VIGS silence system of hydrangea PDS gene and application of VIGS silence system

Abstract

The invention provides a VIGS silencing system of a hydrangea PDS gene and application of the VIGS silencing system, and belongs to the technical field of gene engineering. The method comprises the following steps: firstly, providing a specific nucleotide fragment of a silent hydrangea PDS gene, and constructing silent vectors pTRV2-HmPDS1 and pTRV2-HmPDS2 on the basis of the specific nucleotide fragment; the method comprises the following steps: respectively transferring vectors pTRV1 and pTRV2, and silencing vectors pTRV2-HmPDS1 and pTRV2-HmPDS2 into agrobacterium to obtain a VIGS silencing system of a hydrangea crispa PDS gene, and infecting a hydrangea crispa plant or a leaf disc by adopting the silencing system; experiments prove that the silencing system disclosed by the invention induces silencing of the hydrangea HmPDS1 and the hydrangea HmPDS2 under the mediation of agrobacterium tumefaciens; the VIGS silencing system provided by the invention can be used for quickly identifying the function of the endogenous gene on the hydrangea plant, is simple and convenient to operate, short in period and low in cost, effectively overcomes the defect that a hydrangea genetic transformation system is imperfect, and provides a technical guarantee for excavation of the hydrangea functional gene.

Description

Technical Field

[0001] The invention relates to a VIGS silencing system of a hydrangea PDS gene and application thereof, and belongs to the technical field of genetic engineering. Background Art

[0002] Virus Induced Gene Silencing (VIGS) technology is based on the plant's natural defense mechanism against RNA viruses - post-transcriptional gene silencing, which is activated when plants are infected with viruses to curb the spread of the virus. As a tool for studying gene function, VIGS technology has shown great application potential and value in field crops and horticultural crops, especially those crops whose transgenic systems are not yet mature, due to its significant advantages of convenient operation, short research cycle and low cost.

[0003] Hydrangea macrophylla (Thunb.) Ser. is a perennial ornamental plant of the genus Hydrangea in the family Hydrangeaceae. It is native to China, Japan and other places, and is now popular in Europe, Asia and America. It is known as one of the three major garden plants and five major fresh cut flowers in the world. As an emerging fashion flower, hydrangea has become the preferred choice for landscaping, home potted plants and cut flower modeling, with high ornamental and economic value. However, although hydrangea is a diploid, its genome is large, the degree of heterozygosity is high, and the transgenic technology is still imperfect, which makes the identification of hydrangea gene function more dependent on model plants, which to a certain extent restricts the excavation and accurate identification of hydrangea's excellent trait functional genes.

[0004] Phytoene dehydrogenase (PDS) is a key enzyme in the carotenoid biosynthesis pathway. Its silencing will lead to a decrease in the carotenoid content in plant leaves or tissues, causing albino or chlorotic phenotypes (such as leaf mottle, yellowing, etc.). This intuitive dominant phenotype makes it a visual marker of gene silencing effects and is widely used in virus-induced gene silencing (VIGS) systems.

[0005] At present, it is urgent to establish an efficient hydrangea VIGS silencing system, which is of great significance to the study of hydrangea gene function and genetic improvement. Summary of the invention

[0006] In view of some problems existing in the prior art, the object of the present invention is to provide a VIGS silencing system of the hydrangea PDS gene and its application, thereby realizing the simple, rapid and low-cost identification of the hydrangea phytoene desaturase gene HmPDS (Phytoenedesaturase).

[0007] In order to achieve the above technical objectives, the present invention provides the following technical solutions:

[0008] The present invention first provides a specific nucleotide fragment for silencing the hydrangea PDS gene, and the sequence of the specific nucleotide fragment is shown as SEQ ID No: 1 or SEQ ID No: 2.

[0009] The present invention also provides a VIGS silencing vector of the hydrangea PDS gene, wherein the VIGS vector comprises the specific nucleotide fragment.

[0010] The present invention also provides a method for constructing a VIGS silencing vector of the hydrangea PDS gene, the method comprising:

[0011] The specific fragment is connected to the pTRV2 vector to construct the silencing vector pTRV2-HmPDS1 or pTRV2-HmPDS2.

[0012] Furthermore, the specific fragment is obtained by PCR amplification;

[0013] The primers used to amplify the specific nucleotide fragment shown in SEQ ID No: 1 are shown in SEQ ID No: 3-4;

[0014] The primers used to amplify the specific nucleotide fragment shown in SEQ ID No: 2 are shown in SEQ ID No: 5-6.

[0015] The present invention also provides a VIGS silencing system for the PDS gene of Hydrangea elata, wherein the VIGS silencing system comprises:

[0016] Agrobacterium containing pTRV1 and Agrobacterium containing the VIGS silencing vector; the VIGS silencing vector is pTRV2-HmPDS1 or pTRV2-HmPDS2.

[0017] The present invention also provides the use of the specific nucleotide fragment, or the VIGS silencing vector, or the silencing system in silencing the hydrangea PDS gene or identifying the function of the hydrangea PDS gene.

[0018] The application includes: using the VIGS silencing system to infect hydrangea plants or leaf discs, then continuing to culture after washing, observing leaf phenotypic changes, and detecting PDS gene expression.

[0019] Among them, in the VIGS silencing system, Agrobacterium containing pTRV1 and Agrobacterium containing VIGS silencing vector are cultured in LB liquid culture medium containing kanamycin and rifampicin respectively. After the culture, the bacteria are collected and resuspended with infection solution to OD600≈1.4 to obtain Agrobacterium infection solution containing pTRV1 and Agrobacterium infection solution containing VIGS silencing vector, which are mixed and then infected; the infection solution used for resuspending the bacteria includes 10mM MgCl2, 150μM AS and 10mM MES, and the pH value is 5.6; the volume ratio of the Agrobacterium infection solution containing the pTRV1 vector to the Agrobacterium infection solution containing the VIGS silencing vector is 1:1.

[0020] Before infecting hydrangea plants or leaf discs with the VIGS silencing system, the Agrobacterium infection solution containing the pTRV1 vector and the Agrobacterium infection solution containing the VIGS silencing vector are mixed and then cultured in the dark; the dark culture conditions are: standing at room temperature for 3 to 5 hours;

[0021] The cleaning includes cleaning with distilled water, and the continued culturing includes: culturing in the dark at 8° C. for 3 days, and then placing in a constant temperature incubator for culturing in light at 25° C. / dark at 18° C., with a photoperiod of 12h / 12h and a humidity of 50%.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] (1) The present invention designs a specific nucleotide fragment based on the HmPDS gene, and on the basis of the specific nucleotide fragment, designs primers for amplifying the specific nucleotide fragment. Furthermore, a silencing vector is constructed using the amplified product, and a VIGS silencing system based on the HmPDS gene is constructed for the first time using the silencing vector. The hydrangea VIGS silencing system constructed by the present invention has a simple and time-saving process for infecting plants compared with traditional genetic transformation methods, which makes up for the shortcomings of the imperfect genetic transformation system and low transformation efficiency of hydrangea.

[0024] (2) The silencing system constructed in the present invention can silence the hydrangea PDS gene by infecting hydrangea rooting cuttings or leaf discs. Experimental verification shows that the silencing system can significantly reduce the expression level of PDS in hydrangea, with a silencing rate of 84.2%. After the present invention successfully infects hydrangea rooting cuttings, the silencing effect can last for at least 28 days, and the silencing effect on leaf discs can last for at least 14 days.

[0025] (3) The present invention provides a rapid, convenient and low-cost research method for the identification of hydrangea gene functions in the host plant, which largely avoids the problem of the expression of hydrangea genes being blocked in model plants when verifying the functions of hydrangea genes through heterologous transformation of model plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the electrophoresis diagram of the amplification of the specific nucleotide fragments of HmPDS1 and HmPDS2 in Example 1; in the figure, M is a 2000bp marker, and from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0027] Figure 2 Schematic diagram of pTRV1, pTRV2, pTRV2-HmPDS1 and pTRV2-HmPDS2 vectors in Example 1.

[0028] Figure 3 This is the positive identification detection electrophoresis diagram of Agrobacterium transformed with pTRV1, pTRV2, TRV2-HmPDS1 and TRV2-HmPDS2 in Example 1; in the figure, M is a 2000bp marker, and from top to bottom are 2000bp, 1000bp, 750bp, 500bp, 250bp, and 100bp.

[0029] Figure 4 The chlorotic phenotype of new leaves of hydrangea rooted cuttings seedlings 14d and 28d after infection with the TRV-00, TRV-HmPDS1 and TRV-HmPDS2 infection solutions in Example 1 is shown.

[0030] Figure 5 The relative expression levels of HmPDS1 and HmPDS2 genes in hydrangea cuttings and rooted seedlings after infection with TRV-00, TRV-HmPDS1 and TRV-HmPDS2 infection solutions in Example 1.

[0031] Figure 6 The figure shows the changes in chlorophyll content in the leaves of hydrangea rooting seedlings after infection with the TRV-00, TRV-HmPDS1 and TRV-HmPDS2 infection solutions in Example 1.

[0032] Figure 7 These are the chlorotic phenotypes of hydrangea leaf discs 7 and 14 days after infection with the TRV-00, TRV-HmPDS1 and TRV-HmPDS2 infection solutions in Example 2.

[0033] Figure 8 The relative expression levels of the HmPDS1 gene and the HmPDS2 gene in the hydrangea leaf discs after infection with the TRV-00, TRV-HmPDS1 and TRV-HmPDS2 infection solutions in Example 2.

[0034] Fig. 9 The figure shows the changes in chlorophyll content in hydrangea leaf discs after infection with TRV-00, TRV-HmPDS1 and TRV-HmPDS2 infection solutions in Example 2. DETAILED DESCRIPTION

[0035] In order to enable those skilled in the art to better understand the technical solution of the present invention, the preferred embodiments of the present invention are described in detail below, but the following embodiments do not limit the protection scope of the present invention.

[0036] In the embodiments of the present invention, those that are not described in detail are all completed by conventional experimental methods. Those processes involved in the embodiments that are not described in detail are all understandable and easily implementable by those skilled in the art based on the product instructions or basic knowledge in the field, and therefore are not described in detail.

[0037] The tobacco rattle virus vectors pTRV1 and pTRV2 described in the examples are commercially available.

[0038] Embodiment 1:

[0039] In this example, the hydrangea HmPDS1 and HmPDS2 were used as target genes to construct the pTRV2 recombinant vector. The vacuum suction method was used under the mediation of Agrobacterium tumefaciens GV3101 (purchased from Weidi Biotechnology, item number AC1001) to use hydrangea cutting rooted seedlings (bred by the Hydrangea Germplasm Resources Protection Center of Jiangsu Academy of Agricultural Sciences, the variety is large-flowered hydrangea 'Endless Summer', the cutting method is a public method, and the patent application with publication number CN114027040A can also be referred to) as the test material to explore the silencing time, silencing efficiency and chlorophyll changes of PDS in hydrangea cutting seedlings after virus infection.

[0040] Step S1. Construction of silencing recombinant vectors pTRV2-HmPDS1 and pTRV2-HmPDS2:

[0041] (1) Using the transcriptome of Hydrangea elata (downloaded from the NCBI database, accession number PRJNA 1062999) as a reference, all gene sequences annotated as Phytoene desaturase were extracted. The protein structure of the PDS sequences in the transcriptome was predicted using the NCBI Conserved Domain Database (https: / / www.ncbi.nlm.nih.gov / cdd) and the Protein InterPro Database (https: / / www.ebi.ac.uk / interpro / ). Genes containing complete CL38049 and PF01593 domains were selected and named HmPDS1 (as shown in SEQ ID No: 18) and HmPDS2 (as shown in SEQ ID No: 19), respectively.

[0042] (2) A specific nucleotide fragment at the 3' end of the coding sequence of HmPDS1 was selected, with a length of 504 bp, as shown in SEQ ID No: 1; a specific nucleotide fragment on the 3'-UTR of the coding sequence of HmPDS2 was selected, with a length of 506 bp, as shown in SEQ ID No: 2.

[0043] SEQ ID No: 1 is as follows:

[0044] AATCGGGTTGTTTGAAGATGAGTCGAATGATAATCTGACAGCTGAGGTTGTTAGGGAGCTTTCGGGTTGGTTTGGGGATTCAATGGTGAGGTCGTGGAGGCATTTGAGAACGTATCGAATCGGGTT TGCACAGCCGAACCAAAGCCCGCCCACGAATTTGACGAAAGACCCGAAAGTCAGGCCGGGTTTGTACATGTGTGGTGACCACCAAACTTCAGCAACATTTGATGGGGCTTTGGTGTCAGGAAGAAA AGCAGTGGAAGATTTACTAAGAGATAGGGCACTAATTCAACTTTAAAATCCTAATTTTCCCATATTTGTCTGTTTTATTCTTGTGTGTGAATTTTTGTACAATGTTCTTTTTATTCTTTGTCATATGTAATTTATTCACTGAATGTAACTACCAAAATTCTGGCCAATTGACATATATATTCTTTTTGTGTTTGTATATCAAGAATTTGACCACCTACTACCTAGTATAAGCATCATTCACACACACACATG

[0045] SEQ ID No: 2 is as follows:

[0046] GCCGGTGACTATACAAAGCAAAAGTATTTGGCCTCAATGGAAGGTGCTGTTCTATCAGGAAAGCTCTGTGCGCAAGCTATTGTACAGGATTATGAGTTACTTGTTGCTGGGGGGCAAAAAAAGCTAGTTGAGGCAAGCGTTGTCTGATATATTATCGATTGAATTGGAGGCAATTTTTTTTTTGGTAATATCCGAAATCATCCAAGGATTGGCAAAGGATCTTTAGTAATTTTAATGCCATTTGACTCTAAAAGGGAAAAAAAGAGAAAAGAAAAGAGGGAAAAAAAAATGGTTTTTTGCTTAGGCAAGCTCTTTGAAAGTCAGATCTTCTGAAGCTCTGAAAATGTGAATGAACTCTGTCTCTCTGGGAATGTTACCAACTTCCCTACTTGTTCATGTGTTGTAAAAGTATATGCTTTATTTATTTGTTTGATATAGTTTATACATAGTGGTATCTAAACTTCGAAAAATCTGTGAAATTGAGGGAATGTTTACGAGATGTTTTC

[0047] HmPDS1(SEQ ID No:18):

[0048]

[0049] HmPDS2(SEQ ID No:19):

[0050]

[0051] (3) Primers were designed using SEQ ID No: 1 and SEQ ID No: 2 as reference sequences using Primer Premier 5. The first expanded leaf of Hydrangea grandiflora 'Endless Summer' (provided by the Hydrangea Germplasm Resources Protection Center of Jiangsu Academy of Agricultural Sciences) was used as the test material, and total RNA was extracted using the Trizol kit (Invitrogen, Carlsbad, CA, USA). 1 μg RNA was used for cDNA synthesis, and the synthesis steps were referred to the HiScriptⅡ 1st Strand cDNA Synthesis Kit (Novozyme Biotech Co., Ltd.).

[0052] Table 1. Gene cloning primers

[0053]

[0054] (4) Using the cDNA obtained in step (3) as a template, the specific nucleotide fragments of HmPDS1 and HmPDS2 (SEQ ID No: 1 and SEQ ID No: 2) were amplified respectively. The PCR system was as follows:

[0055] Components Dosage cDNA 1μL 2×Hieff PCR Master Mix 25μL Primer-F 1μL Primer-R 1μL <![CDATA[ddH 2 The]]> 22μL

[0056] PCR amplification conditions are as follows:

[0057]

[0058] (5) The PCR amplification product was detected by 1% agarose gel and the target band was recovered. Figure 1 As shown in the figure, it can be seen that the target product was successfully obtained. The recovered product and the pTRV2 vector linearized by EcoRⅠ and XhoⅠ were mixed in a mass ratio of 3:1, with a total volume of 5μL, and then 5μL 2×Seamless Cloning master mix was added, and the mixture was reacted at 50℃ for 15min. The reaction product was transformed into Escherichia coli DH5α, spread on LB (containing 50mg / L kanamycin) plates, and cultured at 37℃ overnight.

[0059] (6) The single clone obtained after overnight culture in step (5) was selected, and the PCR positive colony was identified using the universal primers of the pTRV2 vector and sent for sequencing. The sequencing results were consistent with the reference sequences SEQ ID No: 1 and SEQ ID No: 2 after DNAMAN alignment, indicating that the recombinant vectors pTRV2-HmPDS1 and pTRV2-HmPDS2 were successfully constructed; the structural schematic diagram of the tobacco rattle virus vectors pTRV1, pTRV2 and the recombinant vectors pTRV2-HmPDS1, pTRV2-HmPDS2 is shown in Figure 2 shown.

[0060] Step S2. Preparation of Agrobacterium infection solution:

[0061] (1) The tobacco rattle virus vectors pTRV1 and pTRV2 and the recombinant vectors pTRV2-HmPDS1 and pTRV2-HmPDS2 were transformed into Agrobacterium tumefaciens GV3101 by freeze-thaw method, and PCR positive identification was performed using universal primers for the vectors. The results were as follows: Figure 3 As shown in the figure, it can be seen that the tobacco rattle virus vectors pTRV1, pTRV2 and the recombinant vectors pTRV2-HmPDS1, pTRV2-HmPDS2 are all clearly expressed, indicating that each vector has been successfully transformed into Agrobacterium.

[0062] Table 2. Primers for positive clone identification

[0063] Primer name Primer sequence (5'-3') TRV1-F TTACAGGTTATTTGGGCTAG (SEQ ID No: 7) TRV1-R CCGGGTTCAATTCCTTATC (SEQ ID No: 8) TRV2-F TGGGAGATGATACGCTGTT (SEQ ID No: 9) TRV2-R CCTAAAACTTCAGACACG (SEQ ID No: 10)

[0064] (2) Positive Agrobacterium colonies carrying pTRV1, pTRV2, pTRV2-HmPDS1 and pTRV2-HmPDS2 were picked respectively, inoculated into 500 μL of LB liquid culture medium (containing 50 mg / L kanamycin and 25 mg / L rifampicin), cultured at 28°C, 200 rpm, and cultured for 12-16 h to obtain positive Agrobacterium bacterial liquid.

[0065] (3) The bacterial solution obtained in step (2) was inoculated into LB liquid culture medium (containing 50 mg / L kanamycin and 25 mg / L rifampicin) at a volume ratio of 1:50, and cultured at 28° C., 200 rpm, for 12 h to obtain a cultured bacterial solution.

[0066] (4) The bacterial solution obtained in step (3) was centrifuged at 5000 rpm for 10 min, the supernatant was discarded, and the cells were resuspended in infection solution (containing 10 mM magnesium chloride, 150 μM acetosyringone and 10 mM 2-(N-morpholine)ethanesulfonic acid, pH 5.6) and the OD was adjusted. 600 ≈1.4, and the infection solutions containing pTRV1, pTRV2, pTRV2-HmPDS1 or pTRV2-HmPDS2 were obtained respectively.

[0067] (5) The impregnation solution containing pTRV1 obtained in step (4) was mixed with the impregnation solution containing pTRV2, pTRV2-HmPDS1 or pTRV2-HmPDS2 in a volume ratio of 1:1 and then allowed to stand in the dark at room temperature for 3-5 hours to obtain the impregnation solutions, which were recorded as TRV-00, TRV-HmPDS1 and TRV-HmPDS2; in subsequent experiments, the hydrangea rooting seedlings impregnated with the impregnation solution TRV-00 were used as the control group, and the hydrangea rooting seedlings impregnated with the impregnation solutions TRV-HmPDS1 and TRV-HmPDS2 were used as the experimental group.

[0068] Step S3. Infection of hydrangea cuttings:

[0069] (1) Prepare hydrangea cuttings for rooting. Wash the roots and remove old leaves.

[0070] (2) The seedlings treated in step (1) were completely immersed in the Agrobacterium infection solutions TRV-00, TRV-HmPDS1 and TRV-HmPDS2 respectively, which had been left to stand in step S2. The vacuum suction method was used with a pressure of 0.08 MPa. The vacuum time was maintained for 10 minutes, and the air was slowly released. The vacuum was repeated 2-3 times until more than 80% of the hydrangea seedlings were waterlogged.

[0071] (3) Take out the seedlings after vacuum suction in step (2), rinse them with tap water 5 times, and then rinse them with distilled water 5 times. Use absorbent paper to wipe off excess water from the rinsed seedlings, place the roots of the seedlings in distilled water, balance in the dark at 8°C for 2 days, and then transplant them into nutrient soil and cultivate them in a plant cultivation room for observation. The plant cultivation conditions are: 25°C light cultivation / 18°C dark cultivation, photoperiod 12h / 12h, and humidity of about 50%.

[0072] Step S4. Observation of silenced plant phenotypes and effect statistics:

[0073] (1) Phenotypic observation of hydrangea cuttings after silencing:

[0074] The PDS gene is a key gene for chlorophyll synthesis, and its lack of expression can cause plant leaves to turn green, flowers to turn yellow, or even turn white. Therefore, we continued to observe the color changes of new leaves of hydrangea cuttings after infection to preliminarily determine whether VIGS can cause a decrease in PDS expression.

[0075] The phenotypes of rooted hydrangea cuttings 14 and 28 days after being treated with the dyes TRV-00, TRV-HmPDS1 and TRV-HmPDS2, respectively, are as follows: Figure 4As can be seen from the figure, compared with the control group (TRV-00), the new leaves of the seedlings in the experimental groups (TRV-HmPDS1 and TRV-HmPDS2) showed obvious chlorosis 14 days after the HmPDS1 and HmPDS2 genes were silenced; and in the plants 28 days after silencing, the chlorosis effect of the new leaves of the seedlings infected with TRV-HmPDS1 was still significant, and the green part of the new leaves of the seedlings infected with TRV-HmPDS2 was restored.

[0076] (2) Detection of the expression levels of HmPDS1 and HmPDS2 after silencing of rooted hydrangea cuttings:

[0077] New leaves of hydrangea rooted cuttings 14 days and 28 days after infection with TRV-00, TRV-HmPDS1 and TRV-HmPDS2 were taken and quickly frozen in liquid nitrogen. RNA was extracted and cDNA was synthesized according to the method in step S1(3). The cDNA was diluted 5 times and used as a template. Real-time fluorescence quantitative PCR (qRT-PCR) was performed on LightCycler480 (ROCHE) using TB Green Premix Ex TaqTM (purchased from Takara Biotechnology (Dalian) Co., Ltd.). HmUPL was used as the internal reference gene according to 2 -ΔΔCt The relative gene expression was calculated.

[0078] The sequence of the HmUPL gene (SEQ ID No: 11) is as follows:

[0079] GCCACGTACTCACACTTGCTGTTAGTTCTAGATGACATAGAGTTCTACGAAAAACAGGTCCCTTTCTCATTGGAGCAGCAACAAAGAATTGCTTCAATGCTAAATACGTTAGTGTATGGTGGTTTGTCCCATGGTGTCATCTACCAGAGTAAACCTCTTTTGGATGTTGCAATTCGATGCCTGCATTTGTTGTATGAAAGGGATTGCAGGCACAGA

[0080] Table 3. Quantification primer sequences

[0081] Primer name Primer sequence (5'-3') qRCR-HmPDS1-F AATCGCCTCCAGGAAGATAAGGCTA(SEQ ID No: 12) qRCR-HmPDS1-R GGTGAGAGGAGAGAGAAAGGGAA (SEQ ID No: 13) qRCR-HmPDS2-F AGATGGATAAATTAGTTGGCGTTCC (SEQ ID No: 14) qRCR-HmPDS2-R TCCAGCATAGATTGATTTGGGTTGTA(SEQ ID No: 15) qRCR-HmUPL-F GCCACGTACTCACACTTGCT(SEQ ID No: 16) qRCR-HmUPL-R TCTGTGCCTGCAATCCCTTT (SEQ ID No: 17)

[0082] The results are as follows Figure 5The results showed that compared with the expression level of HmPDS1 gene in the control group (TRV-00), the silencing efficiency of HmPDS1 gene in the experimental group could reach 84.2% 14 days after silencing, and the silencing efficiency was 58.2% 28 days after silencing, and the expression level of HmPDS1 gene decreased significantly; the silencing efficiency of HmPDS2 gene in the experimental group could reach 54.7% 14 days after silencing, and the expression level of HmPDS2 gene 28 days after silencing was not significantly different from that in the control group, indicating that the silencing effect of HmPDS1 can last until 28 days after infection, and it is more suitable as a silencing marker gene.

[0083] (3) Detection of chlorophyll content in leaves of hydrangea rooted cuttings after silencing:

[0084] Take 0.2 g of new leaves of cutting seedlings 14 days after infection with the dyes TRV-00, TRV-HmPDS1 and TRV-HmPDS2, cut them into pieces and immerse them in 25 mL of acetone-ethanol extract (volume ratio 1:1). Extract them in the dark at 37 °C for 24 h until the leaves turn white. Use the extract to make each tube 25 mL. Measure the OD value of each treatment extract on a UV spectrophotometer. 663 OD 645 and OD 652 . Calculate the chlorophyll a, chlorophyll b and total chlorophyll contents according to the following formula.

[0085] Ca=12.7D663-2.69D645 Chlorophyll a(mg / g)=Ca×V / W

[0086] Cb=22.9D645-4.68D663 Chlorophyll b(mg / g)=Cb×V / W

[0087] Ct=(D652 / 34.5)×1000(mg / L) Total chlorophyll (mg / g)=Ct×V / W

[0088] The results are as follows Figure 6 The results showed that compared with the control group (TRV-00), the chlorophyll a, chlorophyll b and total chlorophyll in the new leaves of the plants in the experimental group 14 days after silencing the HmPDS1 gene or HmPDS2 gene were extremely significant.

[0089] In summary, the present invention designs and selects a specific nucleotide sequence fragment for silencing the hydrangea HmPDS gene for silencing the gene. Different from the silencing method disclosed in the prior art, based on the specific nucleotide sequence provided by the present invention, the present invention constructs a silencing system. The plants in the experimental groups HmPDS1 and HmPDS2 had obvious leaf fading phenotype 14 days after infection, and the silencing efficiency reached 84.2%, which is earlier than the time when leaf chlorosis was observed 30 days after infection reported in the prior art. The observation of the leaf chlorosis phenotype is an intuitive phenotype for judging whether the silencing of the PDS gene is successful, indicating that the VIGS silencing system of the present invention can take effect 14 days after the gene silencing of the cutting rooting seedlings, which helps to shorten the test cycle when the VIGS system is applied.

[0090] Embodiment 2:

[0091] The pTRV2 recombinant vector was constructed with the hydrangea HmPDS1 and HmPDS2 genes as target genes. The vacuum aspiration method was used to mediate Agrobacterium tumefaciens and hydrangea detached leaf discs (provided by the Hydrangea Germplasm Resources Protection Center of Jiangsu Academy of Agricultural Sciences) as test materials to explore the silencing time, silencing efficiency and chlorophyll changes of PDS in hydrangea leaf discs after virus infection.

[0092] The specific process of this embodiment is divided into the following four steps:

[0093] S1. Construction of silent recombinant vectors pTRV2-HmPDS1 and pTRV2-HmPDS2;

[0094] S2. Preparation of Agrobacterium infection solution;

[0095] S3. Infection of detached hydrangea leaf discs;

[0096] S4. Observation of silenced plant phenotypes and effect statistics.

[0097] Step S1 and step S2 are the same as those in Example 1.

[0098] Step S3 The infection of hydrangea in vitro leaf discs includes the following steps: first, the plant material is a biennial, vigorous, disease- and insect-free hydrangea seedling (provided by the Hydrangea Germplasm Resource Protection Center of Jiangsu Academy of Agricultural Sciences), and the 3rd and 4th nodes of the opposite leaves are counted from top to bottom, and the leaves are punched into discs using a hole puncher; secondly, the leaf discs are immersed in the infection solution TRV-00, TRV-HmPDS1 or TRV-HmPDS2 described in Example 1, and the bacterial solution is introduced into the leaf discs by vacuum suction. The infected leaf discs are cleaned with tap water and distilled water; finally, the leaf discs are wiped dry with absorbent paper, placed on a 0.4% agar plate, balanced in the dark at 8°C for 3 days, and then transferred to a plant incubator for observation. The plant culture conditions are: 25°C light culture / 18°C dark culture, photoperiod 12h / 12h, and humidity of about 50%.

[0099] The phenotypic observation and effect statistics of the silent leaves in step S4 are as follows:

[0100] (1) Phenotypic observation after silencing of hydrangea leaf discs:

[0101] Observe the chlorosis of the leaf discs after silencing HmPDS1 and HmPDS2 in hydrangea. Figure 7 It was shown that compared with the chlorosis of leaf discs in the control group (TRV-00), the leaf discs in the experimental group showed slight chlorosis 7 days after silencing of the HmPDS1 gene and HmPDS2 gene, and showed obvious chlorosis 14 days after silencing.

[0102] (2) Detection of the expression levels of HmPDS1 and HmPDS2 after silencing of hydrangea leaf discs:

[0103] The determination method is the same as in Example 1. The results are as follows Figure 8 As shown in the figure, compared with the control group (TRV-00), the silencing efficiency of HmPDS1 gene in the experimental group reached 66.5% after 7 days of silencing, and 43.4% after 14 days of silencing; the silencing efficiency of HmPDS2 gene in the experimental group reached 59.8% after 7 days of silencing, and 31.3% after 14 days of silencing. The expression levels of HmPDS1 gene and HmPDS2 gene in leaf discs were significantly reduced at 14 days of infection, indicating that the silencing effect of HmPDS1 and HmPDS2 in leaf discs can last for at least 14 days.

[0104] (3) Detection of chlorophyll content in leaf discs after HmPDS1 and HmPDS2 silencing

[0105] The determination method was the same as in Example 1, and the changes in chlorophyll content in leaf discs 14 days after HmPDS1 and HmPDS2 were silenced were detected. Fig. 9: Compared with the control group (TRV-00), 14 days after silencing the HmPDS1 gene and HmPDS2 gene, the chlorophyll a, chlorophyll b and total chlorophyll in the leaf discs of the experimental group were extremely significant.

[0106] The above embodiments are preferred implementation modes of the present invention, but the present invention is not limited to the above embodiments. Any obvious improvements, substitutions or modifications that can be made by those skilled in the art without departing from the essential content of the present invention belong to the protection scope of the present invention.

Claims

1. A specific nucleotide fragment for silencing the PDS gene of Hydrangea truncatula, characterized in that: The sequence of the specific nucleotide fragment is shown as SEQ ID No: 1 or SEQ ID No:

2.

2. VIGS silencing vector of hydrangea PDS gene, characterized in that: The VIGS silencing vector comprises the specific nucleotide fragment according to claim 1.

3. The method for constructing the VIGS silencing vector of the hydrangea PDS gene according to claim 2, characterized in that: The construction method comprises: The specific nucleotide fragment according to claim 1 is connected to the pTRV2 vector to construct the silencing vector pTRV2-HmPDS1 or pTRV2-HmPDS2.

4. The method for constructing the VIGS silencing vector of the hydrangea PDS gene according to claim 3, characterized in that: The specific nucleotide fragment is obtained by PCR amplification; The primers used to amplify the specific nucleotide fragment shown in SEQ ID No: 1 are shown in SEQ ID No: 3-4; The primers used to amplify the specific nucleotide fragment shown in SEQ ID No: 2 are shown in SEQ ID No: 5-6.

5. The VIGS silencing system of the hydrangea PDS gene is characterized by: The VIGS silencing system comprises: Agrobacterium containing the vector pTRV1 and Agrobacterium containing the VIGS silencing vector of claim 2.

6. Use of the specific nucleotide fragment according to claim 1, or the VIGS silencing vector according to claim 2, or the VIGS silencing vector constructed by the method according to any one of claims 3-4, or the VIGS silencing system according to claim 5 in silencing the hydrangea PDS gene or identifying the function of the hydrangea PDS gene.

7. The use according to claim 6, characterized in that: include: The VIGS silencing system of claim 5 is used to infect hydrangea plants or leaf discs, which are then washed and cultured continuously to observe leaf phenotypic changes and detect the expression of the PDS gene.

8. The use according to claim 7, characterized in that: In the VIGS silencing system, Agrobacterium containing the vector pTRV1 and the Agrobacterium containing the VIGS silencing vector according to claim 2 were cultured in LB liquid medium containing kanamycin and rifampicin, and the cells were collected and resuspended in the infection solution to an OD of 600 ≈1.4, obtaining an Agrobacterium infection solution containing the pTRV1 vector and an Agrobacterium infection solution containing the VIGS silencing vector according to claim 2, mixing them and then infecting; The infection solution used for resuspension of the bacteria includes 10 mM MgCl2, 150 μM AS and 10 mM MES, and the pH value is 5.

6.

9. The use according to claim 8, characterized in that: The volume ratio of the Agrobacterium infection solution containing the pTRV1 vector to the Agrobacterium infection solution containing the VIGS silencing vector according to claim 2 is 1:

1.

10. The use according to claim 8, characterized in that: Before infecting hydrangea plants or leaf discs with the VIGS silencing system, the Agrobacterium infection solution containing the pTRV1 vector and the Agrobacterium infection solution containing the VIGS silencing vector are mixed and then cultured in the dark; the dark culture conditions are: standing at room temperature for 3-5 hours; The cleaning includes cleaning with distilled water, and the continued culturing includes: culturing in the dark at 8° C. for 3 days, and then placing in a constant temperature incubator for culturing in light at 25° C. / dark at 18° C., with a photoperiod of 12h / 12h and a humidity of 50%.

Images