table 1 Comparison of specific activities of xylanase Xyn and its single-point mutants

[0065]

[0066]

[0067] From the data in Table 1, it can be seen that compared with the wild-type xylanase Xyn, the specific activity of the xylanase single point mutants provided by the present invention is generally improved by 12.4%-63.4%; among them, the xylanase mutant containing the I128E single point mutation has the highest specific activity, reaching 1273.9U / mg, achieving unexpected technical effects.

[0068] Example 4 Analysis of the heat resistance of xylanase

[0069] The crude enzyme solution of the mutant obtained by fermentation in Example 3 was diluted to about 20 U / ml with acetic acid-sodium acetate buffer at pH 5.5, and treated at 75°C and 80°C for 5 min, respectively, and the retained enzyme activity was measured. The enzyme activity of the untreated sample was taken as 100%, and the enzyme activity retention rate was calculated. The specific results are shown in Table 2.

[0070] Table 2 Comparison of thermotolerance of xylanase Xyn and its single-point mutants

[0071]

[0072] From the results in Table 2, it can be seen that the mutants containing single-point mutations of S15T, N43S, Y95F / W, T99A / D, R121K, V122I, I128V / Q / D, Y134W / D, Y178F / V, and F179G / Q / H / D screened by the present invention not only have improved specific activity, but also significantly improved heat resistance. After being treated at 75°C for 5 minutes, the enzyme activity retention rate generally increased by 18.0%-63.5%, and after being treated at 80°C for 5 minutes, the enzyme activity retention rate generally increased by 11.2%-52.7%. Among them, the xylanase mutant containing the single-point mutation of F179Q has the strongest heat resistance, and after being treated at 75°C and 80°C for 5 minutes, its enzyme activity retention rate is as high as 65.2% and 52.7%, respectively. Unexpected technical effects have been achieved.

[0073] In summary, the xylanase mutant provided by the present invention has higher specific activity and stronger heat resistance, has a greater cost advantage than the wild type, and is more suitable for use as a feed additive.

Claims

1. A xylanase mutant, It is characterized in that The mutant comprises an amino acid sequence that is at least 90% identical to SEQ ID NO:1, and comprises an amino acid substitution at at least one position selected from the group consisting of: 4, 6, 15, 43, 44, 46, 83, 94, 95, 99, 120, 121, 122, 123, 127, 128, 130, 131, 134, 172, 178, 179 compared to SEQ ID NO:

1.

2. The xylanase mutant according to claim 1, It is characterized in that The amino acid sequence of the mutant is at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% identical to SEQ ID NO:

1.

3. The xylanase mutant according to claim 2, It is characterized in that The amino acid sequence of the mutant is at least 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, or at least 99.9% identical to SEQ ID NO:

1.

4. The xylanase mutant according to claim 1, It is characterized in that The mutant comprises a substitution of at least one amino acid in the following group: P4D / S, T6Q, S15T, N43S, F44V, G46V / C, L83M, T94D, Y95W / F, T99A / D, Q120T / F / V, R121K, V122T / F / H / D / I, N123H / S / E, I127V, I128E / Q / D / M / V, T130D, A131T / K, Y134W / D / H / Q / S / T / M / N / P / A, I172V / M / T, Y178W / F / V, F179G / Q / H / D.

5. A DNA molecule encoding the xylanase mutant according to any one of claims 1 to 4.

6. A recombinant expression plasmid comprising the DNA molecule of claim 5.

7. A host cell, It is characterized in that The host cell comprises the recombinant expression plasmid according to claim 6; the host cell is a non-plant cell.

8. The host cell according to claim 7, It is characterized in that The host cell is Trichoderma reesei ( Trichoderma reesei ).

9. Use of the xylanase mutant according to any one of claims 1 to 4 in feed production.

Images