Beta-1, 4-endo-xylanase XlyAE10, coding gene and application of beta-1, 4-endo-xylanase XlyAE10
By developing a β-1,4-endoxilanase XlyAE10 with excellent characteristics, the problem of the reduction of existing enzymes in high temperature and extreme pH environments has been solved, and efficient application in food, feed, textile, pulp bleaching and energy development has been achieved.
Patent Information
- Application Number
- CN202510586844.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-08
- Publication Date
- 2025-06-06
- Estimated Expiration
- 2045-05-08
AI Technical Summary
The existing β-1,4-endoxylase has reduced activity in high temperature and extreme pH environments, limiting its application in food, feed, textile, pulp bleaching and energy development.
A β-1,4-endoxylase called XlyAE10 was developed, with an optimum temperature of 60.0°C, an optimum pH of 5.5, and maintaining 50% activity in the pH range of 4.0-9.0 and having 93.26% enzyme activity at 65.0°C.
XlyAE10 enzyme maintains high activity under high temperature and wide range pH conditions, expanding its application potential in food, feed, textile, pulp bleaching and energy development.
Smart Images

Figure CN120098972A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the field of biotechnology, and in particular to beta-1,4-endo-xylanase XlyAE10, a coding gene and an application thereof. Background Art
[0002] Xylan is an important component of hemicellulose in plant cell walls and is an abundant biomass resource. However, it is difficult to be degraded and utilized in nature, resulting in a large waste of biological resources. Xylanase (EC. 3. 2. 1. 8) is a general term for a class of multifunctional enzymes that degrade xylan, and can hydrolyze xylan into reducing sugars such as oligoxylose and xylose. The action site of β-1,4-endo-xylanase is located inside the main chain of xylan. It can release xylo-oligosaccharides by degrading the glycosidic bonds inside xylan. Most of the hydrolysis products are xylobiose, and a small amount is arabinose and xylose. In fact, β-1,4-endo-xylanase is xylanase in a narrow sense.
[0003] Xylanases are abundant in nature. Many fungi, plant tissues, and bacteria can produce xylanases, which have received widespread attention in recent years. The enzymatic properties of xylanases from different microorganisms are also quite different. Most of the xylanases with good thermal stability come from actinomycetes, while most xylanases from bacteria and fungi do not have good heat resistance and have a low optimum reaction temperature. The optimum pH of most β-1,4-xylanases is 4.0-7.0, and they are most stable between pH 3.0-10.0. The optimum temperature is generally concentrated between 40.0℃-75.0℃. Among them, xylanases with an optimum pH of 5.0-8.0 are generally derived from Bacillus, while those with a relatively low optimum pH, such as xylanases from fungi such as Aspergillus niger. At the same time, xylanase is also an important industrial enzyme preparation, widely used in food processing, textiles, pulp bleaching, brewing, feed processing and other fields. However, different fields require different properties of xylanase. For example, pulp bleaching and feed processing require high temperature treatment. Food processing, brewing and feed industries require acid xylanase, while textile and pulp bleaching require alkaline xylanase. Therefore, the development of xylanases with different properties is conducive to expanding the application direction of xylanase in different industrializations, and has become a hot topic of widespread concern today. Summary of the invention
[0004] In view of the shortcomings of the prior art, the present invention provides β-1,4-endo-xylanase XlyAE10, encoding genes and applications thereof, and proves that it can tolerate a pH of 20-10.0 and a high temperature environment of 65.0°C and can be applied to the fields of food, feed, textile, pulp bleaching and energy development, providing more options for expanding the application of xylanase in different industrializations.
[0005] To achieve the above object, the present invention provides a β-1,4-endo-xylanase XlyAE10, characterized in that it is a protein shown in (a) or (b): (a) a protein consisting of the amino acids shown in SEQ ID NO. 1; (b) a derivative protein having the same function as the amino acid sequence shown in SEQ ID NO.1, wherein one or more amino acid residues are substituted and / or deleted and / or added; The protein of one of the above (a) or (b) has an optimum temperature of 60.0°C and an optimum pH of 5.5. It can withstand high temperature environments of pH 20-10.0 and 55-70°C, and can be used in high temperature biotechnology fields such as food, feed, textiles, pulp bleaching and energy development.
[0006] In some specific embodiments, the present invention provides a protein having an amino acid sequence with 80% identity to the sequence shown in SEQ ID NO.1, and having enhanced heat resistance; preferably, 85% identity, more preferably, 90% identity, more preferably, 95% identity, and most preferably, 99% identity.
[0007] The invention also provides a gene encoding beta-1,4-endo-xylanase XlyAE10.
[0008] Furthermore, the nucleotide sequence of the gene is (a), (b) or (c); (a) the nucleotide sequence shown in SEQ ID NO. 2; (b) a nucleotide sequence that hybridizes with and encodes the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions; (c) a nucleotide sequence encoding a gene having 80% or more homology to the nucleotide sequence shown in SEQ ID NO. 2.
[0009] It is well known to those skilled in the art that, since the same amino acid may be determined by a variety of different codons, the nucleotide sequence encoding the above-mentioned protein is not limited to just one type. It can be a nucleotide sequence that can also encode the mutant amino acid sequence of the present invention by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 2 to form a synonymous mutation, or a nucleotide sequence that can encode the mutant amino acid sequence of the present invention can be designed based on codon optimization.
[0010] In some specific embodiments, the present invention provides a protein whose gene nucleotide sequence has 80% identity with the sequence shown in SEQ ID NO. 2; preferably, it has 85% identity, more preferably, it has 90% identity, more preferably, it has 95% identity, and most preferably, it has 99% identity.
[0011] The recombinant vector, expression cassette, transgenic cell line or recombinant bacteria containing the above gene also fall within the protection scope of the present invention.
[0012] A method for preparing xylanase XlyAE10 also belongs to the protection scope of the present invention, comprising the following steps: cloning the coding gene of β-1,4-endo-xylanase XlyAE10 into a recombinant expression vector, introducing the vector into a host cell, and obtaining the recombinantly expressed xylanase XlyAE10.
[0013] Further, the nucleotide sequence of the encoding gene is (a), (b) or (c); (a) the nucleotide sequence shown in SEQ ID NO. 2; (b) a nucleotide sequence that hybridizes with and encodes the nucleotide sequence shown in SEQ ID NO. 2; (c) a nucleotide sequence encoding a gene having 80% or more homology to the nucleotide sequence shown in SEQ ID NO. 2.
[0014] Furthermore, the recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a phage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector; preferably, it is selected from pET-28a(+).
[0015] Furthermore, the recombinant bacteria or transgenic line used for recombinant expression of xylanase XlyAE10 is selected from one of Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells, and mammalian cells; preferably, selected from BL21 (DE3).
[0016] The application of xylanase XlyAE10 in xylan degradation also falls within the protection scope of the present invention.
[0017] Furthermore, the present invention provides the use of xylanase XlyAE10 in the preparation of food, medicine, feed, textiles, detergents or paper products.
[0018] Beneficial effects: The present invention provides a β-1,4-endo-xylanase XlyAE10 with excellent properties, good pH stability and heat resistance, with an optimum temperature of 60.0°C and an optimum pH of 5.5. It still maintains 50% activity in the pH range of 4.0-9.0, and has 93.26% enzyme activity at 65.0°C. It can be applied to food, feed, textile, pulp bleaching, energy development and other high-temperature biotechnology fields that require good thermal stability and long catalytic reaction time, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 This is an electrophoresis diagram for PCR amplification verification of the gene encoding β-1,4-endo-xylanase XlyAE10 in the present invention; Figure 2 It is the pH activity diagram of β-1,4-endo-xylanase XlyAE10 in the present invention; Figure 3 This is a pH stability diagram of the β-1,4-endo-xylanase XlyAE10 of the present invention; Figure 4 This is a thermal activity diagram of the β-1,4-endo-xylanase XlyAE10 of the present invention; Figure 5 This is a thermal stability diagram of the β-1,4-endo-xylanase XlyAE10 of the present invention. DETAILED DESCRIPTION
[0020] In order to make those skilled in the art better understand the technical scheme of the present invention, the present invention is described in detail below in conjunction with specific embodiments. The experimental methods for which specific conditions are not indicated in the following examples are usually carried out under normal conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, are purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar to or equal to the recorded content can all be applied to the present invention. The preferred implementation methods and materials described in the text are only for demonstration purposes.
[0021] Some experimental materials and reagents used in this invention: Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; pET-28a (+) expression vector was from Wuhan Miaoling Biotechnology Co., Ltd.
[0022] Enzymes and other biochemical reagents: Beech xylan was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; ClonExpress II One Step Cloning Kit was purchased from Nanjing Novozyme Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from QIAGEN; Pfu-Mix high-fidelity enzyme was purchased from Takara Biotechnology Co., Ltd.; others were domestic reagents (all of which can be purchased from ordinary biochemical reagent companies).
[0023] Culture medium: LB culture medium: Peptone 10 g, Yeast extract 5 g, NaCl 10 g, add distilled water to 1000 mL, pH natural (about 7.0). Solid culture medium is based on this and 2.0% (w / v) agar is added.
[0024] Example 1 Cloning of the gene encoding β-1,4-endo-xylanase XlyAE10 1.1 Fresh dung from wild Asian elephants collected in the Wild Elephant Valley, using EZNA ® The soil DNA extraction kit was used to extract total DNA according to the instructions to obtain metagenomic DNA from fresh feces of wild Asian elephants, which was stored at -20°C for future use.
[0025] 1.2 Using the binning assembly function of the metagenomics analysis software Metawrap, the metagenomic DNA of the fresh feces of wild Asian elephants obtained above was analyzed, and a strain of Bacteroides bacteria that had not been isolated and cultured was obtained ( Bacteroidales bacterium ) genome, annotated with the xylanase gene contained in the InterPro and Pfam databases, and then compared with the NR database (non-redundant protein database) using the blastp tool. The results showed that a new β-1,4-endo-xylanase XlyAE10 amino acid sequence was obtained, as shown in SEQ ID NO.1, and the highest amino acid sequence identity with the xylanase in the NCBI database was about 67.63%. The nucleic acid sequence of the new β-1,4-endo-xylanase XlyAE10 was analyzed, as shown in SEQ ID NO.2, and its length was 2673 bp. The PCR amplification primers for the β-1,4-endo-xylanase encoding gene were designed as follows: (5→3): Upstream primer XlyAE10-F (sequence as shown in SEQ ID NO.3): TGGTGCCGCGCGGCAGCCATTGATGAATAATATCAGTAAGATAATTG Downstream primer XlyAE10-R ((sequence as shown in SEQ ID NO.4): TGGTGGTGGTGGTGGTGCTCGAGCTCAGCCTTTGGTTGCGCTGTGAAT Among them, the upstream and downstream primers XlyAE10-F and XlyAE10-R contain the recombinant connection fragments and are used for the construction of the recombinant vector; 1.3 Extract the total DNA of the intestinal metagenomics of wild Asian elephants and use it as a template for PCR amplification. The amplification reaction system is as follows: 25 μL Pfu-Mix, 2.5 μL primers XlyAE10-F and XlyAE10-R, 5 μL DNA, and ddH 2 The amplification reaction conditions were as follows: 94°C for 5 min; 94°C for 30 s, 63°C-49°C for 30 s, 72°C for 3 min, for a total of 28 cycles, with the annealing temperature decreasing by 0.5°C in each cycle; 94°C for 30 s, 49°C for 30 s, 72°C for 3 min, for a total of 7 cycles; finally, 72°C for 10 min; 4°C for 10 min.
[0026] 1.4 The PCR product was verified by 1% agarose gel electrophoresis. It was found that the PCR amplification verification electrophoresis diagram of the β-1,4-endo-xylanase XlyAE10 encoding gene (such as Figure 1 ), where lane M is the DNA marker of DL15000 bp and lane EA10 is the amplified product. The PCR product was recovered by gel purification and sent for sequencing verification, and a 2673 bp band was obtained, which is the β-1,4-endo-xylanase encoding gene XlyAE10.
[0027] Experimental Example 2 Construction and transformation of recombinant β-1,4-endo-xylanase XlyAE10 expression vector 2.1 The expression vector pET-28a(+) was digested with restriction endonucleases (NdeI and XhoI), and the digestion products of XlyAE10 and pET-28a(+) after gel recovery and purification were connected with the recombinase of ClonExpress II One Step Cloning Kit to obtain the recombinant plasmid XlyAE10-pET-28a(+) containing XlyAE10. The nucleotide sequence of the recombinant XlyAE10 is shown in SEQ ID NO.5; 2.2 The recombinant plasmid XlyAE10-pET-28a(+) was transformed into Escherichia coli BL21(DE3) by heat shock to obtain the recombinant strain BL21(DE3) / XlyAE10 containing XlyAE10.
[0028] Experimental Example 3 Preparation of recombinant β-1,4-endo-xylanase XlyAE10 3.1 The recombinant strain BL21(DE3) / XlyAE10 obtained in Example 2 was inoculated into LB (containing 50 μg / mL kanamycin) culture medium at an inoculum size of 0.5%, and activated by shaking in a shaker at 37°C and 200 rpm / min for 12-16 h; 3.2 Inoculate the activated bacterial solution in 1) into fresh LB (containing 50 μg / mL kanamycin) culture medium at a 2% inoculum volume, culture in a shaker at 37°C and 200 rpm / min for about 4 h (OD is about 0.8), add IPTG at a final concentration of 0.5 mM for induction, and continue to culture in a shaker at 16°C and 150 rpm / min for about 18 h to induce the production of recombinant protein; 3.3 Centrifuge at 4°C and 8000 rpm / min for 10 min to collect the cells. Suspend the cells with an appropriate amount of pH=7.0 citric acid-phosphate buffer and disrupt the cells by ultrasonic in a low-temperature water bath. Centrifuge the above intracellular concentrated crude enzyme solution at 13000 rpm / min for 15 min, aspirate the supernatant and affinity purify the target protein with Nickel-NTA Agarose and 0-500 mM imidazole.
[0029] The SDS-PAGE results of the purified protein are as follows Figure 1 As shown, M is a protein marker and EA10 is a recombinant β-1,4-endo-xylanase XlyAE10. The results showed that the recombinant novel β-1,4-endo-xylanase XlyAE10 was expressed and purified, and the product was a single band.
[0030] Example 3 Investigation of the activity of β-1,4-endo-xylanase XlyAE10 Activity determination method DNS method was used to determine the activity of purified recombinant enzyme XlyAE10 with beech xylan as substrate. Beech xylan was dissolved in buffer to a final concentration of 0.5%; the reaction system contained 100 μL enzyme solution and 900 μL substrate-containing buffer; the substrate was preheated at the reaction temperature for 5 min, then the enzyme solution was added and the reaction was continued for another 10 min, and then 1.5 mL DNS was added to terminate the reaction. After mixing, the reaction was boiled in boiling water for 5 min. The control group was first added with the stop solution and then the enzyme solution. After cooling, the absorbance was measured at a wavelength of 540 nm. The experiment consisted of one control group and three parallel tests. Enzyme activity definition: 1 enzyme activity unit (U) is defined as the amount of enzyme required to decompose xylan to produce 1 μmol of xylose per minute.
[0031] The purified enzyme solution was placed in buffers of different pH values (citrate-phosphate buffer pH 2.0-7.0; Tris-HCl buffer pH 7.0-9.0; glycine-NaOH buffer pH 9.0-12.0) and the enzymatic reaction was carried out at 37°C to determine the enzymatic activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 (see Figure 2 ).
[0032] like Figure 2 As shown, the results showed that the optimum pH of the purified recombinant β-1,4-endo-xylanase XlyAE10 was 6.0, and it still maintained 50% activity in the pH range of 4.0-9.0.
[0033] Example 4 Investigation of the stability of β-1,4-endo-xylanase XlyAE10 in different pH environments The purified enzyme was placed in a pH 2.0-12.0 buffer (pH = 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0 is citric acid-phosphate buffer; pH = 9.0, 10.0, 11.0, 12.0 is glycine-NaOH buffer) and treated at 37°C for 60 min. According to the enzyme activity determination method, the enzymatic reaction was carried out at pH 5.0 and 37°C, with beech xylan as the substrate, and the reaction was carried out for 10 min to determine the relative enzyme activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 (see Figure 3 ).
[0034] like Figure 3 As shown, the results showed that the purified recombinant β-1,4-endo-xylanase XlyAE10 could maintain more than 50% of the enzyme activity at pH 2.0-10.0 for 60 min.
[0035] Example 5 Investigation of the thermal activity of β-1,4-endo-xylanase XlyAE10 The enzymatic reaction was carried out in a buffer solution at pH 5.5 at 10-90 °C. Beech xylan was used as substrate for 10 min and the activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 was determined (see Figure 4 ).
[0036] like Figure 4 The results showed that the optimum temperature of the recombinant β-1,4-endo-xylanase XlyAE10 was 60.0℃. The enzyme activities were 93.26%, 76.23%, 52.12% and 22.66% at 65.0℃, 70.0℃, 80.0℃ and 90.0℃, respectively, indicating that the recombinant β-1,4-endo-xylanase XlyAE10 was a high-temperature enzyme.
[0037] Example 6 Investigation of the thermal stability of β-1,4-endo-xylanase XlyAE10 The same amount of enzyme solution was placed at 55.0℃, 60.0℃ and 65.0℃ for 60min, and the enzyme activity was measured once at 5 min, 10 min, 15 min, 20 min, 30 min, 40 min, 50 min and 60 min. The enzymatic reaction was carried out at pH = 5.5 and 37℃, and the untreated enzyme solution was used as a control. Beech xylan was used as a substrate and the reaction was carried out for 10 min. The enzyme activity of the purified recombinant β-1,4-endo-xylanase XlyAE10 was determined (see Figure 5 ).
[0038] like Figure 5 As shown, the results showed that the enzyme activity of recombinant β-1,4-endo-xylanase XlyAE10 decreased to 63.55% after treatment at 55.0℃ for 60 min, and the temperature half-life had not yet been reached; the enzyme activity decreased to 42.96% after treatment at 60.0℃ for 60 min; the enzyme activity decreased to 48.57% after treatment at 65.0℃ for 30 min, and the temperature half-life was about 30 min; these results indicate that β-1,4-endo-xylanase XlyAE10 can tolerate a high temperature environment of 65℃ and is a thermostable endo-xylanase.
[0039] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make a variety of similar expressions without violating the purpose and claims of the present invention, and such changes all fall within the protection scope of the present invention.
Claims
1. A β-1,4-endo-xylanase XlyAE10, characterized in that The protein shown in (a) or (b): (a) a protein consisting of the amino acids shown in SEQ ID NO. 1; (b) A derivative protein having the same function as the amino acid sequence shown in SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added.
2. The β-1,4-endo-xylanase XlyAE10 according to claim 1, characterized in that The enzyme activity temperature of the xylanase XlyAE10 is 55-70° C., and the enzyme activity pH value is 2.0-10.
0.
3. The gene encoding β-1,4-endo-xylanase XlyAE10 according to claim 1, characterized in that The nucleotide sequence of the encoding gene is (a), (b) or (c); (a) the nucleotide sequence shown in SEQ ID NO. 2; (b) a nucleotide sequence that hybridizes with and encodes the nucleotide sequence shown in SEQ ID NO. 2; (c) a nucleotide sequence encoding a gene having 80% or more homology to the nucleotide sequence shown in SEQ ID NO.
2.
4. A recombinant vector, expression cassette, transgenic line or recombinant bacterium containing the coding gene according to claim 3.
5. A method for preparing xylanase XlyAE10, characterized in that: The coding gene according to claim 3 is cloned into a recombinant expression vector and introduced into a host cell to obtain the recombinantly expressed xylanase XlyAE10.
6. The preparation method according to claim 5, characterized in that: The recombinant expression vector is selected from one or more of an Escherichia coli expression vector, a yeast expression vector, a Bacillus subtilis expression vector, a lactic acid bacteria expression vector, a Streptomyces expression vector, a bacteriophage vector, a filamentous fungus expression vector, a plant expression vector, an insect expression vector, or a mammalian cell expression vector.
7. The preparation method according to claim 5, characterized in that: The host cell is selected from one of Escherichia coli host cells, yeast host cells, Bacillus subtilis host cells, lactic acid bacteria host cells, actinomycete host cells, filamentous fungal host cells, insect cells and mammalian cells.
8. The preparation method according to claim 5, characterized in that: The recombinant expression vector is selected from pET-28a(+), and / or, The host cell is selected from BL21 (DE3). 9 . Use of the β-1,4-endo-xylanase XlyAE10 according to claim 1 in xylan degradation.
10. The use according to claim 9, characterized in that: Application in the preparation of food, medicine, feed, textiles, detergents or paper products.
Citation Information
Patent Citations
Low-temperature xylanase XYNGR40 and gene and application thereof
CN101921739A
Xylanases, nucleic adics encoding them and methods for making and using them
CN101967490A
Cryophilic xylosidase / arabinofuranosidase and preparation method and application thereof
CN102051350A
Xylanase XynRBM26 and encoding gene thereof
CN104726434A
Compositions and methods comprising a xylanase enzyme variant
CN106103709A