Melanin nucleic acid pest prevention and control preparation as well as preparation method and application thereof
By combining dsRNA with melanin nanomaterials, electrostatic interactions are used to improve the stability and delivery efficiency of dsRNA, the application challenges of RNAi technology in pest control and achieve more efficient pest control effects.
Patent Information
- Application Number
- CN202510257290.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-06-06
AI Technical Summary
The application of RNAi technology in pest control faces the problems of poor stability, low delivery efficiency and high cost of dsRNA, which limits its large-scale application.
By using melanin nanomaterials to carry dsRNA, electrostatic interactions are used to prepare melanin nucleic acid pest control agents to improve the stability and delivery efficiency of dsRNA.
It effectively improves the internal and external stability of dsRNA, significantly improves its delivery efficiency into somatic cells, and initially improves the effect of preventing and controlling pests.
Smart Images

Figure CN120098998A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of agricultural pest control, and specifically relates to a melanin nucleic acid pest control preparation and a preparation method and application thereof. Background Art
[0002] Agricultural pests are an important factor affecting crop yield and quality, causing huge economic losses every year. Traditional pest control methods mainly rely on chemical pesticides. However, the long-term and large-scale use of chemical pesticides has led to a series of problems, including pest resistance, environmental pollution and non-target biological hazards. To solve the above problems, people have begun to explore safer, more efficient and environmentally friendly pest control methods.
[0003] As an emerging gene silencing technology, RNA interference (RNAi) technology provides a new idea for pest control. RNAi technology introduces exogenous double-stranded RNA (dsRNA) into pests to specifically silence the expression of key genes of pests, thereby inhibiting the growth and development of pests or causing their death. RNA interference technology has the advantages of high specificity and no residue, making RNA biopesticides selected as the top ten scientific breakthroughs of the year in Science in 2024. As early as 2007, studies reported that transgenic plants based on RNAi technology can control pests. Corn rootworms (Diabrotica virgifera virgifera) can cause larval developmental delay by feeding on transgenic corn expressing dsRNA. In 2017, Monsanto's first transgenic corn MON87411 expressing dsRNA was approved by the US Environmental Protection Agency (EPA), which was the first commercial case of RNAi technology application. Since then, the product has been continuously improved and developed to obtain multiple generations of improved transgenic products. The continuous investment of capital has led to the thriving development of new products based on RNAi technology. In 2023, the first spray-type dsRNA product Ledprona biopesticide for the control of Colorado potato beetle (Leptinotarsa decemlineata) was registered by the EPA. Therefore, RNAi has shown great application potential in agricultural pest control.
[0004] However, the application of RNAi technology in pest control faces the following challenges: 1) Poor stability of dsRNA: dsRNA is easily degraded by nucleases in the environment and is difficult to effectively reach the target pest. 2) Low dsRNA delivery efficiency: dsRNA has difficulty penetrating the body wall and cell membrane of pests and entering target cells to exert its effects. 3) High cost: The high cost of dsRNA synthesis limits its large-scale application. In recent years, nanomaterials have shown great potential as dsRNA carriers in the field of pest control. Nanomaterials can protect dsRNA from degradation, improve its delivery efficiency, and achieve targeted release. Among them, melanin nanomaterials have attracted much attention due to their unique physical and chemical properties such as good biocompatibility and degradability, excellent adsorption performance, photothermal conversion characteristics and pH responsiveness. Therefore, the development of a pest control preparation based on melanin nanomaterials carrying dsRNA is of great significance for improving RNAi efficiency and promoting the development of green pest control technology. Summary of the invention
[0005] In view of this, the purpose of the present invention is to overcome the deficiencies of the above-mentioned prior art and provide a melanin nucleic acid pest control preparation and a preparation method and application thereof.
[0006] To achieve the above object, the technical solution of the present invention is as follows:
[0007] On one hand, the present invention provides a melanin nucleic acid pest control preparation, which is a complex with pest control function formed by melanin nanomaterials carrying dsRNA.
[0008] Furthermore, the dsRNA targets key genes of pests, including key lethal genes related to growth, development, reproduction, and metabolism.
[0009] Furthermore, the dsRNA is dsLmCht10, and its sequence is shown in SEQ ID NO.1.
[0010] Another aspect of the present invention provides a method for preparing the melanin nucleic acid pest control agent as described above, comprising: first modifying melanin nanoparticles MNP with polylysine PLL to obtain MNP-PLL nanoparticles, and then mixing the MNP-PLL nanoparticles with a dsRNA solution.
[0011] Furthermore, the mass ratio of the polylysine to the melanin nanoparticles is 2:1-5:1.
[0012] Furthermore, the solid mass ratio of the MNP-PLL to the dsRNA is 1:1-1:5.
[0013] Another aspect of the present invention also provides the use of the melanin nucleic acid pest control preparation as described above in controlling agricultural pests.
[0014] Another aspect of the present invention also provides the use of the melanin nucleic acid pest control preparation as described above in the preparation of nucleic acid biological pesticides for controlling agricultural pests.
[0015] Furthermore, the agricultural pests are Orthoptera pests.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] The present invention realizes the loading of dsRNA on melanin nanomaterials through electrostatic interaction, prepares melanin nucleic acid pest control preparations, and preliminarily tests the in vitro protective effect of melanin nanomaterials on dsRNA, the improvement effect of melanin nanomaterials on the efficiency of dsRNA entering the blood cells of locusts, and the improvement effect of RNAi efficiency of locusts. The melanin nucleic acid pest control preparation prepared by the present invention effectively improves the in vitro and in vivo stability of dsRNA, greatly improves the delivery efficiency of dsRNA entering somatic cells, preliminarily improves the control effect, and provides a new technical approach for nucleic acid biological pesticide control technology of locusts. BRIEF DESCRIPTION OF THE DRAWINGS
[0018] Figure 1 The effect of melanin nanomaterials on dsRNA loading;
[0019] Figure 2 Particle size and morphology of melanin nucleic acid pest control formulations;
[0020] Figure 3 Melanin improves the in vitro stability of dsRNA;
[0021] Figure 4 Melanin promotes the absorption of dsRNA by locust blood cells;
[0022] Figure 5 Evaluation diagram of the pest control effect of melanin nucleic acid pest control preparations;
[0023] Figure 6 Diagram of biotoxicity evaluation of melanin nucleic acid pest control preparations. DETAILED DESCRIPTION
[0024] In order to facilitate the understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0025] The dsRNA in the embodiment of the present invention is dsLmCht10, and its sequence is shown in SEQ ID NO.1.
[0026] SEQ ID NO.1:
[0027] cagcagtatcaccgagcaaagttgtcattgactcaggctatgatgttcctgttctgtctcagtactttgattacatctctctgtgatgacttatgatttccatggccattgggataagcagactggtcatgttg ctcctctgtattactatcctggagatacttatgattacttcaatgctaacttcacaatgcattactggatagagaagggagctgacaggaaaaagcttataatgggtatgcccatgtatggacagtcattct cactggctgacgctaaaaatcatggtctgaatgctaagtcatatggtcctggtgaggctggagagtttacacgggctggtggattcatggcttattatgagatatgttataatgtgaagaacaaaggatgga ctacggtaagggatcccgaaggaagaattggtccatatgcataccgtggtaatcagtgggtttcttatgatgatgtgtccgacatcagaagaaagactaagttcattaaagaacttggacttggtggtggaat
[0028] Example 1 Preparation of melanin nucleic acid pest control preparation
[0029] Weigh 0.5 g dopamine hydrochloride, 1 g poly(ethylene glycol)-block-poly(propylene glycol)-block-poly(ethylene glycol) ( F-127). Add the above powder to a flask and add 100mL of solution (50mL of anhydrous ethanol and 50mL of distilled water). Put it in an ultrasonic instrument and dissolve until there is no precipitation. Add 2mL of tridecane to the above solution, stir at 250rpm for half an hour, then add 5mL of ammonia water, continue stirring for two hours, the reaction is over, and transfer to a large tube. Centrifuge at 4℃ for 20min, 12000rpm. Remove the supernatant, add distilled water, resuspend and wash, centrifuge until the pH of the supernatant is neutral, and obtain melanin nanoparticles.
[0030] 20 mg of melanin nanoparticles MNP were dissolved in 10 mL of 0.1 M NaOH, and the pH was adjusted to 7.0 with 10 mL of 0.1 M HCl to obtain a 1 mg / mL MNP solution. The above solution was centrifuged with a 50 mL ultrafiltration tube (MWCO 30 kDa), and the NaCl was removed by ultrafiltration at 4000 rpm for 4 min. The polylysine PLL solution was added dropwise to the melanin solution (the mass ratio of polylysine to melanin nanoparticles was 2:1) to obtain the MNP-PLL solution, which was vigorously stirred for 24 h (400 rpm, pH was adjusted to 9.0 with 0.1 M NaOH); the MNP-PLL solution was mixed with dsLmCht10 according to a solid mass ratio of 1:1-1:5, vortexed for 30 seconds, and the melanin nucleic acid pest control preparation was obtained after standing at room temperature for 20 minutes, which was labeled as MNP-PLL / dsLmCht10. The optimal binding mass ratio was observed and confirmed by agarose gel electrophoresis. Figure 1 The electrophoresis results showed that the optimal mass ratio of MNP-PLL to dsLmCht10 was 1:1.
[0031] Example 2 Characterization of Melanin Nucleic Acid Pest Control Preparations
[0032] UV-Vis can perform simple qualitative analysis of the composition and structure of a substance through absorbance, and is a common method for material characterization. First, scan with deionized water, and use the result as the baseline. Then dilute the melanin stock solution, dsRNA solution, and MNP-PLL / dsRNA solution by the same multiple, and pipette 2mL of each solution into a quartz cuvette, and put it into the instrument for measurement. The wavelength range is 200-800nm.
[0033] Particle size and morphology analysis of melanin nucleic acid pest control preparations: The particle size of the above three solutions was detected using a multi-angle particle size and high-sensitivity Zeta potential analyzer. The detection conditions were: temperature 25°C, solvent water, and the number of detections was three times. At the same time, the morphology of the nanoformulation was observed using a transmission electron microscope. The samples MNP-PLL, dsLmCht10 and MNP-PLL / dsLmCht10 were diluted to 10 ng / ul and observed under a transmission electron microscope (ThermoFisher Talor L120C G2, USA). The copper mesh was discharged with 15 mA micro-light, and 2 ul of the sample was dropped on the ultra-thin copper mesh and dried for 3 minutes. dsLmCht10 was stained with 1% uranyl acetate for 3 minutes, and MNP-PLL and MNP-PLL / ds LmCht10 were directly observed on the machine after drying.
[0034] Figure 2 a shows that MNP-PLL / dsRNA has an absorption peak at 260 nm, indicating that the melanin nucleic acid pest control preparation was successfully prepared. Figure 2b shows that the particle size of MNP-PLL in aqueous solution is about 275 nm, the particle size of dsLmCht10 is about 203 nm, and the particle size of the melanin nucleic acid pest control agent MNP-PLL / dsLmCht10 is about 342 nm. Figure 2 c shows: Under transmission electron microscopy, the morphology of melanin particles MNP-PLL is spherical, dsLmCht10 is filamentous, MNP-PLL / dsLmCht10 has a network structure, and melanin nanoparticles are attached to the surface of nucleic acids.
[0035] Example 3 Effect of melanin on the in vitro stability of dsRNA
[0036] Locust midgut fluid incubation experiment: Take the third day of the fifth instar locust, dissect the midgut of the locust, take out the midgut contents, add 200μL of BRBuffer into a 1.5mL EP tube, centrifuge at 16,000g, 4℃ for 10min, take the supernatant and store it at -20℃ for later use. Take 20μL of locust midgut fluid (total protein is 20μg), add 1000ng dsLmCht10 to it, and incubate it in a 28℃ metal bath for different times. Note: After the MNP-PLL / dsLmCht10 group is incubated for each time, immediately add 6× Loading Buffer and put it on ice to terminate the incubation. Disaggregation: Add 5μL 1% SDS to the EP tube and incubate at 25℃ for 10min. Then use agarose gel electrophoresis to detect the protective effect of melanin on nucleic acid.
[0037] The experimental results showed that the naked dsRNA began to degrade after 5 minutes of incubation in the intestinal fluid, and the dsRNA was completely degraded after 10 minutes. In the MNP-PLL / dsLmCht10 group, the dsLmCht10 began to degrade after 90 minutes and was completely degraded after 120 minutes ( Figure 3 ). The above results indicate that melanin can protect dsRNA from degradation by nuclease in the intestinal fluid of locusts.
[0038] Example 4 Effect of melanin on dsRNA delivery
[0039] dsGFP using T7 RiboMAX TMThe dsGFP fluorescent label was synthesized by the Express RNAi System (Promage, USA) kit according to the manufacturer's experimental protocol using the Roche kit (Roche Diagnostics, USA), and the biotin-16-UTP was transcribed in vitro using the fluorescent RNA labeling mixture. MNP-PLL and dsGFP were compounded at an optimal mass ratio of 1:1 and incubated at room temperature for 20 minutes to generate MNP-PLL / dsGFP nanomaterials. The prepared MNP-PLL / dsGFP nanomaterials were injected into the locust blood cavity using a microsyringe. The locust blood cells were collected at different times of 1, 20, 60, and 120 minutes, smeared on a slide, fixed with paraformaldehyde, and stained with a cell nucleus (blue) and cell membrane dye (orange), and then the difference in green fluorescence intensity in the cells was observed under a laser confocal microscope. At the same time, RT-qPCR technology was used to detect the absorption of dsGFP and MNP-PLL / dsGFP by blood cells. To detect whether melanin nanocarriers can improve the absorption efficiency of locust blood cells for dsGFP with green fluorescence.
[0040] The results showed that over time, the green fluorescence intensity in the blood cells of the MNP-PLL / dsGFP treatment group increased compared with the control group dsGFP. This indicates that melanin enhances the absorption effect of dsGFP ( Figure 4 a,b,c,d,e,f).
[0041] Example 5 Biological Assay of Melanin Nucleic Acid Pest Control Preparation
[0042] In order to detect the effect of the melanin nucleic acid pest control agent prepared above on the efficiency of RNAi of migratory locusts, two dose experiments were set up, namely 10ng or 50ng dsLmCht10 per locust. For each dose experiment: uniform and active migratory locust nymphs of the fifth instar and one day old were selected and injected with equal amounts of dsLmCht10, MNP-PLL-dsLmCht10, H 2 O. Observe the death of the insects, record the data, and analyze the mortality rate. At the same time, 3-4 days after injection, randomly select nymphs, dissect the epidermal tissue, extract total RNA, reverse transcribe to obtain cDNA, and use RT-qPCR to detect the silencing efficiency of the target gene.
[0043] The results of RNAi biological assays showed that the silencing efficiency of the target gene in locusts was increased by 30% (10 ng) and 70% (50 ng) after the treatment of locusts with 10 ng and 50 ng of MNP-PLL-dsLmCht10 complexes compared with the control naked dsLmCht10 treatment group ( Figure 5 a), the mortality rate of nymphs increased by about 20% ( Figure 5b). The results show that melanin nucleic acid pest control agents can improve the RNAi efficiency of locusts, and have broad application prospects in the field of nucleic acid biological pesticide research and development.
[0044] Example 6 Biological Toxicity Evaluation of Melanin Nucleic Acid Pest Control Preparations
[0045] 1. Biological toxicity evaluation of PLL-modified melanin MNP-PLL
[0046] Using Drosophila melanogaster as an experimental model, the biological toxicity of MNP-PLL was evaluated. 420 adults that emerged within 3 days were taken. 20 fruit flies were treated with each concentration, with 10 female flies and 10 male flies in each tube. Three parallel tests were set up, and a blank control was performed at the same time. The concentrations of the MNP-PLL prepared above were set to 0.1 mg / mL, 1 mg / mL, 10 mg / mL, 20 mg / mL, 30 mg / mL, and 50 mg / mL, respectively. Different masses of MNP-PLL were added to the feeding medium, and after the fruit flies were placed in the treated medium, the fruit flies began to feed. After that, the number of deaths of fruit flies was observed at 24h, 48h, 72h, and 96h, and the biological toxicity of melanin MNP-PLL was evaluated by analyzing the survival rate data of fruit flies in different time periods.
[0047] The above acute toxicity test results show that the fruit flies under different dosage concentrations did not die within 96 hours, and the survival rate was 100% ( Figure 6 a). Therefore, the PLL-modified melanin nanoparticles MNP-PLL have no acute toxicity, and the material is a biosafety material and a preferred carrier for developing green and safe nucleic acid biopesticides.
[0048] 2. Biological toxicity evaluation of melanin nucleic acid pest control agents
[0049] Using Drosophila melanogaster as an experimental model, the biological toxicity of melanin nucleic acid pest control preparations was evaluated. 720 adults that emerged within 3 days were taken. 20 fruit flies were treated with each concentration, with 10 female flies and 10 male flies in each tube. Three parallel tests were set up. The concentrations of MNP-PLL-dsLmCht10 were set to 0.125 mg / mL, 0.25 mg / mL, 0.5 mg / mL, 1 mg / mL, and 2 mg / mL, respectively. Different masses of MNP-PLL-dsLmCht10 were added to the feeding medium, and the fruit flies began to feed after being placed in the treated medium. After that, the death number of fruit flies was observed at 24h, 48h, 72h, and 96h, and the biological toxicity of the melanin nucleic acid pest control preparation MNP-PLL-dsLmCht10 was evaluated by analyzing the survival rate data of fruit flies in different time periods.
[0050] The above acute toxicity test results show that the survival rate of fruit flies at different dosage concentrations is greater than 98% at 96h, and there is no significant difference in mortality data between different concentrations ( Figure 6 b). Therefore, the melanin nucleic acid pest control preparation has no acute toxicity and is a safe nucleic acid biological pesticide pest control preparation.
[0051] The above description is only for better explaining the embodiments of the present invention, and is not intended to limit the present invention. Any modification or equivalent substitution that does not depart from the spirit and scope of the present invention shall fall within the scope of the present invention.
Claims
1. A melanin nucleic acid pest control preparation, characterized in that: It is a complex with pest control function formed by melanin nanomaterials carrying dsRNA.
2. The melanin nucleic acid pest control preparation according to claim 1, characterized in that: The dsRNA targets key genes of pests, including key lethal genes related to growth, development, reproduction and metabolism.
3. The melanin nucleic acid pest control preparation according to claim 2, characterized in that: The dsRNA is dsLmCht10, and its sequence is shown in SEQ ID NO.
1.
4. The method for preparing the melanin nucleic acid pest control preparation according to any one of claims 1 to 3, characterized in that: include: Firstly, melanin nanoparticles MNP are modified with polylysine PLL to obtain MNP-PLL nanoparticles, and then the MNP-PLL nanoparticles are mixed with a dsRNA solution.
5. The method for preparing the melanin nucleic acid pest control preparation according to claim 4, characterized in that: The mass ratio of the polylysine to the melanin nanoparticles is 2:1-5:
1.
6. The method for preparing the melanin nucleic acid pest control preparation according to claim 4, characterized in that: The solid mass ratio of the MNP-PLL to the dsRNA is 1:1-1:
5.
7. Use of the melanin nucleic acid pest control preparation according to any one of claims 1 to 3 in controlling agricultural pests.
8. Use of the melanin nucleic acid pest control preparation according to any one of claims 1 to 3 in the preparation of nucleic acid biological pesticides for controlling agricultural pests.
9. The use of the melanin nucleic acid pest control preparation according to claim 7 or 8, characterized in that: The agricultural pests are Orthoptera pests.