Method for controlling activity of deoxyribozyme through intramolecular cyclization and application thereof

Abstract

The invention provides a method for controlling activity of deoxyribozyme through intramolecular cyclization and application of the method, and relates to application of the method in the field of biological analysis and regulation. According to the method, a ring-forming chain is subjected to intramolecular connection mainly through T4DNA ligase and a splint chain to form a ring-shaped molecule, so that active conformation cannot be formed, and catalytic activity cannot be lost. Meanwhile, by modifying functional elements (such as photosensitive groups, disulfide bonds and the like) on the deoxyribozyme, the annular deoxyribozyme can be opened and converted into a linear structure under specific conditions (such as illumination, a reducing agent and the like), so that the catalytic activity of the annular deoxyribozyme is recovered. The cyclic deoxyribozyme molecule has a good enzyme digestion resistant effect and biological stability. The method is simple and efficient, can be used for controlling the catalytic activity of deoxyribozyme in living cells, realizes space-time selective sensing analysis and metabolism regulation of target biomolecules, and is extremely high in application value.

Description

Technical Field

[0001] The invention belongs to the cross field of chemistry and biotechnology, and in particular relates to a method for controlling the activity of a deoxyribozyme through intramolecular cyclization and its application. Background Art

[0002] In 1982, American scientist T. Cech discovered ribozymes in his research. The RNA that splices introns by itself has catalytic function. Compared with protein enzymes, ribozymes have lower catalytic efficiency and are a relatively primitive catalytic enzyme. However, only a small number of the ribozymes discovered so far exist naturally, and most of them are obtained through in vitro screening technology. Thanks to the accelerated selection process of in vitro screening technology, researchers have successively discovered new catalytic functions of ribozymes in RNA ligation, phosphorylation, and self-alkylation. So far, people have not found naturally occurring DNA with catalytic function in nature. However, due to the similarity between DNA and RNA in chemical structure, researchers have explored whether DNA also has catalytic ability similar to ribozymes, and single-stranded DNA molecules with catalytic function are called deoxyribozymes.

[0003] At present, all DNAzymes are obtained through SELEX technology. DNAzyme is a type of functional nucleic acid obtained by in vitro screening, which has the ability to sense and image a variety of metal ions. DNAzyme has the advantages of simple synthesis, easy chemical modification, strong designability and good biocompatibility. DNAzyme is a single-stranded DNA fragment with high catalytic activity and structural recognition ability. Like single-stranded RNA molecules, it can fold, catalyze and exhibit enzyme activity.

[0004] Since the first discovery of deoxyribozymes in 1994, dozens of DNAzymes have been discovered so far. Among all DNAzymes, the most special one is the one with RNA cleavage activity, which can catalyze the cleavage reaction at a specific site of RNA, silence genes at the mRNA level, and thus regulate protein expression. It may become a new gene therapy drug for fighting viral infections, tumors and other diseases, and a new nucleic acid tool enzyme for gene function research, nucleic acid mutation analysis, etc. DNAzyme has the characteristics of site-specific RNA cleavage, can be chemically synthesized, is easy to transform and iteratively update, and can be redesigned for different target RNAs. Although DNAzyme has made great progress, it is constrained by the "always on" design mode of traditional DNAzyme sensors and lacks controllability in time and space dimensions. After encountering the target molecule during the delivery process, it will immediately recognize and cleave the substrate, resulting in serious nonspecific background signals, which limits its application in living cells and living organisms. It is still a challenge to develop new methods and technologies to achieve precise control of DNAzyme activity at the cellular level.

[0005] Intramolecular cyclization is a reaction that causes a molecular chain to form a ring structure. DNA cyclization refers to the connection of single-stranded DNA molecules end to end to form a ring. The usual method of cyclization is to use DNA ligase to connect into a ring with the assistance of a DNA splint chain, that is, the linear DNA (circular chain) is hybridized with a DNA splint chain that is partially complementary to its two ends to form a nick structure, and the two ends of the circular chain are closed by DNA ligase. Compared with linear DNA, circular DNA has better resistance to enzyme cutting and biological stability.

[0006] In view of this, the present invention utilizes intramolecular cyclization technology to perform intramolecular ligation on deoxyribozymes through T4 DNA ligase and splint DNA chains to cyclize deoxyribozymes modified with functional elements for controlling the catalytic activity of deoxyribozymes in living cells. This method has important application value for spatiotemporal selective sensing analysis and metabolic regulation of target biological molecules. Summary of the invention

[0007] In order to solve the above technical problems, the present invention provides a method for controlling the activity of deoxyribozymes by intramolecular cyclization and its application. The present invention uses T4 DNA ligase to cyclize deoxyribozymes modified with functional elements for controlling the catalytic activity of deoxyribozymes in living cells. This method has important application value for spatiotemporal selective sensing analysis and metabolic regulation of target biological molecules. The technical scheme adopted is: by using T4 DNA ligase, deoxyribozyme molecules are cyclized to achieve good anti-enzymatic effect and biological stability; by modifying the functional elements of deoxyribozymes, conformational conversion is achieved under specific conditions (such as light, reducing agent, etc.), and its linear structure is restored, thereby restoring its catalytic activity, thereby realizing the catalytic activity control of deoxyribozymes in living cells.

[0008] To achieve this object, the present invention adopts the following technical solutions:

[0009] In a first aspect, the present invention provides a method for intramolecular cyclization of a deoxyribozyme, the method comprising: mixing a circular chain with a splint chain, annealing, adding T4 DNA ligase, and ligating under the action of T4 DNA ligase to obtain a circular deoxyribozyme;

[0010] Among them, the nucleic acid sequence of the ring-forming chain includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleic acid sequence of the splint chain includes the sequence shown in SEQ ID NO.3 or SEQ ID NO.4.

[0011] SEQ ID NO. 1: GAGCTGCCGCGAGCTGCAGGCTAGCTACAAC.

[0012] SEQ ID NO. 2: ACGACCGCTCCCCTCGGCCAGGCTAGCTACA.

[0013] SEQ ID NO. 3: CTAGTTTTCTAGCAGCTCGTTGTACGTGTTTTCACG.

[0014] SEQ ID NO. 4: CTAGTTTTCTAGGGTCGTTGTAGCCGTGTTTTCACG.

[0015] When the looped chain is SEQ ID NO.1 optionally containing functional elements, the splint chain is SEQ ID NO.3; when the looped chain is SEQ ID NO.2 optionally containing functional elements, the splint chain is SEQ ID NO.4.

[0016] The method for intramolecular cyclization of deoxyribozymes provided by the present invention uses T4 DNA ligase and a splint chain to intramolecularly connect the circular chain, and form a phosphodiester bond between the 5'-terminal phosphate group of the linear circular chain and its own 3'-terminal hydroxyl group to form a circular deoxyribozyme, so that it cannot form an active conformation and loses catalytic activity. The purified circular deoxyribozyme is subjected to exonuclease cleavage, and the circular deoxyribozyme cannot be cleaved by the exonuclease.

[0017] The deoxyribozyme selected 10-23DNAzyme, the active site sequence remains unchanged, the two arms can complementarily pair with the corresponding mRNA bases, and the circular chain hybridizes with a DNA splint chain with six complementary bases at both ends to form a nick structure.

[0018] Preferably, the looping chain has functional elements.

[0019] Preferably, the functional element comprises a photosensitive group or a disulfide bond.

[0020] Preferably, the nucleic acid sequence forming the loop chain includes any one of GAGCTGCCG / iPCLinker / CGAGCTGCAGGCTAGCTACAAC, GAGCTGCCG / iSH-HS / CGAGCTGCAGGCTAGCTACA AC or ACGACCGCTCC / iPCLink / CCTCGGCCAGGCTAGCTACA.

[0021] Preferably, the molar ratio of the ring-forming chain to the splint chain is 1:(1-5).

[0022] The specific point values ​​(1 to 5) mentioned above can be 1, 2, 3, 4 or 5, etc.

[0023] Preferably, the annealing includes: reacting at 70-90°C (for example, 70°C, 75°C, 78°C, 80°C, 82°C, 85°C or 90°C, etc.) for 5-10 min (for example, 5 min, 6 min, 7 min, 8 min, 9 min or 10 min, etc.), and cooling to 20-30°C (for example, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C or 30°C, etc.).

[0024] Preferably, the ratio of the circularized chain to T4 DNA ligase is 1 nmol: (80-120)U.

[0025] The specific point values ​​of the above-mentioned (80~120)U can be 80U, 90U, 95U, 100U, 105U, 110U or 120U, etc.

[0026] Preferably, the connection temperature is 14-20°C (for example, it can be 14°C, 15°C, 16°C, 17°C, 18°C ​​or 20°C, etc.), and the connection time is 10-20h (for example, it can be 10h, 12h, 14h, 15h, 16h, 17h, 18h or 20h, etc.).

[0027] In a second aspect, the present invention provides a method for preparing a circular deoxyribozyme, which comprises the method for intramolecular circularization of deoxyribozyme described in the first aspect, and further comprises the step of purifying the ligation product ligated under the action of T4 DNA ligase.

[0028] Preferably, the purification comprises: separating the ligation product using 10% to 15% (for example, 10%, 11%, 12%, 13%, 14% or 15%, etc.) urea gel, cutting the gel for recovery, adding icy ethanol and precipitating at -25°C to -15°C (for example, -25°C, -23°C, -21°C, -20°C, -19°C, -17°C or -15°C, etc.) for 30 to 60 minutes (for example, 30 minutes, 35 minutes, 40 minutes, 45 minutes, 50 minutes, 55 minutes or 60 minutes, etc.).

[0029] In a third aspect, the present invention provides a circular deoxyribozyme, wherein the circular deoxyribozyme is prepared by the method for intramolecular cyclization of deoxyribozyme described in the first aspect or the method for preparing the circular deoxyribozyme described in the second aspect.

[0030] In a fourth aspect, the present invention provides a method for converting the circular deoxyribozyme described in the third aspect into a linear deoxyribozyme, wherein the circular deoxyribozyme has a functional element, and the circular deoxyribozyme is opened by a trigger signal corresponding to the functional element and converted into a linear deoxyribozyme.

[0031] The method for converting a circular deoxyribozyme into a linear deoxyribozyme provided by the present invention is mainly to modify a photosensitive group or other elements such as a disulfide bond at a designated position of the deoxyribozyme and cut it using a corresponding trigger signal. 200nM of a circular deoxyribozyme with a functional element and 400nM of a corresponding substrate chain are mixed, the circular deoxyribozyme is opened using a corresponding trigger signal, and the reaction is carried out at 37°C for 1h to achieve cutting of the substrate chain.

[0032] In a fifth aspect, the present invention provides a method for restoring the catalytic activity of a DNA enzyme, wherein the linear DNA enzyme is obtained by the method for converting a circular DNA enzyme into a linear DNA enzyme as described in the fourth aspect.

[0033] In a sixth aspect, the present invention provides a method for controlling the activity of a deoxyribozyme by intramolecular cyclization, the method comprising: preparing a circular deoxyribozyme using the method for intramolecular cyclization of a deoxyribozyme described in the first aspect or the method for preparing a circular deoxyribozyme described in the second aspect, restoring the catalytic activity of the circular deoxyribozyme using the method for converting a circular deoxyribozyme into a linear deoxyribozyme described in the fourth aspect, wherein the linear deoxyribozyme has catalytic activity and the circular deoxyribozyme does not have catalytic activity, thereby achieving control over the activity of the deoxyribozyme.

[0034] In a seventh aspect, the present invention provides the use of any one of the method for intramolecular cyclization of deoxyribozymes as described in the first aspect, the method for preparing a circular deoxyribozyme as described in the second aspect, the circular deoxyribozyme as described in the third aspect, the method for converting a circular deoxyribozyme into a linear deoxyribozyme as described in the fourth aspect, the method for restoring the catalytic activity of deoxyribozymes as described in the fifth aspect, or the method for controlling the activity of deoxyribozymes by intramolecular cyclization as described in the sixth aspect, or a combination of at least two of them in controlling the catalytic activity of deoxyribozymes in living cells.

[0035] Preferably, the living cells contain RNA molecules that are specifically recognized by the DNAzyme.

[0036] Preferably, the RNA molecule includes mRNA corresponding to GFP protein or survivin protein.

[0037] In an eighth aspect, the present invention provides a method for controlling the catalytic activity of a deoxyribozyme in a living cell, the method comprising: transfecting the cyclic deoxyribozyme described in the third aspect into a living cell via lipo3000, and 3 to 5 hours after transfection, using a trigger signal corresponding to a functional element to open the cyclic deoxyribozyme and convert it into a linear structure, thereby restoring its catalytic activity.

[0038] The present invention provides a method for controlling the catalytic activity of a DNA enzyme in living cells. The method can cut a cyclic DNA enzyme containing a photosensitive group transfected into the cell by light irradiation, thereby restoring its catalytic activity and realizing spatiotemporal selective biosensing and molecular regulation.

[0039] The present invention provides a linear deoxyribozyme obtained after the circular deoxyribozyme is opened, which has the function of recognizing and cutting mRNA. After the cell transfection is completed, the cells can be lysed by using RIPA and PMSF for 15 minutes to extract proteins, and a protein immunoblotting experiment can be performed to verify the change of protein content after the circular deoxyribozyme is opened in the cell.

[0040] Other specific point values ​​within the above numerical ranges can be selected and will not be described in detail here.

[0041] Compared with the prior art, the present invention has the following beneficial effects: the cyclic DNAzyme molecule has good anti-enzymatic effect and biological stability. The method is simple and efficient, and can be used to control the catalytic activity of DNAzymes in living cells to achieve spatiotemporal selective sensing analysis and metabolic regulation of target biomolecules. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 Gel electrophoresis of the circular deoxyribozyme prepared in Example 1 of the present invention.

[0043] Figure 2 Gel electrophoresis of the circular deoxyribozyme prepared in Example 2 of the present invention.

[0044] Figure 3 Gel electrophoresis of the circular deoxyribozyme prepared in Example 3 of the present invention.

[0045] Figure 4 Gel electrophoresis of the circular deoxyribozyme prepared in Example 4 of the present invention.

[0046] Figure 5 Gel electrophoresis of the circular deoxyribozyme prepared in Example 5 of the present invention.

[0047] Figure 6 This is a graph showing the results of the anti-enzymatic effect test in Example 6 of the present invention.

[0048] Figure 7 This is a graph showing the results of the structural conversion capability test in Example 6 of the present invention.

[0049] Figure 8 This is a graph showing the results of the substrate cleavage activity test in Example 6 of the present invention.

[0050] Fig. 9 This is a graph showing the results of the test of the ability to degrade target mRNA molecules in cells in Example 6 of the present invention. DETAILED DESCRIPTION

[0051] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0052] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0053] DNA was from Sangon Biotechnology Co., Ltd., and RNA was from Hippo Biotechnology Co., Ltd.;

[0054] T4 DNA ligase, Exonuclease I, and Exonuclease III were purchased from New England Biolabs;

[0055] Lipo 3000 was purchased from Thermo Fisher Scientific;

[0056] RIPA and PMSF were purchased from Solebao Life Sciences Co., Ltd.;

[0057] Hela cells were from the American type culture collection (ATCC).

[0058] Example 1

[0059] This embodiment provides a product of intramolecular ligation of a DNA enzyme. The ligation product is formed by catalyzing the 5'-terminal phosphate group of the circular chain with its own 3'-terminal hydroxyl group to form a phosphodiester bond with the assistance of a splint chain by T4 DNA ligase. The preparation method thereof comprises the following steps:

[0060] The sequences of the ring-forming chain and the splint chain in this embodiment are shown in SEQ ID NO.1 and SEQ ID NO.3 respectively:

[0061] SEQ ID NO. 1: GAGCTGCCGCGAGCTGCAGGCTAGCTACAAC (p-L31).

[0062] SEQ ID NO. 3: CTAGTTTTCTAGCAGCTCGTTGTACGTGTTTTCACG (S36-1).

[0063] Step 1: Annealing

[0064] Add 20 μmol / L of the ring-forming chain and 60 μmol / L of the splint chain to a 200 μL reaction system, react at 80°C for 5 min, and anneal to room temperature.

[0065] Step 2: Connect

[0066] Add 100 U T4 DNA ligase to every 1 nmol of circular chain and react at 16°C for 16 h.

[0067] Step 3: Gel cutting, recovery and purification

[0068] Add loading buffer to each tube of the obtained product, heat on a 80℃ metal bath for 5min to terminate the reaction, cool on ice, recover by 12% dPAGE, and load 40μL per well. Run the gel at 200V for 30min, cut the corresponding band, add it to a 1.5mL centrifuge tube, crush it, add 600μL of 1×RB, heat on a 55℃ metal bath, overnight, centrifuge at 14000rpm for 10min the next day, and aspirate the supernatant into a new centrifuge tube. Add 200μL 1×RB to the residue, heat on a 55℃ metal bath for 120min, centrifuge under the same conditions, and aspirate the supernatant into a new centrifuge tube, 300μL per tube.

[0069] Step 4: Ice ethanol precipitation

[0070] Add 30 μL NaAc (3M, pH=5.2) to each tube and shake thoroughly and centrifuge. Since the DNA sequence used is relatively short, 2 μL of nucleic acid precipitation aid needs to be added to each tube. Finally, add 900 μL of ice ethanol, shake thoroughly and precipitate at -20℃ for 30min-1h. After precipitation, centrifuge the sample at 4℃, 14000rpm for 10min, carefully pour off the supernatant, and try not to disturb the precipitate. Then wash with 600 μL 70% ethanol, shake thoroughly, centrifuge at 20℃ 14000rpm for 5min, and repeat twice.

[0071] Step 5: DNA quantification

[0072] The precipitate obtained in the above step 4 was fully volatilized in a metal bath at 80°C to remove ethanol. An appropriate amount of water was added depending on the amount of precipitate. The mixture was fully shaken and quantified by Nanodrop with a sample loading of 1.2 μL.

[0073] Example 2

[0074] The only difference from Example 1 is that the ring-forming chain in this example contains a photosensitive group, the sequence of which is as follows; the remaining raw materials and preparation method are the same as those in Example 1.

[0075] GAGCTGCCG / iPCLinker / CGAGCTGCAGGCTAGCTACAAC(L pc-DZ eGFP ).

[0076] Example 3

[0077] The only difference from Example 1 is that the ring-forming chain in this example contains a disulfide bond, and the sequence is as follows. The other raw materials and preparation method are the same as those in Example 1.

[0078] GAGCTGCCG / iSH-HS / CGAGCTGCAGGCTAGCTACAAC(L S -DZ eGFP ).

[0079] Example 4

[0080] The only difference from Example 1 is that the sequences of the ring-forming chain and the splint chain in this example are different (their sequences are shown in SEQ ID NO.2 and SEQ ID NO.4, respectively), and the other raw materials and preparation methods are the same as those in Example 1.

[0081] SEQ ID NO.2: ACGACCGCTCCCCTCGGCCAGGCTAGCTACA(L-DZ sur )

[0082] SEQ ID NO. 4: CTAGTTTTCTAGGGTCGTTGTAGCCGTGTTTTCACG (S36-2).

[0083] Example 5

[0084] The only difference from Example 4 is that the ring-forming chain in this example contains a photosensitive group, the sequence of which is as follows; the remaining raw materials and preparation method are the same as those in Example 4.

[0085] ACGACCGCTCC / iPCLink / CCTCGGCCAGGCTAGCTACA(L pc -DZ sur )

[0086] Example 6

[0087] This example characterizes the circular deoxyribozymes prepared in Examples 1 to 5, including the anti-enzymatic effect, structural conversion ability, substrate cleavage activity, and intracellular target mRNA molecule degradation ability.

[0088] Anti-enzyme cutting effect test

[0089] The anti-enzyme effect of the circular deoxyribozymes prepared in Examples 1 and 2 was characterized in the following steps:

[0090] A portion of the obtained product was digested with two exonucleases, Exonuclease I and Exonuclease III, at the same time. The concentration of Exonuclease I was 2 U / μL, the concentration of Exonuclease III was 10 U / μL, the final concentration of DNA was 2 μM, the final volume was 20 μL, and after cleavage in a 37°C metal bath for 1 hour, an equal volume of urea and glycerol loading buffer was added, and the reaction was terminated by heating in an 80°C metal bath for 5 minutes. The results were shown in FIG. Figure 6 As shown, CL-DZ eGFP Example 1 circular deoxyribozyme, CL pc -DZ eGFP This is the circular deoxyribozyme obtained in Example 2.

[0091] It can be seen from the figure that the circular deoxyribozymes prepared in Examples 1 and 2 have good anti-enzyme cleavage effects.

[0092] Structural transformation ability test

[0093] The structural conversion ability of the circular deoxyribozyme prepared in Example 2 was characterized in the following steps:

[0094] The circular deoxyribozyme with PCLinker prepared in Example 2 was irradiated with ultraviolet light at 120 mW for 3 min, and an equal volume of urea and glycerol loading buffer was added. The reaction was terminated by heating in a metal bath at 80°C for 5 min, and the reaction was run on a 12% dPAGE gel. The results are shown in FIG. Figure 7 As shown, L-DZ eGFP Linear DNAzyme for the mRNA corresponding to eGFP, C-DZ eGFP For L-DZ eGFP cyclized form.

[0095] As can be seen from the figure, the circular deoxyribozyme with PCLinker prepared in Example 2 can open the circular deoxyribozyme under specific conditions and transform it into a linear structure.

[0096] Substrate cleavage activity test

[0097] The substrate cleavage activity of the circular deoxyribozyme prepared in Example 2 was characterized in the following steps:

[0098] 200 nM of circular DNAzyme and 400 nM of substrate were reacted at 37°C for one hour, with the same illumination conditions as mentioned above. An equal volume of urea-glycerol loading buffer was added, and the reaction was terminated by heating at 80°C in a metal bath for 5 min. The reaction was then run on 12% dPAGE. The results are shown in Figure 2. Figure 8 shown.

[0099] As can be seen from the figure, the prepared circular deoxyribozyme with functional elements can open the circular deoxyribozyme under specific conditions, transform it into a linear structure, restore its activity, and cut the substrate with an efficiency comparable to that of 10-23DNAzyme.

[0100] Intracellular target mRNA molecule degradation ability test

[0101] The target mRNA molecule degradation ability of the circular deoxyribozymes prepared in Example 4 and Example 5 was characterized in living cells, and the steps were as follows:

[0102] Step 1: Inoculate Hela cells stably expressing survivin protein in a culture dish and incubate at 37°C and 5% CO 2 Cultivated under conditions.

[0103] Step 2: Transfection

[0104] The circular deoxyribozymes prepared in Example 4 and Example 5 were transfected into Hela cells respectively by Lipo 3000.

[0105] Step 3: UV light

[0106] 4 h after transfection, 5 mW UV light was used for 10 min to break the PCLinker, and then 800 μL of culture medium was added.

[0107] Step 4: RNA extraction

[0108] After 48 h of transfection, the total RNA of each group of cells was extracted using RNA Easy Fast Cell Total RNA Extraction Kit.

[0109] Step 5: Reverse transcription of RNA into cDNA

[0110] First, gDNA Eraser was used to remove genomic DNA at 42°C for 2 min, and then reverse transcription was performed using the TB Green qPCR method to reverse transcribe part of the RNA into cDNA for subsequent experiments.

[0111] Step 6: qPCR

[0112] cDNA was subjected to qPCR analysis using the Bio-Rad iQTM6 Real-Time PCR System. In each qPCR run, five serial dilutions of a DNA standard of known concentration were used to establish a standard curve and calculate the starting quantity (SQ) of the target transcript. For each experimental sample, three replicates were performed and each serially diluted standard was assayed twice. The relative mRNA copy number of the target transcript was calculated by multiplying each individual SQ by the corresponding scaling factor from the loading control β-Actin. By dividing the median β-Actin SQ in the qPCR run by the individual β-Actin SQ, a scaling factor for that specific sample was generated. Using 1 / 2 ΔΔCt Calculate multiple reduction.

[0113] The results are as follows Fig. 9 As shown, lipo is the control group, C-DZ sur The cyclized deoxyribozyme prepared in Example 4, CL pc -DZ sur The cyclized deoxyribozyme prepared in Example 5 can effectively inhibit the deoxyribozyme cleavage activity after being cyclized. Only in the presence of functional elements and corresponding specific conditions can it be opened and its cleavage activity restored.

[0114] In summary, the present invention provides a method for controlling the structure and activity of a DNA enzyme by intramolecular cyclization, and relates to the application of the method in the field of biological analysis and regulation. The method mainly connects the DNA enzyme intramolecularly through a DNA ligase and a splint DNA chain to form a ring molecule, so that the active conformation cannot be formed and the catalytic activity is lost. At the same time, by modifying the functional elements of the DNA enzyme (such as a photosensitive group, a disulfide bond, etc.), the ring-shaped DNA enzyme can be opened under specific conditions (such as light, a reducing agent, etc.) and converted into a linear structure, thereby restoring its catalytic activity. The ring-shaped DNA enzyme molecule has good anti-enzymatic effect and biological stability. The method is simple and efficient, and can be used for controlling the catalytic activity of DNA enzymes in living cells, realizing the spatiotemporal selective sensing analysis and metabolic regulation of target biological molecules, and has a very high application value.

[0115] The applicant declares that the above is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention shall fall within the protection scope and disclosure scope of the present invention.

Claims

1. A method for intramolecular cyclization of a deoxyribozyme, characterized in that: The method for intramolecular cyclization of deoxyribozyme comprises: mixing the cyclized chain and the splint chain, annealing, adding T4 DNA ligase, and connecting under the action of T4 DNA ligase to obtain a circular deoxyribozyme; Among them, the nucleic acid sequence of the ring chain includes the sequence shown in SEQ ID NO.1 or SEQ ID NO.2, and the nucleic acid sequence of the splint chain includes the sequence shown in SEQ ID NO.3 or SEQ ID NO.

4.

2. The method for intramolecular cyclization of deoxyribozyme according to claim 1, characterized in that: The looping chain has functional elements; Preferably, the functional element comprises a photosensitive group or a disulfide bond; Preferably, the nucleic acid sequence forming the loop chain includes any one of GAGCTGCCG / iPCLinker / CGAGCTGCAGGCTAGCTACAAC, GAGCTGCCG / iSH-HS / CGAGCTGCAGGCTAGCTAC AAC or ACGACCGCTCC / iPCLink / CCTCGGCCAGGCTAGCTACA; Preferably, the molar ratio of the ring-forming chain to the splint chain is 1:(1-5); Preferably, the annealing comprises: reacting at 70-90°C for 5-10 minutes, and cooling to 20-30°C; Preferably, the ratio of the circularized chain to T4 DNA ligase is 1 nmol: (80-120) U; Preferably, the connection temperature is 14-20° C. and the connection time is 10-20 h.

3. A method for preparing a circular deoxyribozyme, characterized in that: The method for preparing the circular deoxyribozyme comprises the method for intramolecular circularization of deoxyribozyme according to claim 1 or 2, and further comprises the step of purifying the ligation product ligated under the action of T4 DNA ligase.

4. The method for preparing the circular deoxyribozyme according to claim 3, characterized in that: The purification comprises: separating the connection product using urea gel with a concentration of 10% to 15%, cutting the gel for recovery, adding icy ethanol and precipitating at -25°C to -15°C for 30 to 60 minutes.

5. A circular deoxyribozyme, characterized in that The circular deoxyribozyme is prepared by the method for intramolecular cyclization of deoxyribozyme according to claim 1 or 2 or the method for preparing the circular deoxyribozyme according to claim 3 or 4.

6. A method for converting the circular deoxyribozyme according to claim 5 into a linear deoxyribozyme, characterized in that: The circular deoxyribozyme has a functional element, and the circular deoxyribozyme is opened by a trigger signal corresponding to the functional element to be transformed into a linear deoxyribozyme.

7. Restoration of DNAzyme catalytic activity, characterized in that: The linear deoxyribozyme is prepared by the method of converting a circular deoxyribozyme into a linear deoxyribozyme as described in claim 6.

8. A method for controlling the activity of a DNA enzyme by intramolecular cyclization, characterized in that: The method for controlling the activity of a deoxyribozyme by intramolecular cyclization comprises: preparing a circular deoxyribozyme using the method for intramolecular cyclization of a deoxyribozyme according to claim 1 or 2 or the method for preparing a circular deoxyribozyme according to claim 3 or 4, and restoring the catalytic activity of the circular deoxyribozyme using the method for converting a circular deoxyribozyme into a linear deoxyribozyme according to claim 6, wherein the linear deoxyribozyme has catalytic activity and the circular deoxyribozyme has no catalytic activity, thereby achieving control over the activity of the deoxyribozyme.

9. Use of any one of the method for intramolecular cyclization of deoxyribozymes according to claim 1 or 2, the method for preparing a circular deoxyribozyme according to claim 3 or 4, the circular deoxyribozyme according to claim 5, the method for converting a circular deoxyribozyme into a linear deoxyribozyme according to claim 6, the method for restoring the catalytic activity of deoxyribozymes according to claim 7, or the method for controlling the activity of deoxyribozymes by intramolecular cyclization according to claim 8, or a combination of at least two thereof, in controlling the catalytic activity of deoxyribozymes in living cells; Preferably, the living cells contain RNA molecules specifically recognized by the DNAzyme; Preferably, the RNA molecule includes mRNA corresponding to GFP protein or survivin protein.

10. A method for controlling the catalytic activity of a DNA enzyme in a living cell, characterized in that: The method for controlling the catalytic activity of deoxyribozymes in living cells comprises: transfecting the cyclic deoxyribozyme described in claim 5 into living cells through lipo 3000, and 3 to 5 hours after transfection, using a trigger signal corresponding to the functional element to open the cyclic deoxyribozyme and convert it into a linear structure, thereby restoring its catalytic activity.

Images